The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	846166	866534	5496245	transposase,integrase,holin	Stx2-converting_phage(53.85%)	23	843922:843938	868270:868286
843922:843938	attL	CATGATTGGCTGGCGTC	NA	NA	NA	NA
WP_000624681.1|846166_846517_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_000998048.1|846739_848278_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|848327_848675_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|848865_850078_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|850579_850927_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|850923_851304_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|851660_852005_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|852009_852225_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|852374_854228_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|854635_854803_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|854888_855632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|855884_856508_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|856504_857170_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|857166_857778_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|857752_858319_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|858678_859434_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001418122.1|859436_859772_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000150579.1|859847_861080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|861475_861889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|861986_862385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059531.1|862385_864017_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000428092.1|864013_865327_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|865328_866534_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
868270:868286	attR	GACGCCAGCCAATCATG	NA	NA	NA	NA
>prophage 2
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	1237496	1244548	5496245	transposase,tail	Enterobacteria_phage(50.0%)	8	NA	NA
WP_162829202.1|1237496_1238710_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1238927_1239197_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1239357_1239780_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1239909_1240968_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1241046_1241697_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132158.1|1241879_1242470_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1242971_1243220_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1244065_1244548_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 3
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	1522126	1527552	5496245	integrase	Enterobacteria_phage(50.0%)	6	1511114:1511130	1529748:1529764
1511114:1511130	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1522126_1522696_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1522695_1523163_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1523149_1523830_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1523839_1524976_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1525150_1526308_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1526619_1527552_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1529748:1529764	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	1773171	1877046	5496245	protease,terminase,tRNA,holin,transposase,portal,tail	Enterobacteria_phage(63.86%)	118	NA	NA
WP_000569336.1|1773171_1774098_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1774102_1774834_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1774814_1774922_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1774981_1775683_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1775703_1776990_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1777023_1777278_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1777296_1777431_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1777434_1777677_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1777764_1778127_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1778123_1778480_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001304101.1|1778813_1778990_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	98.3	3.0e-27
WP_001289954.1|1778991_1779939_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1779935_1780157_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1780255_1780537_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1780547_1780739_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1780711_1780894_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1780893_1781571_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1781567_1782353_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1782358_1782655_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372942.1|1782730_1782874_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1782842_1783007_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1783079_1783448_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|1783708_1784290_+	super-infection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1784306_1784579_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1785091_1785643_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1785649_1785931_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1786053_1786701_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1786809_1787028_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|1787142_1787439_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_000185456.1|1787471_1788410_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788906.1|1788406_1789108_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|1789104_1789395_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|1789465_1789744_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1789876_1790092_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1790102_1790339_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|1790295_1790742_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|1790738_1791266_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|1791262_1791439_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|1791441_1791843_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|1791802_1792012_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|1792004_1792610_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|1792606_1792801_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1792793_1793228_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|1793734_1794682_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1794691_1794961_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874257.1|1795471_1797418_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000143458.1|1797555_1797735_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1797775_1798021_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1798098_1798314_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1798318_1798852_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1799122_1799692_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1799691_1799838_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1800065_1800251_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1800462_1800735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1800767_1801244_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1801240_1803364_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1803360_1803573_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1803572_1805075_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001097065.1|1807130_1807457_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1807449_1807731_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1807733_1808357_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1808369_1808768_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1808775_1809528_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1809541_1809964_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1809990_1810299_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|1810342_1812988_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1812984_1813314_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1813313_1814012_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1814022_1814766_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1814711_1815341_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001356361.1|1815581_1816757_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_115801855.1|1816708_1819054_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001228289.1|1819121_1819721_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_001302809.1|1819785_1821099_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1821100_1821370_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1821737_1821986_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1822500_1824186_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1824182_1824902_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001302807.1|1824948_1825419_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.3e-81
WP_001295429.1|1825460_1825922_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_164848152.1|1826105_1827318_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302810.1|1829359_1830496_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1830488_1831220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1831238_1832768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1832778_1833867_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1835107_1835425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1835486_1839116_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1846073_1848107_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1848238_1849348_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1849609_1849891_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1850182_1850725_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1850812_1851487_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1851502_1853983_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1853993_1855028_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1855109_1855448_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1855665_1856517_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1856637_1856910_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1857019_1857334_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1857343_1857691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1858741_1858981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1859314_1860103_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1860099_1860900_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1860964_1861783_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1861834_1862581_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1862554_1863520_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1863516_1864521_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1864517_1865795_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1866051_1867104_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1867402_1868257_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1868285_1869548_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1869557_1870010_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1870040_1870325_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1870328_1871684_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1871731_1872772_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1872871_1873651_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1873732_1874632_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1875037_1875355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1875684_1877046_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 5
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	1975059	2047456	5496245	head,terminase,holin,transposase,capsid,integrase,portal,tail	Enterobacteria_phage(32.65%)	72	1974566:1974581	2031645:2031660
1974566:1974581	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_162829204.1|1975059_1976273_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|1976644_1978792_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|1980239_1981778_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1981827_1982175_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1982171_1982552_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|1982913_1983459_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1983455_1984199_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1984210_1985290_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1985351_1986287_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1986743_1987661_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1987762_1988713_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|1991099_1991816_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1992158_1993613_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1993714_1995031_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1995344_1996397_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|1996658_2004641_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2005130_2005928_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2006163_2007186_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2007185_2007389_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2007447_2009919_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2010014_2010203_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2010199_2010388_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2010868_2011021_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2011295_2011940_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2012037_2012265_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2012261_2012687_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2012755_2013793_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2013704_2014247_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2014281_2014980_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2015001_2015226_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2015222_2015579_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2015611_2015764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2015760_2016072_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2016198_2016762_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2016871_2016976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2017162_2017375_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2017542_2017821_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2017822_2018872_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2018884_2019244_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2019240_2019930_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2020563_2020992_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2021469_2023320_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2023401_2024615_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2024925_2025141_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2025145_2025490_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2025540_2026074_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2026229_2026412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2026424_2026556_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2026783_2026969_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2027495_2027810_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2027891_2028116_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2028510_2029020_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2028991_2030920_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2030903_2031110_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2031106_2032699_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2031645:2031660	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|2032688_2034194_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2034230_2034578_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2034635_2034902_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2034883_2035624_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2035637_2036069_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2036095_2036509_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001455418.1|2036489_2038352_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_001304129.1|2038303_2039068_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	98.0	3.3e-134
WP_000847298.1|2039064_2039394_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2039393_2040092_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2040102_2040846_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_127446151.1|2040791_2041421_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_001413764.1|2041661_2042837_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_115801853.1|2042788_2045140_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|2045207_2045807_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268861.1|2045871_2047185_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|2047186_2047456_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	2105036	2125019	5496245	transposase,integrase,tail	Enterobacteria_phage(75.0%)	28	2118155:2118168	2128161:2128174
WP_032161728.1|2105036_2106170_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|2106120_2106444_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2106601_2107786_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2107785_2108298_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2108352_2108718_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2108726_2108882_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2111684_2112173_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2112329_2112902_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2112945_2113476_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2114567_2114882_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|2114886_2115846_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123463.1|2115922_2118745_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2118155:2118168	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2118751_2119117_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001413181.1|2119113_2119731_-	ash family protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000104305.1|2119742_2120042_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2120038_2120305_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2120301_2120505_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2120528_2120945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2121037_2121151_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2121147_2121390_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2121401_2121680_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2121690_2122041_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2122062_2122266_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2122337_2122475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2122564_2122969_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2122984_2123635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2123664_2124012_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2124017_2125019_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2128161:2128174	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	2445565	2561726	5496245	tail,head,terminase,holin,transposase,capsid,portal,protease	Enterobacteria_phage(29.73%)	141	NA	NA
WP_001260835.1|2445565_2446387_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2446486_2446570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2446662_2446998_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2447394_2448648_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2448754_2449648_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2449782_2451003_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2451127_2451823_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2451775_2453068_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2453225_2453840_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2453882_2454737_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2454738_2455356_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2455366_2457790_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2457850_2460277_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2460475_2460781_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2460888_2461599_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2461601_2462162_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2462196_2462538_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2462672_2462999_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2463987_2464239_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2464311_2466783_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2466875_2467067_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2467063_2467252_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2467652_2467817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2467820_2468039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2468110_2468410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2468762_2469041_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2469042_2469234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2469254_2469626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2469723_2470026_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2470022_2470448_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2470470_2471433_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2471439_2472180_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2472990_2473386_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2473442_2474027_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2474142_2474247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2474435_2474648_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2474815_2475094_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2475095_2476145_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2476157_2476517_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2476513_2477203_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2477841_2478270_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2478748_2480599_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2481038_2481254_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2481258_2481603_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2481653_2482187_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2482457_2483027_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2483026_2483173_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2483400_2483586_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2484010_2484238_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2484279_2484645_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2484934_2485498_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001304106.1|2485494_2487156_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|2487219_2489157_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|2489201_2489423_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|2489368_2491948_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|2491950_2492277_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2492286_2492637_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2492633_2493080_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2493076_2493421_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2493486_2494203_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2494217_2494592_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2494687_2494897_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212822.1|2494944_2498187_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_000807954.1|2498179_2498521_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179481.1|2498520_2499219_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|2499229_2499973_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2499918_2500551_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2500892_2502068_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_001230508.1|2504434_2505034_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2505098_2506322_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2506323_2506593_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|2507992_2508643_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2509225_2510764_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2510813_2511161_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2511157_2511538_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2512500_2512743_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2513453_2514698_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2514790_2514979_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2514975_2515164_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2515728_2515938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2515938_2516577_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2516588_2516741_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2517033_2517372_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2517763_2518006_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2517989_2518415_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2518483_2519527_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2519519_2519981_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2520014_2520731_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2520763_2521045_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2521041_2521269_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2521261_2521573_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2521700_2521919_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2521920_2522478_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2522711_2522924_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2523043_2523388_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2523509_2523782_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2523783_2524833_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2524845_2525151_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2525213_2525768_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2525992_2526190_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2526325_2527039_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2527489_2527921_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2528398_2530249_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2530687_2530903_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2530907_2531252_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2531302_2531836_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2532106_2532676_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2532675_2532822_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2533044_2533230_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2533755_2534070_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2534151_2534376_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867493.1|2534762_2535308_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|2535282_2537208_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2537204_2537411_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2537407_2539009_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2538989_2540309_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2540318_2540651_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2540706_2541732_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2541773_2542172_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2542183_2542537_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2542551_2543085_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2543081_2543477_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2543484_2544237_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2544250_2544673_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2544699_2545113_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2545093_2547706_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2547702_2548032_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2548031_2548730_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2548740_2549484_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2549429_2550059_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514945.1|2550299_2553779_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_001230508.1|2553846_2554446_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2554510_2555734_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2555735_2556005_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|2556118_2556694_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2556766_2557396_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|2557477_2558119_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001120551.1|2558280_2558523_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2558654_2559938_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2560026_2561487_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2561522_2561726_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	2743693	2801411	5496245	head,terminase,tRNA,holin,capsid,tail	Escherichia_phage(42.19%)	70	NA	NA
WP_001295593.1|2743693_2744128_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2744708_2745350_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2745431_2746061_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2746133_2746709_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2746821_2747091_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2747092_2748406_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2748470_2749070_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2749140_2752638_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2752771_2753299_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2753489_2754122_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2754067_2754811_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2754821_2755520_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2755519_2755861_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212768.1|2755853_2758934_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|2758985_2759195_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2759290_2759665_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275479.1|2759670_2760387_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2760455_2760800_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2760796_2761243_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2761239_2761590_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2761599_2761926_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2764452_2764674_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2764718_2766656_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001304172.1|2766719_2768381_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|2768377_2768941_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2769229_2769595_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2769636_2769837_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2769968_2770295_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|2770695_2770881_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2771103_2771235_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|2771329_2772025_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|2772298_2772832_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|2772882_2773227_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2773231_2773447_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143079.1|2773596_2775450_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|2776024_2776456_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2777017_2777572_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2777568_2777859_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2777858_2778458_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2778957_2780349_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000016656.1|2780348_2781338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2781305_2782457_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2782888_2783134_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2783212_2783374_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2783384_2783648_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2783899_2784112_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2784217_2784640_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2784655_2785417_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2785439_2786186_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2786192_2786981_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2787058_2787481_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2787477_2787732_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2787811_2788231_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2788473_2788653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2788663_2788819_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2788815_2789304_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2789745_2789967_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2789966_2790137_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2790211_2790487_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2790588_2793189_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2793181_2793991_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2794046_2794196_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2794233_2794422_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2794521_2794737_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2794738_2795974_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2796025_2796961_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|2797089_2798463_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001625136.1|2798495_2798666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2798940_2799924_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2800178_2801411_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 9
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	2886357	2959896	5496245	protease,head,terminase,holin,transposase,capsid,integrase,tail	Stx2-converting_phage(40.38%)	80	2901859:2901886	2960033:2960060
WP_000422055.1|2886357_2887407_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2887626_2888385_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2888381_2888972_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2889011_2889884_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2890096_2891680_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2891707_2892328_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2892324_2893206_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2893343_2893388_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2893479_2895042_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2895041_2896637_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2896637_2897999_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2898010_2899204_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2899203_2900010_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2900390_2900570_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2900655_2901156_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2901201_2901708_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2901859:2901886	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001144877.1|2905178_2905769_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2905952_2906600_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2906736_2906883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2907310_2907589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2907928_2908309_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2908305_2908653_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2908702_2910241_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2911206_2911776_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2911841_2912753_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2912859_2912982_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2914579_2915905_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2916931_2917201_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2917202_2918516_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2918667_2919267_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000514792.1|2919334_2922811_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_001152128.1|2922998_2923436_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|2923435_2923777_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212897.1|2923769_2926850_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
WP_001453698.1|2926902_2927112_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2927207_2927582_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275500.1|2927587_2928304_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	3.1e-126
WP_000133388.1|2928362_2928707_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2928703_2929150_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2929146_2929497_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2929506_2929833_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063094.1|2932359_2932581_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|2932625_2934563_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|2934626_2936288_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2936284_2936848_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2937137_2937503_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2937544_2937772_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2938196_2938382_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2938609_2938756_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2938755_2939325_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2939595_2940129_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2940179_2940524_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2940528_2940744_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2940893_2942747_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2943543_2944602_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2944752_2944950_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2945191_2945722_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2945730_2946090_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2946102_2947149_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2947150_2947429_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2947498_2947756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2947976_2948189_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2948467_2949226_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2949924_2950089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2950085_2950667_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2950853_2951396_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2951307_2952348_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2952319_2952871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2952854_2953082_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2953158_2953566_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2953829_2954129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2954201_2954420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2954442_2954850_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2954827_2955061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|2955054_2955198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2955534_2955723_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2955719_2955911_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2956003_2958475_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2958539_2958788_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2958765_2959896_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2960033:2960060	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 10
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	3006592	3178807	5496245	protease,head,terminase,tRNA,holin,transposase,capsid,lysis,integrase,portal,tail	Enterobacteria_phage(32.5%)	196	3039307:3039322	3185464:3185484
WP_001299679.1|3006592_3007849_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3008062_3008686_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3008685_3009537_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3009687_3010635_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3010759_3012439_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3012493_3012772_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3013049_3013634_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3013750_3014842_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|3017663_3018734_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3018744_3019377_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3019387_3020806_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000060146.1|3023150_3024173_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3024172_3025153_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3025149_3025908_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3026726_3027581_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3027606_3029577_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3029626_3029881_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_162829200.1|3030729_3031942_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001295616.1|3032130_3032742_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3032841_3033756_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3033851_3035588_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3035979_3037050_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3037059_3038358_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3038720_3040253_+	SpoVR family protein	NA	NA	NA	NA	NA
3039307:3039322	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3040304_3041024_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
3039307:3039322	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000406391.1|3041245_3042787_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3042932_3043463_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3043508_3044777_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3044776_3045196_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3045568_3046480_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3046686_3047148_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3047224_3047884_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3047955_3048249_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3048260_3048419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3048489_3048891_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3048993_3049362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3049881_3050577_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3050600_3051413_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3051416_3051683_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3052848_3054062_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3054235_3054820_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3055318_3056272_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3056458_3057943_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3058245_3059784_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3059833_3060181_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3060177_3060558_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3060633_3060882_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3060938_3061607_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3062104_3062287_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3062365_3062866_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3062902_3063409_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3063427_3064318_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|3064437_3065019_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_171878222.1|3065018_3067940_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3068004_3068604_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3068670_3072069_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3072129_3072762_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3072698_3073442_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3073447_3074146_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3074145_3074475_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3074471_3077021_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3077013_3077448_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3077429_3077852_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3077867_3078608_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3078615_3079011_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3079007_3079586_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3079597_3079951_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3079962_3080361_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3080402_3081428_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3081483_3081816_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3081825_3083145_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3083125_3084727_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3084723_3084930_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3084926_3086852_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3086826_3087372_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3087760_3087955_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3088119_3088326_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3088611_3089022_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3089313_3089607_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3089697_3089880_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3090096_3090573_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3090559_3090865_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3091186_3091876_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3091872_3092013_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3092009_3092372_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3092368_3092659_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3092651_3092822_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3092821_3093277_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3093778_3095305_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3095362_3095485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3095549_3095882_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3095949_3096252_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3096248_3096950_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3097874_3098111_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3098100_3099243_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3099356_3100607_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3100778_3101432_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3101441_3101903_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3101956_3103063_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3103098_3103740_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3103743_3105114_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3105032:3105047	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3105282_3105954_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
3105032:3105047	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000735407.1|3105953_3107414_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133425.1|3108270_3108552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127900.1|3108565_3110227_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	9.8e-277
WP_000113645.1|3110210_3110567_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3110690_3110873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|3110856_3111297_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|3111296_3111593_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|3111589_3111928_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000267612.1|3111924_3113136_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_000504050.1|3113137_3113710_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|3113749_3114907_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|3115199_3115424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|3115548_3115821_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|3115831_3116242_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|3116238_3116490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|3116860_3118993_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|3118989_3119289_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|3119294_3119537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|3119526_3119718_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|3119717_3119903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|3119895_3120093_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|3120118_3120862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|3120919_3121108_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|3121472_3122702_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|3122950_3124072_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3124120_3125347_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3125596_3126733_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3126716_3127580_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3127943_3129305_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3129365_3129641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3131949_3135351_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3135941_3138290_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3138309_3138399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3138411_3138648_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3138593_3139331_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3139384_3140263_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3140565_3140676_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3140785_3141040_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|3141056_3141755_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|3141754_3142096_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|3142088_3145331_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3145383_3145593_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3145688_3146063_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|3146068_3146785_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|3146843_3147188_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3147184_3147631_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3147627_3147978_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3147987_3148314_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_171878223.1|3148393_3150895_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.0	0.0e+00
WP_001063099.1|3150840_3151062_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3151106_3153044_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3153107_3154769_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3154765_3155329_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3155618_3155984_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3156025_3156211_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3156340_3156481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3156837_3157062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3157126_3157333_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3157560_3157707_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3157706_3158276_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3158546_3159080_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3159130_3159475_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3159479_3159695_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3159770_3160040_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3160077_3160260_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3160407_3162345_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3162659_3162827_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3163423_3164245_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3164241_3164616_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265168.1|3164628_3165678_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3165679_3165958_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3166125_3166338_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3166526_3166631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3166746_3167334_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3167336_3167528_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3167529_3167967_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3167953_3168271_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3168224_3168542_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3168531_3168834_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3168830_3169112_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3169144_3169861_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3169894_3170437_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3170348_3171386_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3171454_3171880_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3171863_3172187_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3172311_3172788_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3173103_3173256_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3173370_3173886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3174018_3174408_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3174469_3174739_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3174707_3175826_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3175992_3176787_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3176783_3177830_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3177985_3178807_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3185464:3185484	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	3406282	3557368	5496245	protease,portal,head,terminase,holin,transposase,capsid,integrase,bacteriocin,tail	Escherichia_phage(47.41%)	179	3503914:3503929	3559133:3559148
WP_001028088.1|3406282_3406777_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|3406797_3408126_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|3408208_3408316_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_000203825.1|3409274_3409904_+	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_000763353.1|3409951_3410173_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|3410169_3410454_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_001120841.1|3410931_3411339_+	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	99.3	7.1e-80
WP_000426668.1|3411338_3411734_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|3411967_3412180_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|3412299_3412644_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000331690.1|3413194_3421576_-	hypothetical protein	NA	A0A0N7C080	Escherichia_phage	100.0	0.0e+00
WP_000012450.1|3421645_3422911_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3422921_3423173_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|3423182_3423629_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|3423631_3424288_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3424381_3424783_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3424839_3424980_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|3425212_3425947_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|3426037_3426655_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3426660_3426939_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|3426953_3428222_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|3428218_3429844_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|3430138_3430327_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3430466_3430736_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|3430737_3432675_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|3432671_3433322_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|3433321_3433885_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3433868_3434330_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3434379_3434769_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3434824_3436039_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3436062_3437070_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3437227_3439372_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3439371_3441078_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3441058_3441865_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|3441920_3442124_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3442273_3442567_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_015971382.1|3442657_3442843_-	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3443070_3443217_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3443216_3443786_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3444056_3444590_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3444594_3444810_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3444886_3445159_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3445199_3445379_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000224729.1|3445513_3445783_-	hypothetical protein	NA	A0A0N7C066	Escherichia_phage	100.0	5.4e-44
WP_162829202.1|3445840_3447053_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738068.1|3449251_3449521_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3449532_3450492_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204880.1|3451275_3451710_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3451702_3451897_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|3451893_3452499_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_001004024.1|3452498_3453221_-	phage antirepressor KilAC domain-containing protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211422.1|3453295_3454030_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|3454304_3454487_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|3454483_3455011_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3455007_3455454_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3455410_3455647_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3455657_3455873_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3456005_3456284_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_001036032.1|3456354_3456624_-	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
WP_000131484.1|3456623_3458060_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	100.0	6.1e-275
WP_000065666.1|3458049_3458949_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
WP_000166207.1|3458941_3459088_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438540.1|3459120_3459417_-	hypothetical protein	NA	A0A0N7BZS9	Escherichia_phage	100.0	6.8e-48
WP_000067727.1|3459558_3459774_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|3459849_3460545_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|3461046_3461568_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|3462136_3462319_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|3462296_3462569_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|3462627_3462879_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|3463061_3463430_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|3463502_3463667_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3463635_3463779_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|3463853_3464150_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|3464155_3464941_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186812.1|3464937_3465618_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_000682306.1|3465614_3465797_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548534.1|3465769_3465961_+	DUF1382 family protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
WP_001444000.1|3465971_3466253_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000774248.1|3466351_3466573_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289936.1|3466569_3467343_+	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000797281.1|3467494_3467683_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|3467684_3467900_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|3467901_3468120_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3468121_3468409_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001303965.1|3469384_3469684_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|3469769_3470054_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|3470106_3471417_+	DUF3596 domain-containing protein	NA	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000607020.1|3471413_3471992_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3472012_3472240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044286.1|3472277_3473519_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|3475326_3476247_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|3476246_3476552_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|3476705_3477305_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|3477301_3479848_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|3479847_3481020_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|3481149_3481842_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|3481814_3482843_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001054754.1|3482925_3485670_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
WP_000818441.1|3485741_3486815_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|3486863_3486998_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|3487025_3487256_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3487230_3487419_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3487429_3487642_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3487927_3488140_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|3488581_3488887_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|3488993_3489638_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|3489634_3490381_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|3490380_3492477_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|3492522_3493662_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3493649_3494096_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|3494115_3496296_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|3496415_3497720_-	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000270305.1|3497799_3497892_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460778.1|3497904_3499041_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|3499052_3500597_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|3500730_3501588_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|3501584_3501983_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|3501979_3502567_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3502563_3503271_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3503289_3505083_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3503914:3503929	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3505079_3506198_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3508471_3508741_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3508742_3510056_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230444.1|3510120_3510720_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|3510787_3514261_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|3514394_3514922_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_050546863.1|3515112_3515745_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3515690_3516434_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3516444_3517143_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3517142_3517472_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082449.1|3517468_3520048_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	0.0e+00
WP_000533402.1|3520028_3520442_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3520468_3520900_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3520913_3521654_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3521635_3521902_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3521959_3522307_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3522343_3523849_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3523838_3525431_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3525427_3525634_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3525617_3527546_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|3527809_3529348_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3529397_3529745_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3529741_3530122_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3530197_3530473_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3531223_3531430_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3531685_3531958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3532117_3532651_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3532871_3532985_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3533206_3533392_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3533919_3534234_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3535590_3537441_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3538208_3538922_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3539542_3540361_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3540512_3540884_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3540873_3541245_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3541257_3542307_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3542308_3542587_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3542754_3542910_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3543011_3543149_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3543514_3544288_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3544639_3545053_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3545068_3545839_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3545860_3546607_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3546613_3547705_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3547783_3548239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3548445_3548871_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3548854_3549127_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3549235_3549637_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3549664_3549856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3549855_3550143_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3550420_3550576_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3550717_3551107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3551293_3551479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3552052_3552241_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3552237_3552429_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3552522_3554994_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3555061_3555304_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3555281_3556301_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3556708_3557368_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3559133:3559148	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	3788305	3826402	5496245	protease,terminase,holin,lysis,integrase,portal,tail	Enterobacteria_phage(51.16%)	50	3787890:3787904	3826476:3826490
3787890:3787904	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3788305_3789004_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3789234_3790116_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3790285_3790447_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3790943_3791963_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3791996_3792977_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3793153_3793423_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3793424_3794741_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3794800_3795400_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3795470_3798884_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3798944_3799553_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3799489_3800233_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3800238_3800937_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3800946_3801276_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3801275_3804341_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3804312_3804642_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3804650_3805037_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3805097_3805841_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3805851_3806253_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3806249_3806828_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3806839_3807115_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3807107_3807431_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3807517_3809545_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3809489_3809825_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3809946_3811071_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3810998_3811211_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3811207_3813310_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3813309_3813801_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3814475_3814628_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3814615_3815083_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3815079_3815577_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3815576_3815792_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3815934_3816333_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3816413_3816572_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3816657_3817401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3817584_3818274_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3818288_3818411_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3818748_3819708_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3819919_3820585_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3820581_3821202_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3821194_3821365_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3821361_3821544_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3822241_3822922_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3822918_3823101_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3823073_3823265_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3823275_3823557_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3823655_3823877_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120054.1|3824087_3824690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3824932_3825100_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3825139_3825358_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3825631_3826402_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3826476:3826490	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	4369509	4421115	5496245	transposase,tail,integrase	Enterobacteria_phage(34.78%)	56	4362666:4362682	4418561:4418577
4362666:4362682	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000998048.1|4369509_4371048_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4371097_4371445_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4371441_4371822_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4372085_4372349_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4372348_4372489_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4372558_4372750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4373574_4374117_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4374191_4374779_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4374836_4375505_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4375530_4378056_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4378045_4379689_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4379657_4380368_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4380680_4381010_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4381257_4381872_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4382289_4382979_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|4382975_4383932_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4383928_4386127_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121321.1|4386136_4387093_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171064.1|4387271_4388399_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4388540_4389599_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4389844_4390747_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4391449_4391728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4391894_4392617_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4392715_4393615_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4394290_4395247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4395379_4397713_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4397726_4398050_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4398049_4398271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4398267_4398825_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4398821_4399082_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4400015_4400768_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4400764_4401316_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4401321_4401594_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4402003_4402570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4402569_4403160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4403190_4403823_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4403815_4404274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4404273_4404891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4404863_4405280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4405283_4406465_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4407427_4408171_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4408994_4409768_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4409825_4410380_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4410409_4410820_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4410840_4411284_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4411255_4411849_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4411848_4412643_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4412642_4412954_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4413905_4414199_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4414317_4414518_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4414618_4415332_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4415459_4415849_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4416088_4416334_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4417403_4418657_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4418561:4418577	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|4418668_4419772_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4420059_4421115_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 14
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	4439901	4462606	5496245	transposase,plate	uncultured_Caudovirales_phage(66.67%)	18	NA	NA
WP_000027427.1|4439901_4441074_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4441154_4441340_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4441254_4441518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4441719_4443480_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4443482_4444619_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001451375.1|4445364_4445916_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4445984_4450199_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103107.1|4450274_4452416_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	7.0e-25
WP_001142958.1|4452625_4453144_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4453840_4454341_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4454375_4454600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4454650_4456042_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4456132_4456546_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4456549_4458400_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4458363_4459446_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4459470_4460751_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4460747_4461272_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4461274_4462606_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 15
NZ_CP038342	Escherichia coli O157:H7 strain H2495 chromosome, complete genome	5496245	5204421	5292450	5496245	protease,head,plate,tRNA,transposase,tail	Shigella_phage(51.16%)	92	NA	NA
WP_000187008.1|5204421_5205522_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|5205561_5205921_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|5205920_5206571_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000125471.1|5206674_5207991_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.7	1.2e-59
WP_000569560.1|5208033_5209200_-	amidohydrolase	NA	NA	NA	NA	NA
WP_001120807.1|5209529_5210930_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|5210912_5211830_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230096.1|5212096_5213470_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|5213530_5214307_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935347.1|5214314_5215319_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001301638.1|5215472_5216624_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005582.1|5216975_5219627_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556285.1|5219809_5221543_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274629.1|5221757_5222609_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323843.1|5222595_5222937_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204139.1|5222938_5223817_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184851.1|5223782_5226080_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|5226130_5226451_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001174066.1|5227853_5230355_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000077537.1|5230840_5231371_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|5231561_5231810_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289290.1|5231811_5233902_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_000129790.1|5233972_5234905_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000268103.1|5234907_5235129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|5235141_5235396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|5235397_5235679_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|5235675_5235948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|5235952_5236246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|5236257_5236788_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|5236885_5237428_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564283.1|5237431_5237965_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000465559.1|5237964_5238480_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000977060.1|5238483_5239035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|5239031_5239217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021235.1|5239255_5239588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|5239580_5239778_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|5239767_5240064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|5240060_5240570_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852377.1|5240639_5241065_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|5241136_5241637_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|5241671_5242100_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|5242083_5242302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342746.1|5242311_5242539_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|5242519_5242828_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279084.1|5242824_5243115_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000360581.1|5243117_5243699_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057672.1|5243698_5245363_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000532593.1|5245362_5246952_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_000046893.1|5246935_5248261_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000094804.1|5248379_5248853_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000850811.1|5249029_5250154_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_001142982.1|5250153_5251101_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002060.1|5251144_5251513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|5251509_5251929_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|5251925_5252486_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|5252486_5252732_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|5252728_5254231_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|5254239_5254605_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|5254619_5255096_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|5255222_5257298_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000146116.1|5257284_5258634_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|5258617_5259742_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|5259731_5260346_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|5260338_5260776_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_032250085.1|5260775_5261858_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|5261848_5262409_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|5262408_5263320_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|5263354_5263876_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|5263955_5264159_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|5264381_5264942_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|5265041_5267081_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|5267227_5267410_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|5267445_5267691_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|5267729_5268194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|5268308_5268509_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|5268462_5269200_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_000374012.1|5269781_5270885_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647911.1|5271158_5271776_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271257.1|5271802_5272708_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001297636.1|5272801_5274982_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_001008791.1|5275310_5276201_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110783.1|5276549_5278982_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001301705.1|5278984_5280145_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|5280421_5280739_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000702307.1|5280798_5281407_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000644418.1|5282399_5282636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014969.1|5282637_5286822_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
WP_000710769.1|5286981_5287194_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001301674.1|5287396_5289595_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|5289750_5290776_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068837.1|5290867_5291827_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|5291919_5292450_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 1
NZ_CP038343	Escherichia coli O157:H7 strain H2495 plasmid pH2495-1, complete sequence	92743	49406	58198	92743	transposase,integrase	Macacine_betaherpesvirus(66.67%)	6	45976:45989	52564:52577
45976:45989	attL	TACAGTTCAAAAAG	NA	NA	NA	NA
WP_000016989.1|49406_50213_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|50935_52149_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_071525396.1|52110_52449_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|53036_54203_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
52564:52577	attR	CTTTTTGAACTGTA	NA	NA	NA	NA
WP_000817031.1|54202_55174_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000138832.1|56473_58198_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
