The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	1143296	1149150	5477854	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_001295182.1|1143296_1144058_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1144051_1144678_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272567.1|1144817_1145957_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000998042.1|1146837_1148376_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|1148425_1148773_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1148769_1149150_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 2
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	1190813	1263070	5477854	transposase,tail,tRNA,integrase,holin	Enterobacteria_phage(18.52%)	67	1235473:1235532	1255975:1257288
WP_000047198.1|1190813_1193444_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1193678_1193864_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273311.1|1195091_1195658_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287450.1|1195654_1196083_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611787.1|1196155_1197712_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130215.1|1197861_1198377_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1198440_1199979_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001302673.1|1199995_1201168_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1201294_1201825_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119747.1|1201915_1202251_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1202240_1202978_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000165714.1|1203101_1204286_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216525.1|1204477_1205470_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774978.1|1205526_1206591_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985501.1|1206583_1207786_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.9e-27
WP_000777971.1|1208141_1209101_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.9e-132
WP_000246553.1|1209110_1211255_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.9e-196
WP_000080947.1|1211227_1211638_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|1211634_1211880_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000209792.1|1212088_1212520_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001138451.1|1212607_1213942_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001295174.1|1214091_1214421_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1214572_1214917_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1214953_1215403_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1216070_1216475_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229446.1|1216527_1217046_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000138003.1|1217055_1217355_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1217537_1217696_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|1217779_1218229_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1218229_1218892_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001301367.1|1218912_1220313_-	GABA permease	NA	NA	NA	NA	NA
WP_000097647.1|1220550_1221831_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_000772884.1|1221844_1223293_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001301435.1|1224602_1225580_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000906744.1|1229556_1230906_+	DUF5507 domain-containing protein	NA	NA	NA	NA	NA
WP_072145424.1|1231293_1231503_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.2	1.7e-08
WP_001120794.1|1231657_1231777_+	hypothetical protein	NA	NA	NA	NA	NA
1235473:1235532	attL	ACTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCA	NA	NA	NA	NA
WP_162829202.1|1235516_1236730_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000800629.1|1238167_1239019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001071599.1|1239118_1239325_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000540864.1|1239647_1240853_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1240854_1242168_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1242164_1243796_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1243796_1244195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1244292_1244706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150589.1|1245101_1246274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1246349_1246685_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1246687_1247443_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1247778_1248345_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1248319_1248931_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1248927_1249593_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1249589_1250213_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1250465_1251209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1251294_1251462_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1251869_1253723_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1253872_1254088_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1254092_1254437_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1254793_1255174_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1255170_1255518_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1256018_1257232_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1257449_1257719_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
1255975:1257288	attR	ACTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTCCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTTAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCAGCCATCGCGTTGTCATACGAGTCGCCTGTACTCCCTGTTGATGCCAGTAATCCGGCTTCTTTTAGTCGCTCCGTATAGGCCAGTGACACATACTGAGAGCCTTTATCGCTGTGATGGATGGTGCCAGACGGACGACGGGCCCACAACGCCTGCTCCAGCGCATCCAGCACGAATGTCGTTTCCATAGACGATGAGACCCGCCACCCCACGATGTATCCGGCAAACACATCAATGATAAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACTGTACATCTGGCCACCCTGATTCCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTACACCTGATGATTTTCATCGTATACGCGCTGTATCTCTCTCTTCAGCCAGTCGTCGTGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAATGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATACCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGTTCCAGCTCTTTCAGACGCTGACGTTCAGCGCTGGTGAGCCCACCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGGGCAATGGAACAAATTGCCGCCCACTGTGAGTCATATTCATCCTGACTTTCCAGAACCATACGAATCGCCCGCTGACGGACTTCGGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGA	NA	NA	NA	NA
WP_000442132.1|1257879_1258302_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1258431_1259490_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1259568_1260219_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132152.1|1260401_1260992_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1261493_1261742_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1262587_1263070_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 3
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	1540648	1641026	5477854	portal,transposase,tail,tRNA,terminase,bacteriocin,integrase,lysis,capsid,holin	Escherichia_phage(80.68%)	116	1545043:1545067	1609907:1609931
WP_000950857.1|1540648_1541218_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1541217_1541685_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1541671_1542352_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1542361_1543498_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1543672_1544830_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1545043:1545067	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|1545261_1546431_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|1546414_1546597_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994803.1|1546675_1547053_-	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_001291844.1|1547088_1547301_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|1547260_1547887_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_000809302.1|1547883_1548315_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211992.1|1548370_1549048_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_001260980.1|1549372_1549630_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	8.6e-39
WP_001451755.1|1549758_1549956_+	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001302866.1|1550044_1550350_+	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451754.1|1550392_1550962_-	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_001304084.1|1550954_1551131_-	hypothetical protein	NA	A0A0N7C151	Escherichia_phage	100.0	2.5e-26
WP_000206752.1|1551224_1551848_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_000212746.1|1551851_1552139_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|1552140_1552359_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_001301947.1|1552360_1552576_-	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001301469.1|1552535_1553042_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001303141.1|1553043_1553991_-	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
WP_000476217.1|1553987_1554227_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	100.0	2.1e-39
WP_000157000.1|1554219_1554423_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_001453790.1|1554419_1555298_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_001159716.1|1555405_1555849_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	100.0	1.7e-79
WP_000080417.1|1555925_1556747_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_000077905.1|1556810_1557158_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_162829202.1|1557693_1558907_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000187066.1|1559134_1559824_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	100.0	2.7e-135
WP_000459724.1|1559820_1560771_-	recombinase RecT	NA	A0A2R2Z324	Escherichia_phage	100.0	1.4e-179
WP_000995346.1|1560789_1561071_-	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	100.0	1.7e-48
WP_000934195.1|1561091_1561373_-	hypothetical protein	NA	A0A2R2Z322	Escherichia_phage	100.0	1.3e-45
WP_000917253.1|1561384_1561597_-	hypothetical protein	NA	A0A2R2Z321	Escherichia_phage	100.0	3.4e-33
WP_000201269.1|1561667_1562315_-	Rha family transcriptional regulator	NA	A0A2R2Z320	Escherichia_phage	100.0	1.5e-119
WP_001064714.1|1563175_1564129_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1564125_1565595_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1565689_1566403_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1566498_1566702_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001302923.1|1566872_1567067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1567233_1567611_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913119.1|1567604_1569125_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001193567.1|1569114_1570086_+	toprim domain-containing protein	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000402093.1|1570085_1570535_+	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	100.0	1.3e-82
WP_001187434.1|1570542_1571106_+	recombination protein NinG	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000144764.1|1571102_1571297_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204844.1|1571289_1571724_+	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_001356551.1|1571972_1572125_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|1572507_1573467_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1573478_1573748_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874428.1|1574233_1576171_+	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|1576305_1576485_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|1576525_1576771_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_001072901.1|1576848_1577064_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087729.1|1577068_1577602_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_162829202.1|1577928_1579142_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000989259.1|1579195_1579759_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	2.6e-104
WP_000455406.1|1579758_1579908_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1579915_1580380_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1580411_1580705_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1580854_1581058_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086073.1|1581113_1581920_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|1581900_1583607_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|1583606_1585751_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1585908_1586916_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1586939_1588154_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1588209_1588599_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|1588648_1589110_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|1589093_1589657_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207926.1|1589656_1590307_+	hypothetical protein	NA	A0A0N6WEJ5	Escherichia_phage	100.0	4.6e-121
WP_000117994.1|1590303_1592241_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|1592242_1592512_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|1592651_1592840_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146324.1|1593134_1594760_+	hypothetical protein	NA	A0A0N7C0A7	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|1594756_1596025_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|1596039_1596318_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|1596323_1596941_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835362.1|1597031_1597766_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0N7C1B9	Escherichia_phage	100.0	4.4e-136
WP_000078907.1|1597998_1598139_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1598195_1598597_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1598690_1599347_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|1599349_1599796_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|1599805_1600057_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|1600067_1601333_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000331692.1|1601402_1609784_+	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	100.0	0.0e+00
WP_000368131.1|1610005_1610938_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1609907:1609931	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_000776768.1|1611231_1611987_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000952959.1|1612381_1613413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301981.1|1613777_1615118_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|1615489_1615774_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531969.1|1615953_1617264_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426146.1|1617263_1619408_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195817.1|1619610_1620096_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033336.1|1620741_1621305_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112847.1|1621386_1622985_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_000182852.1|1623007_1623766_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000675435.1|1623776_1624277_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000822672.1|1624273_1624744_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001301662.1|1624740_1624914_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000794741.1|1625146_1625668_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001301548.1|1625669_1626512_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730817.1|1626682_1627234_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001302029.1|1627399_1628332_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|1628366_1629452_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001043834.1|1629455_1630280_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1630279_1631089_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089225.1|1631088_1631637_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1631670_1631949_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683769.1|1632069_1634076_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|1634234_1635455_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127753.1|1635729_1636908_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615801.1|1636904_1637900_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699109.1|1637998_1639135_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_001289184.1|1639200_1640214_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1640213_1641026_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	1856009	1973900	5477854	portal,tail,tRNA,terminase,protease,integrase,holin	Enterobacteria_phage(48.28%)	134	1951091:1951105	1975963:1975977
WP_000569336.1|1856009_1856936_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1856940_1857672_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1857652_1857760_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1857819_1858521_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1858541_1859828_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1859861_1860116_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556581.1|1860134_1860269_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_000457728.1|1860272_1860515_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1860602_1860965_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1860961_1861318_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1861651_1861828_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1861829_1862777_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1862773_1862995_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1863093_1863375_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1863385_1863577_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1863549_1863732_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1863731_1864409_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1864405_1865191_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1865196_1865493_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|1865568_1865775_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1866255_1866633_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1866610_1867672_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000858974.1|1867752_1868442_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|1868546_1868777_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|1868846_1869386_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_000147876.1|1869382_1870402_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_000788810.1|1870398_1871100_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145915.1|1871096_1871399_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|1871466_1871799_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|1871890_1871998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1872055_1873582_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|1874046_1874598_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1874607_1875405_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1875521_1875623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054341.1|1875619_1876075_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_000224916.1|1876074_1876245_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1876237_1876528_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|1876524_1876887_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1876883_1877024_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1877109_1877544_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1877795_1877948_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1878751_1880698_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1880834_1881014_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|1881054_1881300_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_000284506.1|1881377_1881593_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1881597_1882131_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1882401_1882971_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1882970_1883117_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1883344_1883530_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1884047_1884524_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077621.1|1884520_1885528_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000114064.1|1885689_1886928_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|1886920_1887145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038670.1|1887204_1887786_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_088136225.1|1887766_1888486_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335965.1|1888478_1888703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551748.1|1888695_1889289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|1889485_1889728_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761773.1|1889724_1891539_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_001399692.1|1891826_1892072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|1892068_1892491_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000860404.1|1893148_1895038_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|1895295_1895577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102414.1|1897069_1897282_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1897281_1898784_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114426.1|1898728_1900753_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|1900840_1901167_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1901159_1901441_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1901443_1902067_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1902079_1902478_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1902485_1903238_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1903251_1903674_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1903700_1904009_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|1904052_1906698_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1906694_1907024_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1907023_1907722_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194801.1|1907732_1908476_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_123007081.1|1908421_1909051_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_000514967.1|1909291_1912768_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001228302.1|1912835_1913435_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000268979.1|1913499_1914813_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001023381.1|1914814_1915084_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_001261937.1|1915451_1915700_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1916214_1917900_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1917896_1918616_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1918662_1919133_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1919174_1919636_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1919760_1921764_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1921760_1922897_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1922889_1923621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1923639_1925169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1925179_1926268_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1927508_1927826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1927887_1931517_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1938474_1940508_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1940639_1941749_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1942010_1942292_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1942583_1943126_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1943213_1943888_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1943903_1946384_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001356675.1|1946394_1947429_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1947510_1947849_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134625.1|1948066_1948936_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1949056_1949329_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1949438_1949753_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1949762_1950110_-	hypothetical protein	NA	NA	NA	NA	NA
1951091:1951105	attL	TTTTTATGATCATAG	NA	NA	NA	NA
WP_000141034.1|1951160_1951400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1951733_1952522_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1952518_1953319_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1953383_1954202_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1954253_1955000_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1954973_1955939_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1955935_1956940_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1956936_1958214_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1958470_1959523_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1959821_1960676_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1960704_1961967_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1961976_1962429_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1962459_1962744_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1962747_1964103_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1964150_1965191_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1965290_1966070_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1966151_1967051_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1967456_1967774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985260.1|1968038_1969052_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1969167_1969467_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1969588_1969864_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1969874_1970045_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|1970041_1970542_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1970605_1970830_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1970829_1971129_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1971131_1971356_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1971352_1971628_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1971617_1973900_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
1975963:1975977	attR	CTATGATCATAAAAA	NA	NA	NA	NA
>prophage 5
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	1977996	2004218	5477854	head,portal,plate,tail,tRNA,terminase,lysis,capsid,holin	Escherichia_phage(73.53%)	35	NA	NA
WP_000038161.1|1977996_1979031_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1979030_1980803_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1980976_1981831_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1981889_1982963_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1982966_1983710_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1983809_1984319_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1984318_1984522_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1984525_1984807_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1984806_1985304_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1985318_1985744_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1985731_1986157_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1986128_1986302_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1986264_1986732_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001810.1|1986724_1987177_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_001093728.1|1987243_1987879_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1987875_1988223_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1988227_1989136_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1989128_1989740_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217052.1|1989736_1991056_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001057694.1|1991055_1991658_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|1991629_1992073_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001145592.1|1992093_1992504_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_000905094.1|1992534_1993128_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286706.1|1993187_1994378_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_001251408.1|1994390_1994909_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1994965_1995241_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1995273_1995393_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1995385_1997833_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1997847_1998327_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1998326_1999490_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1999571_1999790_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|2000063_2001425_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001301848.1|2001572_2001905_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|2002095_2002818_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|2002814_2004218_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 6
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	2103304	2170524	5477854	head,portal,transposase,tail,terminase,integrase,capsid,holin	Escherichia_phage(33.33%)	68	2098945:2098960	2154711:2154726
2098945:2098960	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000998048.1|2103304_2104843_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2104892_2105240_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2105236_2105617_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2105978_2106524_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2106520_2107264_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2107275_2108355_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2108416_2109352_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2109808_2110726_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2110827_2111778_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2111895_2113539_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2114164_2114881_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2115223_2116678_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2116779_2118096_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2118409_2119462_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2119723_2127706_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2128195_2128993_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2129228_2130251_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2130250_2130454_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034478.1|2130512_2132984_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2133079_2133268_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2133264_2133453_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2133933_2134086_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2134360_2135005_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2135102_2135330_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2135326_2135752_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2135820_2136858_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2136769_2137312_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2137346_2138045_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2138066_2138291_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2138287_2138644_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2138676_2138829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2138825_2139137_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2139263_2139827_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2139936_2140041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2140227_2140440_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2140607_2140886_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2140887_2141937_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2141949_2142309_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2142305_2142995_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2143628_2144057_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2144534_2146385_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2146466_2147680_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2147990_2148206_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2148210_2148555_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2148605_2149139_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2149294_2149477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2149489_2149621_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2149848_2150034_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2150560_2150875_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2150956_2151181_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2151575_2152085_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2153969_2154176_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2154172_2155765_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2154711:2154726	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|2155754_2157260_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2157296_2157644_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2157701_2157968_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2157949_2158690_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2158703_2159135_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2159161_2159575_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082465.1|2159555_2162135_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.6	0.0e+00
WP_000847298.1|2162131_2162461_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|2162460_2163159_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194801.1|2163169_2163913_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_123007081.1|2163858_2164488_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_072643111.1|2164728_2168208_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.7	0.0e+00
WP_001230514.1|2168275_2168875_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268850.1|2168939_2170253_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.3	5.3e-84
WP_001023455.1|2170254_2170524_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
>prophage 7
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	2228103	2248089	5477854	tail,integrase,transposase	Enterobacteria_phage(75.0%)	28	2241225:2241238	2251231:2251244
WP_032161583.1|2228103_2229240_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2229190_2229514_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2229671_2230856_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2230855_2231368_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2231422_2231788_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2231796_2231952_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2234754_2235243_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2235399_2235972_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2236015_2236546_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2237637_2237952_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2237956_2238916_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2238992_2241815_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2241225:2241238	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2241821_2242187_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2242183_2242801_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2242812_2243112_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2243108_2243375_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2243371_2243575_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2243598_2244015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2244107_2244221_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2244217_2244460_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2244471_2244750_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2244760_2245111_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2245132_2245336_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2245407_2245545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2245634_2246039_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2246054_2246705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2246734_2247082_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2247087_2248089_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2251231:2251244	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 8
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	2566931	2681792	5477854	head,portal,transposase,tail,terminase,protease,capsid,holin	Stx2-converting_phage(41.51%)	136	NA	NA
WP_001260835.1|2566931_2567753_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2567852_2567936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743954.1|2568028_2568364_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2568760_2570014_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2570120_2571014_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2571148_2572369_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2572493_2573189_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2573141_2574434_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2574591_2575206_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2575248_2576103_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2576104_2576722_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2576732_2579156_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041703.1|2579216_2581643_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	3.2e-212
WP_000778147.1|2581841_2582147_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2582254_2582965_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2582967_2583528_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2583562_2583904_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2584038_2584365_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2585353_2585605_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2585677_2588149_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2588241_2588433_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2588429_2588618_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2589018_2589183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2589186_2589405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2589476_2589776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2590127_2590406_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2590407_2590599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2590619_2590991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2591088_2591391_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2591387_2591813_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2591835_2592798_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2592804_2593545_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2594355_2594751_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2594807_2595392_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2595507_2595612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2595800_2596013_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2596180_2596459_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2596460_2597510_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2597522_2597882_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001303509.1|2599204_2599633_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2600111_2601962_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2602401_2602617_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2602621_2602966_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2603016_2603550_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2603820_2604390_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2604389_2604536_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2604763_2604949_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2605373_2605601_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_032173279.1|2605642_2606008_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	4.9e-64
WP_000958392.1|2606297_2606861_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_001303187.1|2606857_2608519_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173004.1|2608582_2610520_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2610564_2610786_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001356761.1|2610731_2613311_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.0	0.0e+00
WP_000125988.1|2613313_2613640_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2613649_2614000_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2613996_2614443_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2614439_2614784_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2614849_2615566_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2615580_2615955_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2616050_2616260_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212818.1|2616307_2619550_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807954.1|2619542_2619884_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|2619883_2620321_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_105626756.1|2620508_2623769_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001304111.1|2623771_2623987_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2624054_2624654_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268842.1|2624718_2625942_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2625943_2626213_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2626326_2626902_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2627612_2628263_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2628845_2630384_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2630433_2630781_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2630777_2631158_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2632120_2632363_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2633073_2634318_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2634410_2634599_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2634595_2634784_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2635348_2635558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2635558_2636197_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2636208_2636361_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2636653_2636992_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000693878.1|2637610_2638036_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001356791.1|2638104_2639160_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.7	1.6e-83
WP_000139447.1|2639152_2639614_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2639647_2640364_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2640396_2640678_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2640674_2640902_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2640894_2641206_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2641333_2641552_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2641553_2642111_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2642344_2642557_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2642676_2643021_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191871.1|2643142_2643415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265229.1|2643416_2644466_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2644478_2644784_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2644846_2645401_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2645625_2645823_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2645958_2646672_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2647122_2647554_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2648031_2649882_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2650320_2650536_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2650540_2650885_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2650935_2651469_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2651739_2652309_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2652308_2652455_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2652682_2652868_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2653292_2653520_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_032173279.1|2653561_2653927_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	4.9e-64
WP_000958392.1|2654216_2654780_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_001303179.1|2654776_2656438_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_000173066.1|2656501_2658439_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
WP_001063023.1|2658483_2658705_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125988.1|2660745_2661072_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007901.1|2661081_2661432_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2661428_2661875_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2661871_2662216_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2662274_2662991_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2662996_2663371_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2663466_2663676_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212925.1|2663727_2666970_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807954.1|2666962_2667304_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179510.1|2667303_2668002_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000194720.1|2668012_2668756_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2668701_2669334_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_072643105.1|2669676_2671245_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	3.9e-299
WP_001230508.1|2673822_2674422_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268849.1|2674486_2675800_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001023407.1|2675801_2676071_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2676184_2676760_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2676832_2677462_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2677543_2678185_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2678346_2678589_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2678720_2680004_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2680092_2681553_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2681588_2681792_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	2953258	3027905	5477854	head,portal,transposase,tail,protease,terminase,integrase,lysis,capsid,holin	Enterobacteria_phage(35.71%)	85	2968760:2968787	3028042:3028069
WP_000422055.1|2953258_2954308_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2954527_2955286_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2955282_2955873_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2955912_2956785_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2956997_2958581_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2958608_2959229_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2959225_2960107_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2960244_2960289_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2960380_2961943_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2961942_2963538_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2963538_2964900_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2964911_2966105_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2966104_2966911_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2967291_2967471_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2967556_2968057_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2968102_2968609_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2968760:2968787	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_169072547.1|2969922_2970573_-	T3SS effector NleG family protein	NA	B6ETE1	Enterobacteria_phage	32.4	1.5e-26
WP_001144877.1|2972079_2972670_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2972853_2973501_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2973637_2973784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2974211_2974490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|2974829_2975210_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2975206_2975554_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2975603_2977142_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2978107_2978677_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2978742_2979654_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2979760_2979883_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2981480_2982806_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2983832_2984102_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216534.1|2984103_2985408_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001228334.1|2985559_2986159_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_072643102.1|2986226_2989052_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.0	0.0e+00
WP_122989782.1|2989292_2989922_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_000194801.1|2989867_2990611_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001356678.1|2990621_2991320_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	2.6e-130
WP_000847298.1|2991319_2991649_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072643101.1|2991645_2994258_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	94.5	0.0e+00
WP_000533440.1|2994238_2994652_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2994678_2995101_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2995114_2995867_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2995874_2996270_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2996266_2996800_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2996814_2997168_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2997179_2997578_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2997619_2998645_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2998700_2999033_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2999042_3000362_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3000342_3001944_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3001940_3002147_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|3002143_3004069_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|3004043_3004589_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|3004975_3005200_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|3005281_3005596_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001082601.1|3006059_3006527_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_000539792.1|3006534_3006681_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3006680_3007250_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3007520_3008054_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3008104_3008449_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3008453_3008669_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3008818_3010672_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000917750.1|3012676_3012874_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3013115_3013646_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3013654_3014014_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3014026_3015073_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3015074_3015353_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3015422_3015680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3015900_3016113_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3016391_3017150_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3017848_3018013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3018009_3018591_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3018777_3019320_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3019231_3020272_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3020243_3020795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3020778_3021006_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3021082_3021490_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3021753_3022053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3022125_3022344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3022366_3022774_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3022751_3022985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3022978_3023146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3023543_3023732_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090196.1|3023728_3023920_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3024012_3026484_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3026548_3026797_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3026774_3027905_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3028042:3028069	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 10
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	3074601	3183599	5477854	holin,head,portal,transposase,tail,protease,terminase,integrase,lysis,capsid,tRNA	Enterobacteria_phage(48.21%)	112	3111783:3111798	3177502:3177517
WP_001299679.1|3074601_3075858_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3076071_3076695_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3076694_3077546_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3077696_3078644_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3078768_3080448_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3080502_3080781_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3081058_3081643_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3081759_3082851_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3083694_3086580_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3086679_3088599_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3088826_3089897_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3089907_3090540_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3090550_3091969_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3094000_3094201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3094309_3095332_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3095331_3096312_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3096308_3097067_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3097885_3098740_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3098765_3100736_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3100785_3101040_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_162829200.1|3101888_3103101_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001295616.1|3103289_3103901_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3104000_3104915_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3105010_3106747_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3106904_3108118_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3108455_3109526_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3109535_3110834_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3111196_3112729_+	SpoVR family protein	NA	NA	NA	NA	NA
3111783:3111798	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3112780_3113500_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3113721_3115263_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3115408_3115939_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3115984_3117253_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3117252_3117672_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3118044_3118956_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3119162_3119624_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3119700_3120360_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3120431_3120725_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3120736_3120895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3120965_3121367_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3121469_3121838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3122357_3123053_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3123076_3123889_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3123892_3124159_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3125398_3125983_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3126481_3127435_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3127621_3129106_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998042.1|3129408_3130947_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|3130996_3131344_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3131340_3131721_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3131796_3132045_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3132101_3132770_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3133267_3133450_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3133528_3134029_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3134065_3134572_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3134590_3135481_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3135600_3136182_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3136181_3139097_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3139161_3139761_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3139827_3143226_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3143286_3143919_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3143855_3144599_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3144604_3145303_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3145302_3145632_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3145628_3148178_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3148170_3148605_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3148586_3149009_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3149024_3149765_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3149772_3150168_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3150164_3150743_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3150754_3151108_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3151119_3151518_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3151559_3152585_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3152640_3152973_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3152982_3154302_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3154282_3155884_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3155880_3156087_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3156083_3158009_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3157983_3158529_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3158917_3159112_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3159276_3159483_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3159768_3160179_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_162829202.1|3160367_3161581_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738495.1|3161783_3162077_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3162167_3162350_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3162566_3163043_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3163029_3163335_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3163656_3164346_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3164342_3164483_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3164479_3164842_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3164838_3165129_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3165121_3165292_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3165291_3165747_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709088.1|3166248_3167775_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3167832_3167955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3168019_3168352_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3168419_3168722_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3168718_3169420_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3170344_3170581_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3170570_3171713_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3171826_3173077_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3173248_3173902_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3173911_3174373_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3174426_3175533_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3175568_3176210_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3176213_3177584_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3177502:3177517	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3177752_3178424_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3178423_3179884_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3180484_3180766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3181021_3181564_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3181769_3182183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3182195_3182531_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3182543_3183599_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 11
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	3189691	3247042	5477854	head,portal,tail,terminase,integrase,capsid,holin	Stx2-converting_phage(26.79%)	71	3232609:3232629	3253699:3253719
WP_000085256.1|3189691_3190921_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3191169_3192291_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3192339_3193566_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3193815_3194952_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3194935_3195799_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3196162_3197524_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3197584_3197860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3200168_3203570_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3204160_3206509_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3206528_3206618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3206630_3206867_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3206812_3207550_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3207603_3208482_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3208784_3208895_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3209004_3209259_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3209275_3209974_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807950.1|3209973_3210315_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212850.1|3210307_3213550_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_001453698.1|3213602_3213812_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|3213907_3214282_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3214296_3215013_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3215078_3215423_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3215419_3215866_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3215862_3216213_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3216222_3216549_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001356670.1|3216628_3219130_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	98.8	0.0e+00
WP_001063099.1|3219075_3219297_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3219341_3221279_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3221342_3223004_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3223000_3223564_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3223853_3224219_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3224260_3224446_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3224575_3224716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3225072_3225297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3225361_3225568_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3225795_3225942_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3225941_3226511_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3226781_3227315_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3227365_3227710_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3227714_3227930_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3228005_3228275_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3228312_3228495_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3228642_3230580_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3230894_3231062_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3231658_3232480_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3232476_3232851_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3232609:3232629	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3232863_3233913_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3233914_3234193_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3234360_3234573_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3234761_3234866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3234981_3235569_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3235571_3235763_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3235764_3236202_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3236188_3236506_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3236459_3236777_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3236766_3237069_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3237065_3237347_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3237379_3238096_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3238129_3238672_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3238583_3239621_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3239689_3240115_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3240098_3240422_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3240546_3241023_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3241338_3241491_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3241605_3242121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3242253_3242643_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3242704_3242974_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3242942_3244061_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3244227_3245022_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3245018_3246065_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3246220_3247042_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3253699:3253719	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	3507492	3562965	5477854	head,portal,transposase,tail,protease,capsid,holin	Escherichia_phage(26.19%)	61	NA	NA
WP_000003653.1|3507492_3508080_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3508076_3508784_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3508802_3510596_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001301613.1|3510592_3511711_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3513843_3514113_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3514114_3515428_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230444.1|3515492_3516092_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515111.1|3516159_3519633_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_000649829.1|3519766_3520294_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122997399.1|3520484_3521117_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	3.5e-102
WP_000194801.1|3521062_3521806_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|3521816_3522515_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3522514_3522844_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082464.1|3522840_3525420_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.2	0.0e+00
WP_000533402.1|3525400_3525814_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3525840_3526272_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3526285_3527026_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3527007_3527274_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3527331_3527679_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3527715_3529221_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3529210_3530803_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3530799_3531006_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3533182_3534721_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612598.1|3534770_3535118_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001171554.1|3535114_3535495_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3535570_3535846_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3536596_3536803_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3537058_3537331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3537490_3538024_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3538244_3538358_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3538579_3538765_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3539292_3539607_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3539811_3541025_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3541200_3543051_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3543818_3544532_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3545152_3545971_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3546122_3546494_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3546483_3546855_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3546867_3547917_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3547918_3548197_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3548364_3548520_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3548621_3548759_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160650.1|3549124_3549898_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3550249_3550663_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3550678_3551449_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788745.1|3551470_3552217_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_001205823.1|3552223_3553315_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3553393_3553849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3554055_3554481_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3554464_3554737_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3554845_3555247_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3555274_3555466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3555465_3555753_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3556030_3556186_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3556327_3556717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3556903_3557089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3557662_3557851_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3557847_3558039_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3558132_3560604_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3560671_3560914_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375128.1|3562305_3562965_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
>prophage 13
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	3793892	3831992	5477854	portal,tail,protease,terminase,integrase,lysis,holin	Enterobacteria_phage(48.84%)	50	3793477:3793491	3832066:3832080
3793477:3793491	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3793892_3794591_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951025.1|3794821_3795703_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_072127173.1|3795872_3796034_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3796530_3797550_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3797583_3798564_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3798740_3799010_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741889.1|3799011_3800328_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001233141.1|3800387_3800987_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3801057_3804471_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090840.1|3804531_3805140_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.6	2.1e-99
WP_000194779.1|3805076_3805820_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3805825_3806524_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3806533_3806863_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3806862_3809928_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3809899_3810229_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3810237_3810624_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3810684_3811428_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3811438_3811840_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3811836_3812415_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3812426_3812702_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3812694_3813018_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136596.1|3813104_3815132_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3815076_3815412_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3815533_3816658_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3816585_3816798_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934096.1|3816794_3818897_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3818896_3819388_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3820062_3820215_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3820202_3820670_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3820666_3821164_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3821163_3821379_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3821521_3821920_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3822000_3822159_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3822244_3822988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3823170_3823860_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3823874_3823997_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3824334_3825294_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3825505_3826171_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3826167_3826788_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3826780_3826951_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3826947_3827130_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3827827_3828508_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3828504_3828687_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3828659_3828851_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3828861_3829143_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3829241_3829463_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3829673_3830276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3830518_3830686_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3830725_3830944_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3830921_3831992_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3832066:3832080	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	4375199	4472219	5477854	integrase,tail,plate,transposase	Enterobacteria_phage(26.67%)	96	4401723:4401741	4458406:4458424
WP_000998048.1|4375199_4376738_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4376787_4377135_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4377131_4377512_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4377775_4378039_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4378038_4378179_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4378248_4378440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4379264_4379807_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4379881_4380469_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4380526_4381195_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4381220_4383746_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4383735_4385379_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4385347_4386058_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4386370_4386700_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4386947_4387562_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4387979_4388669_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4388665_4389622_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4389618_4391817_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4391826_4392783_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4392961_4394089_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4394230_4395289_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4395534_4396437_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4397139_4397418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4397584_4398307_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4398405_4399305_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4399980_4400937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4401069_4403403_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
4401723:4401741	attL	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000562750.1|4403416_4403740_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4403739_4403961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4403957_4404515_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4404511_4404772_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000968317.1|4406455_4407007_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4407012_4407285_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4407694_4408261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647286.1|4408461_4408851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4408881_4409514_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4409506_4409965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4409964_4410582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4410554_4410971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4410974_4412156_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4413118_4413862_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4414685_4415459_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4415516_4416071_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4416100_4416511_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4416531_4416975_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4416946_4417540_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4417539_4418334_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4418333_4418645_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4419596_4419890_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4420008_4420209_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4420309_4421023_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708831.1|4421150_4421534_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
WP_162829202.1|4421559_4422772_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303805.1|4423099_4423345_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4424414_4425668_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4425679_4426783_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4427070_4428126_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4428164_4428566_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4428623_4429868_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4429959_4430418_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4430678_4432136_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4432192_4432750_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4432661_4432928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4433234_4433687_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4433696_4434095_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4434097_4434391_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4434442_4435498_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4435568_4436354_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001303130.1|4436298_4438038_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4438855_4439629_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4439814_4440075_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4440093_4440354_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4440509_4441250_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4441220_4441988_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4442092_4442671_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4442910_4445355_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4445397_4445871_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4446024_4446795_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4446912_4448085_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4448165_4448351_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4448265_4448529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4448730_4450491_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4450493_4451630_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001356741.1|4452376_4452964_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339421.1|4453032_4454541_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_000509129.1|4455579_4459812_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
4458406:4458424	attR	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000103125.1|4459887_4462029_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4462238_4462757_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4463453_4463954_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4463988_4464213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4464263_4465655_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4465745_4466159_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4466162_4468013_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4467976_4469059_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4469083_4470364_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4470360_4470885_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4470887_4472219_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 15
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	4910469	4969480	5477854	protease,transposase	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|4910469_4911822_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4911915_4912467_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4912622_4913996_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4914171_4915170_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4915202_4916198_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4916184_4917207_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000265942.1|4918862_4919819_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4920128_4920659_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4920738_4921089_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4921082_4921334_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4921545_4921887_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060931.1|4921889_4925669_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4925665_4927399_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4927604_4928243_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4928565_4929909_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4929987_4930194_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4930518_4931073_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937659.1|4931135_4932074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4932285_4933026_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4933215_4935159_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4935276_4935657_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4935745_4936606_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4936713_4937679_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4937786_4938449_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4938493_4939906_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4940214_4940835_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4941052_4941691_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4941825_4943034_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4943041_4943473_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4944095_4944890_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4944960_4945410_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4945451_4945679_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4945683_4945998_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4946004_4946400_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4946726_4947002_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4947130_4947817_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949515.1|4947816_4948671_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4948680_4949331_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4949344_4949809_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4949818_4950124_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4950139_4951537_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4951891_4952956_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4953063_4953819_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4953815_4954565_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4954746_4955076_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4955224_4955500_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4955616_4957242_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4957325_4958489_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4958491_4959130_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4959139_4959538_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4959555_4960215_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4960265_4960964_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4960982_4961384_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4961510_4962242_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4962422_4964864_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4964902_4965328_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4965532_4966831_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4966934_4967132_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4967213_4968218_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4968220_4969480_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 16
NZ_CP038339	Escherichia coli O157:H7 strain H6437 chromosome, complete genome	5477854	5106359	5121024	5477854	integrase,tail,tRNA	Enterobacteria_phage(43.75%)	19	5102200:5102215	5119729:5119744
5102200:5102215	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5106359_5107775_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5107857_5108841_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5109006_5109249_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5109382_5110420_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5110508_5111606_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5111667_5111916_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5112076_5112718_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5112799_5113429_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5113501_5114074_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5114185_5114455_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268962.1|5114456_5115770_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230514.1|5115834_5116434_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5117755_5118292_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5118282_5118633_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5118629_5118914_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5119249_5119447_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5119791_5120073_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5119729:5119744	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5120120_5120294_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5120490_5121024_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
