The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	1232540	1245977	5504820	holin,tail	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1232540_1233152_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1233148_1233814_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1233810_1234434_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1234686_1235430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1235515_1235683_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1236090_1237944_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1238093_1238309_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1238313_1238658_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1239014_1239395_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1239391_1239739_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1240356_1240626_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1240786_1241209_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1241338_1242397_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1242475_1243126_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1243308_1243899_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1244400_1244649_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1245494_1245977_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	1388494	1451492	5504820	transposase,plate,protease,head,tail,tRNA	Shigella_phage(57.5%)	76	NA	NA
WP_000489651.1|1388494_1389958_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000892044.1|1390170_1391232_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_001244742.1|1391269_1392118_-	formate transporter	NA	NA	NA	NA	NA
WP_001251535.1|1392139_1394152_-	DNA-binding transcriptional regulator HyfR	NA	NA	NA	NA	NA
WP_001301950.1|1394181_1394595_-	hydrogenase 4 assembly chaperone HyfJ	NA	NA	NA	NA	NA
WP_000075555.1|1394587_1395346_-	hydrogenase 4 catalytic subunit HyfI	NA	NA	NA	NA	NA
WP_000916078.1|1395342_1395888_-	hydrogenase 4 subunit H	NA	NA	NA	NA	NA
WP_001102329.1|1395897_1397613_-	hydrogenase 4 catalytic subunit HyfG	NA	NA	NA	NA	NA
WP_001421044.1|1399210_1399729_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_071800417.1|1399946_1400192_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	58.7	1.0e-12
WP_100009370.1|1400172_1402257_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	43.7	2.2e-153
WP_000129790.1|1402327_1403260_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|1403262_1403484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|1403496_1403751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|1403752_1404034_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|1404030_1404303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|1404307_1404601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096695739.1|1404612_1405143_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	56.6	1.6e-47
WP_000323222.1|1405240_1405783_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564280.1|1405786_1406320_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	2.8e-68
WP_000465559.1|1406319_1406835_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000977061.1|1406838_1407390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096695741.1|1407386_1407698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001401880.1|1407712_1408063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|1408078_1408411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|1408403_1408601_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|1408590_1408887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214364.1|1408883_1409393_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	43.4	1.1e-26
WP_000852375.1|1409462_1409888_+	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	39.7	1.9e-19
WP_001125304.1|1409959_1410460_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|1410494_1410923_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122253.1|1410906_1411125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342749.1|1411135_1411363_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270158.1|1411343_1411655_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279083.1|1411647_1411938_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360582.1|1411940_1412522_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	56.8	5.5e-49
WP_001057672.1|1412521_1414186_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000532587.1|1414185_1415775_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	8.5e-169
WP_052921584.1|1415758_1417090_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.5e-152
WP_000094812.1|1417211_1417685_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
WP_000850812.1|1417861_1418986_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	7.5e-79
WP_001142982.1|1418985_1419933_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_096695743.1|1419976_1420357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|1420353_1420773_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_021499914.1|1420769_1421330_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	4.8e-42
WP_032204026.1|1421330_1421576_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_052921582.1|1421572_1423075_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.5	1.5e-138
WP_000015473.1|1423083_1423449_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|1423463_1423940_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113521.1|1424066_1426142_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	8.1e-71
WP_000146118.1|1426128_1427478_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	5.9e-54
WP_000098807.1|1427461_1428586_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|1428575_1429190_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|1429182_1429620_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|1429619_1430702_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301578.1|1430692_1431253_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_000469163.1|1431252_1432164_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	47.5	2.2e-36
WP_001473653.1|1432198_1432720_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	6.0e-47
WP_000904930.1|1433275_1433836_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_001432608.1|1433965_1435984_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	62.0	7.4e-202
WP_000221106.1|1436041_1436221_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	55.3	6.0e-07
WP_001114107.1|1436256_1436502_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001443803.1|1437117_1437318_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528256.1|1437271_1438009_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	78.6	2.9e-103
WP_000147987.1|1438423_1439074_-	hydrogenase 4 membrane subunit	NA	NA	NA	NA	NA
WP_000429091.1|1439085_1440525_-	hydrogenase 4 subunit HyfD	NA	NA	NA	NA	NA
WP_001301932.1|1440541_1441489_-	hydrogenase 4 subunit HyfC	NA	NA	NA	NA	NA
WP_000339489.1|1441499_1443518_-	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_001301767.1|1443517_1444135_-	hydrogenase 4 subunit HyfA	NA	NA	NA	NA	NA
WP_001068682.1|1444387_1444858_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_000176187.1|1444857_1445430_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_001295469.1|1445575_1446454_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_001301951.1|1446470_1447505_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_001295467.1|1447717_1448431_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
WP_001267498.1|1448598_1449462_+	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000829317.1|1449476_1451492_+|tRNA	tRNA cytosine(34) acetyltransferase TmcA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	1566560	1571986	5504820	integrase	Enterobacteria_phage(50.0%)	6	1555548:1555564	1574182:1574198
1555548:1555564	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1566560_1567130_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1567129_1567597_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1567583_1568264_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1568273_1569410_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1569584_1570742_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1571053_1571986_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1574182:1574198	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	1816267	1918526	5504820	transposase,terminase,protease,holin,portal,tail,tRNA	Enterobacteria_phage(50.0%)	111	NA	NA
WP_000569336.1|1816267_1817194_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1817198_1817930_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1817910_1818018_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1818077_1818779_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1818799_1820086_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1820119_1820374_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1820392_1820527_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1820530_1820773_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1820860_1821223_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1821219_1821576_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1821909_1822086_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1822087_1823035_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1823031_1823253_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1823351_1823633_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1823643_1823835_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_032195523.1|1823807_1823990_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000186740.1|1823989_1824667_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1824663_1825449_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1825454_1825751_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1825826_1826117_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1826620_1828228_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1828334_1829027_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1829390_1829930_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1829926_1830946_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1830942_1831644_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1831640_1831925_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1832152_1832350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1832393_1832675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1832765_1832867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1832863_1833319_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1833318_1833489_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1833481_1833772_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1833768_1834131_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1834127_1834268_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1834353_1834788_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1835036_1835189_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1835992_1837939_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1838076_1838256_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1838296_1838542_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1838619_1838835_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1838839_1839373_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1839643_1840213_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1840212_1840359_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1840586_1840772_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1841289_1841766_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1841762_1843886_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1843882_1844095_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1844094_1845597_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114421.1|1845541_1847566_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|1847653_1847980_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1847972_1848254_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1848256_1848880_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1848892_1849291_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_024748478.1|1849298_1850051_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000479062.1|1850064_1850487_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1850513_1850822_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_115333668.1|1850865_1853511_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|1853507_1853837_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1853836_1854535_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1854545_1855289_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_071601640.1|1855234_1855864_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_024748476.1|1856104_1859584_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230508.1|1859651_1860251_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171880257.1|1860315_1861485_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.7	1.2e-84
WP_001023396.1|1861486_1861756_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1861916_1862333_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1862414_1863056_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1863217_1863466_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1863980_1865666_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1865662_1866382_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1866428_1866899_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1866940_1867402_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1867526_1869530_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1869526_1870663_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1870655_1871387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1871405_1872935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1872945_1874034_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1875274_1875592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1875653_1879283_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|1884884_1886097_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001301615.1|1887553_1889587_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1889718_1890828_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1891089_1891371_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1891662_1892205_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1892292_1892967_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1892982_1895463_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1895473_1896508_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1896589_1896928_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1897145_1897997_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1898117_1898390_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1898499_1898814_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1898823_1899171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1900221_1900461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1900794_1901583_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1901579_1902380_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1902444_1903263_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1903314_1904061_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1904034_1905000_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1904996_1906001_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1905997_1907275_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1907531_1908584_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1908882_1909737_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1909765_1911028_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1911037_1911490_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1911520_1911805_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490697.1|1911808_1913164_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1913211_1914252_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1914351_1915131_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1915212_1916112_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1916517_1916835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1917164_1918526_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 5
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	2004543	2085660	5504820	integrase,lysis,transposase,protease,capsid,holin,head,tail	Stx2-converting_phage(59.04%)	100	1995494:1995508	2010917:2010931
1995494:1995508	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|2004543_2005722_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|2005702_2005894_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2005971_2006316_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2006503_2006854_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|2007720_2008668_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2008664_2008886_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2008984_2009266_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2009276_2009468_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2009440_2009623_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|2009619_2010300_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001302855.1|2010296_2011082_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
2010917:2010931	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|2011087_2011384_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2011458_2011602_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2011570_2011735_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2011807_2012176_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2012358_2012610_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2012668_2012941_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2012918_2013101_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2013669_2014191_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2014692_2015388_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2015462_2015678_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2015819_2016116_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2016148_2016310_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2016296_2017118_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2017114_2018491_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001220560.1|2018569_2019181_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000344569.1|2019644_2019977_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103678.1|2020109_2020325_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2020335_2020572_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2020528_2020975_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2020971_2021499_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2021495_2021678_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|2021952_2022717_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|2022791_2023514_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2023513_2024119_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2024115_2024787_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2024777_2025266_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2025915_2026875_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2026886_2027156_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2027452_2027776_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143115.1|2028019_2029957_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.8	0.0e+00
WP_000143458.1|2030093_2030273_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2030313_2030586_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2030662_2030878_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2030877_2031375_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2031371_2031809_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2032011_2032509_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2032505_2032763_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2033225_2033453_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2033494_2033860_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_162829202.1|2035382_2036596_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000173024.1|2037748_2039686_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001063023.1|2039730_2039952_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|2042478_2042805_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2042814_2043165_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2043161_2043608_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2043604_2043949_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2044007_2044724_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2044729_2045104_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2045199_2045409_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_171880258.1|2045461_2048704_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.3	0.0e+00
WP_000807954.1|2048696_2049038_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152216.1|2049037_2049736_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	99.6	2.5e-133
WP_001302649.1|2049752_2050073_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2050180_2050354_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2050424_2051348_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2051401_2052139_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2052084_2052717_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000515107.1|2052976_2056456_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_001230314.1|2056522_2057122_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_171880259.1|2057186_2058500_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.8	2.4e-84
WP_001023452.1|2058501_2058771_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2058911_2059787_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2060011_2060662_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2061985_2063152_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2063270_2063744_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2063942_2065001_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2065172_2065502_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2065602_2065785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2066273_2066387_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2066399_2066594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2067052_2067421_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2067494_2067716_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2067778_2068255_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2068269_2068749_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2068830_2069652_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2069872_2070283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2070298_2070982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2071117_2072188_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2072184_2073090_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2073086_2073968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2073951_2075165_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2075536_2077684_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2079131_2080670_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2080719_2081067_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2081063_2081444_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_028913479.1|2082835_2083441_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001303891.1|2083488_2083740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|2083763_2084054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|2084447_2085660_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 6
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	2226359	2349358	5504820	integrase,lysis,transposase,terminase,protease,capsid,holin,head,portal,tail,tRNA	Enterobacteria_phage(37.27%)	154	2292269:2292284	2320523:2320538
WP_000952736.1|2226359_2227181_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2227336_2228383_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2228379_2229174_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2229340_2230459_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2230427_2230697_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|2230758_2231148_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2231280_2231796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2231910_2232063_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2232378_2232855_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2232979_2233303_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|2233286_2233712_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|2233780_2234818_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|2234729_2235272_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|2235305_2236022_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|2236054_2236336_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|2236332_2236635_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|2236624_2236942_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2236895_2237213_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2237199_2237637_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2237638_2237830_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2237832_2238420_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2238535_2238640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2238828_2239041_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2239208_2239487_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|2239488_2240538_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001217410.1|2240550_2240925_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|2240921_2241743_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2242339_2242507_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023167.1|2242821_2244759_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|2244906_2245089_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2245126_2245396_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2245471_2245687_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|2245691_2246036_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2246086_2246620_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2246890_2247460_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2247459_2247606_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2247833_2248040_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2248104_2248329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2248685_2248826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|2248955_2249141_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|2249182_2249548_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2249838_2250402_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2250398_2252060_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2252123_2254061_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2254105_2254327_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2254272_2256774_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2256853_2257180_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2257189_2257540_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2257536_2257983_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2257979_2258324_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2258382_2259099_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2259113_2259488_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2259583_2259793_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2259840_2263083_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2263075_2263417_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2263416_2264115_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2264131_2264386_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2264495_2264606_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2264908_2265787_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2265840_2266578_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2266523_2266760_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2266772_2266862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2266881_2269230_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2269820_2273222_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|2275530_2275806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2275866_2277228_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2277591_2278455_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2278438_2279575_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2279824_2281051_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2281099_2282221_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_162829200.1|2282582_2283796_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_032174463.1|2283794_2285012_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_000953272.1|2285376_2285565_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|2286369_2286567_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2286559_2286772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2286761_2287226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2287218_2287452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2287457_2287757_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|2287753_2289154_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|2289354_2289606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2289602_2290013_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2290023_2290296_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2290422_2290647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2290898_2291105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2291104_2292160_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2292172_2292508_+|head	head decoration protein	head	NA	NA	NA	NA
2292269:2292284	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|2292520_2292934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2293139_2293682_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2293937_2294219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2294819_2296280_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2296279_2296951_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2297119_2298490_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2298493_2299135_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2299170_2300277_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2300330_2300792_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2300801_2301455_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2301626_2302877_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2302990_2304133_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|2304122_2304359_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|2305283_2305985_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2305981_2306284_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2306351_2306684_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2306748_2306871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2306928_2308455_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2308956_2309412_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2309411_2309582_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2309574_2309865_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2309861_2310224_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2310220_2310361_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2310357_2311047_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2311368_2311674_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2311660_2312137_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2312353_2312536_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2312626_2312920_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2313211_2313622_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2313907_2314114_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2314278_2314473_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2314861_2315407_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2315381_2317307_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2317303_2317510_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2317506_2319108_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2319088_2320408_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2320417_2320750_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2320523:2320538	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|2320804_2321830_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|2321871_2322270_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2322281_2322635_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_001471447.1|2322646_2323225_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	2.9e-79
WP_000683105.1|2323221_2323617_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2323624_2324365_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2324380_2324803_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2324784_2325219_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2325211_2327761_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2327757_2328087_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2328086_2328785_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2328790_2329534_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2329470_2330103_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2330163_2333562_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2333628_2334228_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2334292_2337208_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001171554.1|2337373_2337754_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2337750_2338098_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2338147_2339686_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_171880295.1|2339678_2340239_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.5	3.4e-88
WP_000488340.1|2340358_2341249_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2341267_2341774_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2341810_2342311_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2342389_2342572_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2343069_2343738_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2343794_2344043_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2344118_2344499_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2344495_2344843_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2344892_2346431_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2346733_2348218_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2348404_2349358_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 7
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	2433942	2507797	5504820	integrase,transposase,terminase,protease,capsid,holin,head,portal,tail	Stx2-converting_phage(38.18%)	82	2433779:2433806	2492269:2492296
2433779:2433806	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113676.1|2433942_2435073_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	9.8e-103
WP_000113189.1|2435050_2435299_-	excisionase	NA	NA	NA	NA	NA
WP_000048549.1|2435363_2437835_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|2437927_2438119_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2438115_2438304_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2438701_2438869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2438862_2439096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2439073_2439481_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2439503_2439722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2439794_2440094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2440357_2440765_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2440841_2441069_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2441052_2441604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2441575_2442616_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2442527_2443070_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|2443256_2443838_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2443834_2443999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2444697_2445456_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2445734_2445947_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2446167_2446425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2446494_2446773_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2446774_2447821_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2447833_2448193_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2448201_2448732_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2448973_2449171_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2449321_2450380_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|2451176_2453030_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|2453179_2453395_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2453399_2453744_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_171880260.1|2453794_2454328_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	2.3e-102
WP_001056806.1|2454598_2455168_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2455167_2455314_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2455541_2455727_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2456151_2456379_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2456420_2456786_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000958387.1|2457075_2457639_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2457635_2459297_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2459360_2461298_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2461342_2461564_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2461509_2464011_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2464090_2464417_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2464426_2464777_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2464773_2465220_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2465216_2465561_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2465619_2466336_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2466341_2466716_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2466811_2467021_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2467073_2470316_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2470308_2470650_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2470649_2471348_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_046671488.1|2471358_2472102_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|2472047_2472680_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2473022_2474198_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|2474149_2476495_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|2476562_2477162_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_171880261.1|2477313_2478627_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|2478628_2478898_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2479924_2481250_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_000998048.1|2483914_2485453_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2485502_2485850_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2485846_2486227_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2486566_2486845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2487272_2487419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2487555_2488203_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2488386_2488977_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2490483_2491134_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001079499.1|2492446_2492953_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2492269:2492296	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|2492998_2493499_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2493584_2493764_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2494144_2494951_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2494950_2496144_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983855.1|2496155_2497517_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000763503.1|2497517_2499113_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2499112_2500675_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2500766_2500811_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2500948_2501830_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2501826_2502447_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2502474_2504058_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2504270_2505143_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2505182_2505773_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2505769_2506528_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2506747_2507797_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	2591418	2644556	5504820	terminase,head,holin,capsid,portal,tail,tRNA	Escherichia_phage(49.18%)	67	NA	NA
WP_000628061.1|2591418_2592651_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2592905_2593889_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|2594163_2594334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|2594366_2595740_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157377.1|2595868_2596804_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000040838.1|2596856_2598092_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.3	1.1e-240
WP_000079604.1|2598093_2598309_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001298826.1|2598408_2598597_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_021500490.1|2598589_2598784_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_001004423.1|2598847_2599900_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	63.3	1.4e-116
WP_000102216.1|2599911_2603037_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	82.8	0.0e+00
WP_171880296.1|2603138_2603414_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	91.2	1.8e-39
WP_000245528.1|2603488_2603665_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_000560227.1|2603658_2603880_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.2e-36
WP_001133037.1|2604449_2604659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2604659_2605298_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379546.1|2605309_2605462_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.3e-07
WP_000410105.1|2605767_2606187_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2606283_2606526_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702023.1|2606522_2606945_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000788990.1|2607831_2608578_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_171880262.1|2608599_2609370_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	1.6e-85
WP_001118155.1|2609385_2609781_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000403779.1|2609838_2610195_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
WP_000063625.1|2610243_2610456_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_029594466.1|2610519_2610864_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	93.5	2.0e-46
WP_171880263.1|2610860_2611214_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	2.7e-35
WP_001278450.1|2611329_2611434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967410.1|2611622_2611835_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
WP_000940348.1|2612394_2612994_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.0	1.6e-104
WP_000228019.1|2612993_2613284_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_000640148.1|2613280_2613835_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
WP_000211416.1|2614108_2614690_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_000917763.1|2614933_2615131_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301789.1|2615266_2615980_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|2616429_2616861_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_137330374.1|2617432_2619283_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.5	0.0e+00
WP_024164617.1|2619721_2619937_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731241.1|2619941_2620286_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_025380272.1|2620336_2620870_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000675931.1|2621090_2621204_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|2621425_2621611_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|2622138_2622453_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|2622534_2622759_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000453564.1|2623155_2623701_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2623675_2625601_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2625597_2625804_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_171880264.1|2625800_2627402_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	1.5e-306
WP_000123292.1|2627382_2628702_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_001295978.1|2628711_2629044_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063258.1|2629099_2630125_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|2630166_2630562_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|2630573_2630927_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975099.1|2630938_2631517_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683137.1|2631513_2631909_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235101.1|2631916_2632669_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	3.2e-134
WP_000479051.1|2632682_2633105_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2633131_2633545_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_171880265.1|2633525_2636138_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	92.6	0.0e+00
WP_000847298.1|2636134_2636464_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_115447996.1|2636463_2637162_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	1.4e-131
WP_061330346.1|2637167_2637911_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	1.4e-145
WP_072141513.1|2637856_2638489_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.9	1.4e-98
WP_171880266.1|2638735_2642215_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.2	0.0e+00
WP_001408020.1|2642283_2642907_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_171880267.1|2642971_2644285_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	1.1e-76
WP_001023455.1|2644286_2644556_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
>prophage 9
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	2827880	2919537	5504820	lysis,transposase,terminase,capsid,head,holin,portal,tail	Enterobacteria_phage(33.01%)	112	NA	NA
WP_000214712.1|2827880_2828084_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2828119_2829580_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2829668_2830952_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2831083_2831326_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2831487_2832129_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2832210_2832840_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2832912_2833488_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2833601_2833871_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_171880269.1|2833872_2835186_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	6.3e-77
WP_171880270.1|2835250_2835850_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	2.2e-109
WP_171880271.1|2835917_2839397_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.0	0.0e+00
WP_129137391.1|2839643_2840276_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2840221_2840965_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001416783.1|2840975_2841674_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000847298.1|2841673_2842003_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081804.1|2841999_2844612_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533440.1|2844592_2845006_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2845032_2845455_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2845468_2846221_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2846228_2846624_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2846620_2847154_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2847168_2847522_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2847533_2847932_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2847973_2848999_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2849054_2849387_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2849396_2850716_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2850696_2852298_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2852294_2852501_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2852497_2854423_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2854397_2854943_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2855329_2855554_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_171880272.1|2855635_2855950_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2856475_2856661_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2856883_2857030_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2857029_2857599_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2857869_2858403_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2858453_2858798_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2858802_2859018_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023185.1|2859457_2861308_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_001302123.1|2861785_2862217_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2862667_2863381_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2863516_2863714_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2863938_2864493_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2864555_2864861_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2864873_2865923_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2865924_2866197_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2866318_2866663_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2866782_2866995_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2867228_2867786_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2867787_2868006_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2868133_2868445_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2868437_2868665_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2868661_2868943_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000139447.1|2869723_2870185_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2870177_2871221_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2871289_2871715_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2871698_2871941_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2872332_2872671_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2872963_2873116_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2873127_2873766_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2873766_2873976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2874540_2874729_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2874725_2874914_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2875006_2876251_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2876961_2877204_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2878166_2878547_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2878543_2878891_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2878940_2880479_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2881061_2881712_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2882421_2882997_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2883110_2883380_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|2883381_2884605_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_171880270.1|2884669_2885269_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	2.2e-109
WP_001304111.1|2885336_2885552_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_012779365.1|2885554_2888815_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_162829348.1|2888980_2890193_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_024748472.1|2890315_2890753_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	100.0	5.0e-63
WP_000807954.1|2890752_2891094_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171880258.1|2891086_2894329_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.3	0.0e+00
WP_001453698.1|2894381_2894591_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2894686_2895061_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2895066_2895783_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2895841_2896186_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2896182_2896629_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2896625_2896976_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2896985_2897312_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2897391_2899893_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2899838_2900060_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2900104_2902042_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|2902105_2903767_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|2903763_2904327_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|2904616_2904982_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|2905023_2905251_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_171880273.1|2905613_2906054_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	100.0	1.3e-71
WP_000539792.1|2906089_2906236_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2906235_2906805_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2907075_2907609_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2907659_2908004_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2908008_2908224_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_024748470.1|2908663_2910514_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|2910992_2911421_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001217455.1|2912743_2913103_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2913115_2914165_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2914166_2914445_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2914612_2914825_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2915013_2915118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2915233_2915818_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2915874_2916270_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788936.1|2917080_2917821_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_000095670.1|2917827_2918790_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000693943.1|2918812_2919238_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2919234_2919537_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 10
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	3234418	3285540	5504820	integrase,tRNA,transposase,tail	Enterobacteria_phage(60.0%)	59	3227642:3227657	3285619:3285634
3227642:3227657	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|3234418_3236152_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|3236328_3236817_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3236936_3237329_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3237328_3239407_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|3239399_3240548_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3240749_3241394_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3241404_3241794_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3241808_3242858_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3242860_3243721_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3243739_3245341_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3245386_3247048_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3247190_3247694_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3247714_3249679_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3249683_3250610_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3250606_3251494_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3251620_3252199_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|3252201_3252552_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3253331_3253760_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|3253766_3255191_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3255165_3255966_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|3256132_3257119_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3257133_3258648_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|3258717_3259707_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|3260503_3261007_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3261086_3261338_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3261452_3261539_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3261800_3262124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3262294_3262792_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3262828_3263068_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3263259_3264471_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3264532_3265198_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001303019.1|3265554_3266556_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
WP_000865208.1|3266561_3266909_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3266938_3267589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3267604_3268009_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3268098_3268236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3268307_3268511_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3268532_3268883_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3268893_3269172_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3269183_3269426_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3269422_3269536_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3269628_3270045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3270068_3270272_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3270268_3270535_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3270531_3270831_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|3270842_3271460_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|3271456_3271822_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3271828_3274651_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|3274727_3275687_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|3275691_3276006_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|3277097_3277628_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|3277671_3278244_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3278400_3278889_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|3281691_3281847_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|3281855_3282221_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3282275_3282788_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3282787_3283972_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3284129_3284453_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|3284403_3285540_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3285619:3285634	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 11
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	3343124	3410811	5504820	integrase,transposase,terminase,head,capsid,holin,portal,tail	Enterobacteria_phage(31.11%)	68	3341923:3341939	3411100:3411116
3341923:3341939	attL	CCACTATAAAAAGGCTG	NA	NA	NA	NA
WP_001023396.1|3343124_3343394_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000268854.1|3343395_3344565_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001230508.1|3344629_3345229_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171880277.1|3345296_3348773_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_000649827.1|3348906_3349434_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_171880297.1|3349624_3350257_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	2.9e-104
WP_171880278.1|3350202_3350946_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001302968.1|3350956_3351655_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3351654_3351984_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_128484525.1|3351980_3354560_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|3354540_3354954_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3354980_3355412_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3355425_3356166_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3356147_3356414_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3356471_3356819_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3356855_3358361_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3358350_3359943_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3359939_3360146_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|3362030_3362540_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|3362934_3363159_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|3363240_3363555_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3364081_3364267_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3364494_3364626_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3364638_3364821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|3364976_3365510_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|3365560_3365905_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|3365909_3366125_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|3366435_3367648_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|3367730_3369581_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|3371120_3371810_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|3371806_3372166_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|3372178_3373228_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|3373229_3373508_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|3373675_3373888_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3374074_3374179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|3374288_3374852_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|3374978_3375290_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|3375286_3375439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3375471_3375828_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3375824_3376049_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|3376070_3376769_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|3376803_3377346_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|3377257_3378295_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|3378363_3378789_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3378785_3379013_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|3379110_3379755_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3380029_3380182_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|3380662_3380851_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|3380847_3381036_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_171880279.1|3381131_3383603_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	4.0e-56
WP_000094838.1|3383661_3383865_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|3383864_3384887_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|3385122_3385920_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|3386409_3394392_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|3394653_3395706_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|3396019_3397336_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|3397437_3398892_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|3399234_3399951_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|3400576_3402220_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|3402337_3403288_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|3403389_3404307_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|3404763_3405699_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|3405760_3406840_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|3406851_3407595_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|3407591_3408137_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|3408498_3408879_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3408875_3409223_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3409272_3410811_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
3411100:3411116	attR	CCACTATAAAAAGGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	3514553	3569898	5504820	integrase,transposase,protease,capsid,head,holin,portal,tail	Escherichia_phage(27.91%)	62	3516488:3516503	3571663:3571678
WP_000003653.1|3514553_3515141_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3515137_3515845_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3515863_3517657_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3516488:3516503	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3517653_3518772_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3520764_3521034_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3521035_3522349_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230444.1|3522413_3523013_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515109.1|3523080_3526554_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_000649827.1|3526687_3527215_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_171880297.1|3527405_3528038_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	2.9e-104
WP_171880278.1|3527983_3528727_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001302968.1|3528737_3529436_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3529435_3529765_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_128484525.1|3529761_3532341_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|3532321_3532735_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3532761_3533193_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3533206_3533947_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3533928_3534195_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3534252_3534600_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3534636_3536142_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3536131_3537724_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3537720_3537927_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3540103_3541642_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3541691_3542039_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3542035_3542416_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3542491_3542767_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3543517_3543724_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3543979_3544252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3544411_3544945_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3545165_3545279_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3545500_3545686_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3546213_3546528_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3546732_3547946_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3548121_3549972_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3550738_3551452_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3552072_3552891_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3553042_3553414_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3553403_3553775_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3553787_3554837_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3554838_3555117_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3555284_3555440_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3555541_3555679_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3556044_3556818_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3557169_3557583_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3557598_3558369_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3558390_3559137_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3559143_3560235_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3560313_3560769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3560975_3561401_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3561384_3561657_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3561765_3562167_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3562194_3562386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3562385_3562673_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3562950_3563106_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3563247_3563637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3563823_3564009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3564582_3564771_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3564767_3564959_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3565052_3567524_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3567591_3567834_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3567811_3568831_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3569238_3569898_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3571663:3571678	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	3800826	3838916	5504820	lysis,integrase,terminase,protease,holin,portal,tail	Enterobacteria_phage(52.5%)	47	3800411:3800425	3838990:3839004
3800411:3800425	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3800826_3801525_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3801755_3802637_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3802805_3802967_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3803463_3804483_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3804516_3805497_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3805673_3805943_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3805944_3807261_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3807320_3807920_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090841.1|3811464_3812073_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3812009_3812753_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3812758_3813457_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3813466_3813796_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001161009.1|3816827_3817157_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3817165_3817552_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3817612_3818356_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3818366_3818768_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3818764_3819343_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3819354_3819630_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3819622_3819946_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3820032_3822060_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3822004_3822340_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3822461_3823586_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3823513_3823726_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3823722_3825825_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001139679.1|3826989_3827142_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3827129_3827597_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3827593_3828091_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3828090_3828306_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3828448_3828847_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3828927_3829086_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3829171_3829915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3830098_3830788_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3830802_3830925_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3831262_3832222_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3832433_3833099_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3833095_3833716_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3833708_3833879_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3833875_3834058_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3834755_3835436_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3835432_3835615_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3835587_3835779_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3835789_3836071_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3836169_3836391_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3836601_3837204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3837446_3837614_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3837653_3837872_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3838145_3838916_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3838990:3839004	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	4383394	4460484	5504820	integrase,lysis,transposase,plate,protease,head,capsid,holin,tail	Shigella_phage(43.86%)	92	4420512:4420558	4456582:4456628
WP_000998048.1|4383394_4384933_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4384982_4385330_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4385326_4385707_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4385970_4386234_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4386233_4386374_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4386443_4386635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4387459_4388002_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4388076_4388664_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4388721_4389390_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4389415_4391941_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4391930_4393574_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4393542_4394253_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4394565_4394895_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4395142_4395757_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4396174_4396864_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4396860_4397817_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4397813_4400012_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4400021_4400978_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4401156_4402284_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4402425_4403484_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4403729_4404632_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4405334_4405613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4405779_4406502_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4406600_4407500_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4408175_4409132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4409264_4411598_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4411611_4411935_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4411934_4412156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4412152_4412710_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4412706_4412967_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4413900_4414653_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4414649_4415201_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4415206_4415479_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4415888_4416455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4416454_4417045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4417075_4417708_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4417700_4418159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4418158_4418776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4418748_4419165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4419168_4420350_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4420512:4420558	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4421312_4422056_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4422880_4423654_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4423714_4424269_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145350.1|4424299_4424710_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_001008234.1|4424730_4425174_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000368084.1|4425145_4425748_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_000554706.1|4425747_4426518_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000383550.1|4426521_4427106_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4427096_4428155_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4428141_4428567_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4428566_4429115_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4429114_4430194_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4430190_4431519_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4431579_4433415_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4433556_4433826_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4433825_4434182_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4434181_4435678_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4435661_4435832_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4435840_4436401_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4436397_4436904_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4436878_4437289_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4437285_4437609_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4437687_4438917_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4438927_4439530_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_162829202.1|4440049_4441263_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738423.1|4441969_4442263_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4442353_4442536_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4442752_4443229_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4443232_4443568_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4443704_4443998_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4444276_4444510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4444653_4445193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4445407_4446160_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4446173_4447163_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4447170_4447980_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4447999_4448389_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4448385_4448712_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4448708_4449362_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4449361_4449856_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4449852_4450794_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4450783_4450963_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4451138_4451690_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4451682_4451943_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4452040_4452733_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4453010_4453307_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4453983_4454520_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4454510_4454873_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4454872_4455178_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4455404_4456568_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4456772_4458026_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4456582:4456628	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4458037_4459141_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4459428_4460484_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 15
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	4892464	4905040	5504820	integrase	Enterobacteria_phage(81.82%)	15	4891498:4891513	4909993:4910008
4891498:4891513	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|4892464_4893292_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4893509_4893704_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_000783684.1|4894059_4896393_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|4896407_4896728_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|4896863_4897319_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001512862.1|4897311_4897599_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	95.8	4.3e-47
WP_000980224.1|4897591_4898182_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|4898178_4898445_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|4898996_4899731_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|4899727_4900228_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4900301_4900874_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000095622.1|4901199_4902444_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|4902481_4903216_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|4903292_4903598_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|4903765_4905040_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
4909993:4910008	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 16
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	4937478	4996488	5504820	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4937478_4938831_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4938924_4939476_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4939631_4941005_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4941180_4942179_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4942211_4943207_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4943193_4944216_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4944229_4945732_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4945871_4946828_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4947137_4947668_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4947747_4948098_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4948091_4948343_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4948554_4948896_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4948898_4952678_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4952674_4954408_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4954613_4955252_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4955574_4956918_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4957013_4957220_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|4957544_4958099_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4958161_4959100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4959311_4960052_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|4960241_4962185_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|4962302_4962683_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4962771_4963632_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4963739_4964705_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4964812_4965475_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4965519_4966932_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4967240_4967861_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4968078_4968717_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4968851_4970060_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4970067_4970499_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4971121_4971916_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4971986_4972436_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4972477_4972705_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4972709_4973024_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4973030_4973426_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4973752_4974028_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4974156_4974843_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4974842_4975697_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4975706_4976357_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4976370_4976835_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4976844_4977150_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001512857.1|4977165_4978545_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4980071_4980827_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4980823_4981573_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4981754_4982084_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4982232_4982508_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4982624_4984250_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4984333_4985497_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4985499_4986138_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4986147_4986546_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4986563_4987223_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4987273_4987972_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4987990_4988392_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4988518_4989250_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4989430_4991872_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4991910_4992336_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4992540_4993839_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4993942_4994140_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4994221_4995226_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4995228_4996488_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 17
NZ_CP038333	Escherichia coli O157:H7 strain N8B7-2 chromosome, complete genome	5504820	5133267	5147932	5504820	integrase,tRNA,tail	Enterobacteria_phage(43.75%)	19	5129108:5129123	5146637:5146652
5129108:5129123	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5133267_5134683_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5134765_5135749_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5135914_5136157_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_171880291.1|5136290_5137328_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5137416_5138514_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5138575_5138824_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5138984_5139626_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5139707_5140337_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5140409_5140982_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5141093_5141363_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5141364_5142678_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5142742_5143342_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5144663_5145200_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5145190_5145541_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5145537_5145822_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5146157_5146355_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5146699_5146981_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5146637:5146652	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5147028_5147202_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5147398_5147932_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038335	Escherichia coli O157:H7 strain N8B7-2 plasmid pN8B7-1, complete sequence	94694	24315	92937	94694	integrase,protease,transposase	Macacine_betaherpesvirus(26.32%)	60	11888:11903	52119:52134
11888:11903	attL	GTGTTTTTCTGGCCGG	NA	NA	NA	NA
WP_001066920.1|24315_25056_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|25340_26318_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|26725_26926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|26922_27543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|27539_28223_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|28681_28900_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|28901_29207_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|29207_30014_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_000852148.1|30714_31470_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|32057_33224_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|33223_34195_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|34803_35706_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|35709_36015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|36091_36775_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_001104869.1|36775_36997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|36890_37445_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001310284.1|38139_38712_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|38807_39110_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|39156_39579_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|39575_39767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|39885_40275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|40762_40993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|41044_42406_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|42452_43016_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001451816.1|43101_43551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|43620_43827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|43852_44305_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|44361_44595_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|44660_46619_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|46673_47108_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|47104_47866_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|48097_48256_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|50478_50910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581719.1|52668_62178_+	toxin B	NA	NA	NA	NA	NA
52119:52134	attR	CCGGCCAGAAAAACAC	NA	NA	NA	NA
WP_001171554.1|63172_63553_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|63549_63897_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|63946_65485_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000205762.1|66886_67633_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|67691_68552_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|68654_69215_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|69347_69560_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233853.1|69804_70266_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302200.1|70311_70521_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|70558_70897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|71136_71391_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|71626_71701_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|71693_72551_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|73462_73747_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|73746_74022_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|74116_74323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302179.1|75663_75849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592771.1|76025_78236_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|78279_78669_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034097.1|79894_83797_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_001302199.1|85974_86796_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|86795_87902_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|87991_89713_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|89786_90785_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001380655.1|91028_91349_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.1	1.3e-57
WP_000998048.1|91398_92937_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
