The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	1221045	1244516	5513087	transposase,integrase,tail,holin	Enterobacteria_phage(33.33%)	27	1212691:1212705	1245387:1245401
1212691:1212705	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1221045_1222251_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1222252_1223566_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1223562_1225194_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1225194_1225593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1225690_1226104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150582.1|1226499_1227708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1227783_1228119_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1228121_1228877_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1229224_1229791_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1229765_1230377_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230373_1231039_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1231035_1231659_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1231911_1232655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232740_1232908_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1233315_1235169_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1235318_1235534_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235538_1235883_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236239_1236620_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236616_1236964_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1237464_1238678_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1238895_1239165_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1239325_1239748_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1239877_1240936_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1241014_1241665_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1241847_1242438_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1242939_1243188_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1244033_1244516_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1245387:1245401	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	1522095	1527521	5513087	integrase	Enterobacteria_phage(50.0%)	6	1511083:1511099	1529717:1529733
1511083:1511099	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1522095_1522665_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1522664_1523132_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1523118_1523799_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1523808_1524945_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1525119_1526277_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1526588_1527521_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1529717:1529733	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	1774454	1878729	5513087	protease,tRNA,tail,holin,transposase,terminase,portal	Enterobacteria_phage(61.04%)	111	NA	NA
WP_000569336.1|1774454_1775381_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1775385_1776117_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1776097_1776205_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1776264_1776966_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1776986_1778273_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_162829202.1|1778456_1779670_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_171877142.1|1779675_1780308_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	4.0e-106
WP_000763383.1|1780304_1780526_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1780624_1780906_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1780916_1781108_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1781080_1781263_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1781262_1781940_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1781936_1782722_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1782727_1783024_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372942.1|1783099_1783243_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1783211_1783376_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1783448_1783817_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|1784077_1784659_+	super-infection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1784675_1784948_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1785460_1786012_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1786018_1786300_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1786422_1787070_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1787178_1787397_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|1787511_1787808_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_000788906.1|1788768_1789470_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|1789466_1789757_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|1789827_1790106_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1790238_1790454_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1790464_1790701_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|1790657_1791104_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|1791100_1791628_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|1791624_1791801_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|1791803_1792205_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|1792164_1792374_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|1792366_1792972_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|1792968_1793163_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1793155_1793590_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|1794096_1795044_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1795053_1795323_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874257.1|1795833_1797780_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000143458.1|1797917_1798097_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1798137_1798383_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1798460_1798676_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1798680_1799214_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1799484_1800054_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1800053_1800200_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1800427_1800613_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1800824_1801097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1801129_1801606_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1801602_1803726_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1803722_1803935_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1803934_1805437_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_162829202.1|1806343_1807557_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001097065.1|1808806_1809133_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1809125_1809407_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1809409_1810033_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1810045_1810444_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1810451_1811204_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1811217_1811640_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1811666_1811975_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|1812018_1814664_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1814660_1814990_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_115448574.1|1814989_1815688_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	98.7	2.8e-132
WP_000194798.1|1815698_1816442_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1816387_1817017_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_151121034.1|1817257_1820731_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.3	0.0e+00
WP_001228289.1|1820798_1821398_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000268835.1|1821462_1822776_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1822777_1823047_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1823414_1823663_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1824177_1825863_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1825859_1826579_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1826625_1827096_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1827137_1827599_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_162829206.1|1827782_1828995_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	2.9e-169
WP_001302810.1|1831036_1832173_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1832165_1832897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1832915_1834445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1834455_1835544_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1836784_1837102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1837163_1840793_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1847750_1849784_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1849915_1851025_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1851286_1851568_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1851859_1852402_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1852489_1853164_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001301545.1|1855670_1856705_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1856786_1857125_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134627.1|1857342_1858200_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1858320_1858593_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1858702_1859017_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1859026_1859374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1860424_1860664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1860997_1861786_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1861782_1862583_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1862647_1863466_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434031.1|1863517_1864264_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1864237_1865203_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1865199_1866204_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1866200_1867478_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1867734_1868787_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1869085_1869940_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1869968_1871231_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1871240_1871693_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1871723_1872008_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1872011_1873367_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1873414_1874455_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1874554_1875334_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1875415_1876315_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1876720_1877038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1877367_1878729_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	1976742	2050454	5513087	integrase,head,tail,holin,transposase,terminase,capsid,portal	Escherichia_phage(34.04%)	69	1976249:1976264	2034641:2034656
1976249:1976264	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_162829204.1|1976742_1977956_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|1978327_1980475_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|1981922_1983461_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1983510_1983858_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1983854_1984235_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|1984596_1985142_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1985138_1985882_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1985893_1986973_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1987034_1987970_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1988426_1989344_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1989445_1990396_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|1992782_1993499_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1993841_1995296_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1995397_1996714_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1997027_1998080_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_162829202.1|2003555_2004768_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2008126_2008924_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2009159_2010182_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2010181_2010385_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2010443_2012915_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2013010_2013199_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2013195_2013384_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2013864_2014017_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2014291_2014936_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2015033_2015261_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2015257_2015683_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2015751_2016789_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2016700_2017243_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2017277_2017976_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2017997_2018222_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2018218_2018575_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2018607_2018760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2018756_2019068_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2019194_2019758_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2019867_2019972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2020158_2020371_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2020538_2020817_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2020818_2021868_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2021880_2022240_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2022236_2022926_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2023559_2023988_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2024465_2026316_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2026397_2027611_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2027921_2028137_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2028141_2028486_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2028536_2029070_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2029225_2029408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2029420_2029552_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2029779_2029965_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2030491_2030806_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2030887_2031112_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2031506_2032016_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2031987_2033916_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2033899_2034106_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2034102_2035695_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2034641:2034656	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_000256723.1|2037226_2037574_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2037631_2037898_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2037879_2038620_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2038633_2039065_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2039091_2039505_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_151121036.1|2039485_2042065_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.6	0.0e+00
WP_000847298.1|2042061_2042391_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_115448574.1|2042390_2043089_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	98.7	2.8e-132
WP_000194798.1|2043099_2043843_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2043788_2044418_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_149888716.1|2044658_2048138_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230508.1|2048205_2048805_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_070479928.1|2048869_2050183_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|2050184_2050454_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 5
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	2108034	2128017	5513087	transposase,integrase,tail	Enterobacteria_phage(75.0%)	28	2121153:2121166	2131159:2131172
WP_032161728.1|2108034_2109168_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|2109118_2109442_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2109599_2110784_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2110783_2111296_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2111350_2111716_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2111724_2111880_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2114682_2115171_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2115327_2115900_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2115943_2116474_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2117565_2117880_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|2117884_2118844_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123463.1|2118920_2121743_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2121153:2121166	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2121749_2122115_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001413181.1|2122111_2122729_-	ash family protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000104305.1|2122740_2123040_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2123036_2123303_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2123299_2123503_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2123526_2123943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2124035_2124149_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2124145_2124388_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2124399_2124678_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2124688_2125039_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2125060_2125264_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2125335_2125473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2125562_2125967_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2125982_2126633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2126662_2127010_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2127015_2128017_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2131159:2131172	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	2448563	2562818	5513087	protease,head,tail,holin,transposase,terminase,capsid,portal	Escherichia_phage(27.52%)	139	NA	NA
WP_001260835.1|2448563_2449385_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2449484_2449568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2449660_2449996_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2450392_2451646_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2451752_2452646_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2452780_2454001_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2454125_2454821_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2454773_2456066_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2456223_2456838_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2456880_2457735_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2457736_2458354_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2458364_2460788_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2460848_2463275_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2463473_2463779_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2463886_2464597_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2464599_2465160_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2465194_2465536_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2465670_2465997_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2466985_2467237_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2467309_2469781_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2469873_2470065_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2470061_2470250_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2470650_2470815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2470818_2471037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2471108_2471408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2471760_2472039_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2472040_2472232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2472252_2472624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2472721_2473024_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2473020_2473446_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2473468_2474431_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2474437_2475178_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2475988_2476384_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2476440_2477025_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2477140_2477245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2477433_2477646_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2477813_2478092_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2478093_2479143_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_151121037.1|2479155_2479515_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	4.6e-38
WP_001059381.1|2479511_2480201_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2480841_2481270_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2481748_2483599_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2484038_2484254_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2484258_2484603_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2484653_2485187_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2485457_2486027_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2486026_2486173_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2486400_2486586_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2487010_2487238_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2487279_2487645_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2487933_2488497_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|2488493_2490155_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|2490218_2492156_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|2492200_2492422_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|2492367_2494947_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|2494949_2495276_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2495285_2495636_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2495632_2496079_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2496075_2496420_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_060722693.1|2496485_2497202_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	5.2e-126
WP_001030063.1|2497207_2497582_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2497677_2497887_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212897.1|2497939_2501020_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
WP_000807954.1|2501012_2501354_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2501353_2501791_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_038425866.1|2501978_2505239_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001304111.1|2505241_2505457_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2505524_2506124_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001023362.1|2507414_2507684_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|2509083_2509734_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2510316_2511855_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2511904_2512252_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2512248_2512629_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2513591_2513834_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2514544_2515789_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2515881_2516070_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2516066_2516255_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2516819_2517029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2517029_2517668_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2517679_2517832_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2518124_2518463_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2518854_2519097_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2519080_2519506_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2519574_2520618_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2520610_2521072_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2521105_2521822_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2521854_2522136_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2522132_2522360_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2522352_2522664_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2522791_2523010_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2523011_2523569_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2523802_2524015_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2524134_2524479_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2524600_2524873_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2524874_2525924_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2525936_2526242_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2526304_2526859_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2527083_2527281_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2527416_2528130_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2528580_2529012_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2529489_2531340_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2531778_2531994_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2531998_2532343_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2532393_2532927_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2533198_2533768_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2533767_2533914_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2534136_2534322_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2534847_2535162_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2535243_2535468_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867493.1|2535854_2536400_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|2536374_2538300_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2538296_2538503_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2538499_2540101_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2540081_2541401_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2541410_2541743_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2541798_2542824_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2542865_2543264_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2543275_2543629_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2543643_2544177_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2544173_2544569_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2544576_2545329_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2545342_2545765_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2545791_2546205_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032166593.1|2546185_2548798_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.3	0.0e+00
WP_000847298.1|2548794_2549124_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2549123_2549822_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2549832_2550576_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2550521_2551151_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_149888716.1|2551391_2554871_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230508.1|2554938_2555538_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2555602_2556826_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2556827_2557097_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|2557210_2557786_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2557858_2558488_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|2558569_2559211_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001120551.1|2559372_2559615_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2559746_2561030_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2561118_2562579_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2562614_2562818_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	2737324	2795042	5513087	tRNA,head,tail,holin,terminase,capsid	Escherichia_phage(42.19%)	69	NA	NA
WP_001295593.1|2737324_2737759_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2738339_2738981_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2739062_2739692_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2739764_2740340_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2740452_2740722_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2740723_2742037_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2742101_2742701_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_151121039.1|2742771_2746269_-	DUF1983 domain-containing protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.2	0.0e+00
WP_000649829.1|2746402_2746930_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2747120_2747753_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2747698_2748442_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2748452_2749151_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_171877143.1|2749150_2749492_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	99.1	4.3e-62
WP_000212768.1|2749484_2752565_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|2752616_2752826_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2752921_2753296_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2753301_2754018_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2754086_2754431_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2754427_2754874_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2754870_2755221_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2755230_2755557_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2758083_2758305_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2758349_2760287_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|2760350_2762012_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|2762008_2762572_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2762860_2763226_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2763267_2763468_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2763599_2763926_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|2764326_2764512_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2764734_2764866_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|2764960_2765656_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|2765929_2766463_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|2766513_2766858_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2766862_2767078_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_021497500.1|2767227_2769081_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000466957.1|2769655_2770087_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2770648_2771203_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2771199_2771490_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2771489_2772089_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2772588_2773980_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000016656.1|2773979_2774969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2774936_2776088_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2776519_2776765_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2776843_2777005_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2777015_2777279_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2777530_2777743_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2777848_2778271_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2778286_2779048_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2779070_2779817_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2779823_2780612_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2780689_2781112_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2781108_2781363_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2781442_2781862_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2782104_2782284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2782294_2782450_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2782446_2782935_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2783376_2783598_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2783597_2783768_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2783842_2784118_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2784219_2786820_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2786812_2787622_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2787677_2787827_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2787864_2788053_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2788152_2788368_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2788369_2789605_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2789656_2790592_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|2790720_2792094_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2792571_2793555_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2793809_2795042_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 8
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	2879988	2955443	5513087	protease,integrase,head,tail,holin,transposase,terminase,capsid,portal	Stx2-converting_phage(35.71%)	84	2895490:2895517	2955580:2955607
WP_000422055.1|2879988_2881038_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2881257_2882016_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2882012_2882603_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2882642_2883515_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2883727_2885311_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2885338_2885959_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2885955_2886837_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2886974_2887019_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2887110_2888673_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2888672_2890268_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2890268_2891630_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2891641_2892835_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2892834_2893641_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2894021_2894201_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2894286_2894787_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2894832_2895339_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2895490:2895517	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001144877.1|2898809_2899400_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2899583_2900231_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2900367_2900514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2900941_2901220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2901559_2901940_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2901936_2902284_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2902333_2903872_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2904837_2905407_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2905472_2906384_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2906490_2906613_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2908210_2909536_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2910562_2910832_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2910833_2912147_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2912298_2912898_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_115801855.1|2912965_2915311_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001304109.1|2915262_2916438_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_151121042.1|2916779_2917412_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	90.9	1.9e-95
WP_000194763.1|2917357_2918101_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2918111_2918810_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2918809_2919151_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_151121040.1|2919143_2922386_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.3	0.0e+00
WP_001453746.1|2922433_2922643_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2922738_2923113_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2923127_2923844_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2923909_2924254_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2924250_2924697_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007901.1|2924693_2925044_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2925053_2925380_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2925459_2927961_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063095.1|2927906_2928128_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.9e-35
WP_000173030.1|2928172_2930110_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|2930173_2931835_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2931831_2932395_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2932684_2933050_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2933091_2933319_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2933743_2933929_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2934156_2934303_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2934302_2934872_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2935142_2935676_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2935726_2936071_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2936075_2936291_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2936440_2938294_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2939090_2940149_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2940299_2940497_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2940738_2941269_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2941277_2941637_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2941649_2942696_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2942697_2942976_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2943045_2943303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2943523_2943736_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2944014_2944773_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2945471_2945636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2945632_2946214_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2946400_2946943_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2946854_2947895_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2947866_2948418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2948401_2948629_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2948705_2949113_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2949376_2949676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2949748_2949967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2949989_2950397_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2950374_2950608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|2950601_2950745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2951081_2951270_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2951266_2951458_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2951550_2954022_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2954086_2954335_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2954312_2955443_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2955580:2955607	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	3001845	3174049	5513087	tRNA,protease,integrase,head,tail,holin,transposase,terminase,lysis,capsid,portal	Enterobacteria_phage(31.67%)	197	3034555:3034570	3180706:3180726
WP_001299679.1|3001845_3003102_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3003315_3003939_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3003938_3004790_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3004940_3005888_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3006012_3007692_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3007746_3008025_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3008302_3008887_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3009003_3010095_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|3012916_3013987_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3013997_3014630_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3014640_3016059_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3018090_3018291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3018398_3019421_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3019420_3020401_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3020397_3021156_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3021974_3022829_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3022854_3024825_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3024874_3025129_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_162829200.1|3025977_3027190_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001295616.1|3027378_3027990_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3028089_3029004_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3029099_3030836_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3031227_3032298_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3032307_3033606_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3033968_3035501_+	SpoVR family protein	NA	NA	NA	NA	NA
3034555:3034570	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3035552_3036272_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
3034555:3034570	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000406391.1|3036493_3038035_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3038180_3038711_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3038756_3040025_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3040024_3040444_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3040816_3041728_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3041934_3042396_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3042472_3043132_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3043203_3043497_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3043508_3043667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3043737_3044139_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3044241_3044610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3045129_3045825_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3045848_3046661_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3046664_3046931_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3048096_3049310_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3049483_3050068_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3050566_3051520_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3051706_3053191_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3053493_3055032_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3055081_3055429_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3055425_3055806_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3055881_3056130_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3056186_3056855_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3057352_3057535_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3057613_3058114_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3058150_3058657_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3058675_3059566_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|3059685_3060267_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|3060266_3063182_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3063246_3063846_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3063912_3067311_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3067371_3068004_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3067940_3068684_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3068689_3069388_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3069387_3069717_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3069713_3072263_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3072255_3072690_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3072671_3073094_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3073109_3073850_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3073857_3074253_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3074249_3074828_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3074839_3075193_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3075204_3075603_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3075644_3076670_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3076725_3077058_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3077067_3078387_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3078367_3079969_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3079965_3080172_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027374.1|3080168_3082094_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3082068_3082614_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3083002_3083197_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3083361_3083568_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3083853_3084264_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3084555_3084849_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3084939_3085122_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3085338_3085815_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3085801_3086107_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3086428_3087118_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3087114_3087255_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3087251_3087614_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3087610_3087901_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3087893_3088064_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3088063_3088519_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3089020_3090547_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3090604_3090727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3090791_3091124_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3091191_3091494_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3091490_3092192_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3093116_3093353_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3093342_3094485_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3094598_3095849_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3096020_3096674_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3096683_3097145_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3097198_3098305_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3098340_3098982_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3098985_3100356_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3100274:3100289	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3100524_3101196_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
3100274:3100289	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000735407.1|3101195_3102656_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133425.1|3103512_3103794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127893.1|3103807_3105469_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000113645.1|3105452_3105809_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3105932_3106115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|3106098_3106539_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|3106538_3106835_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|3106831_3107170_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000267612.1|3107166_3108378_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_000504050.1|3108379_3108952_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|3108991_3110149_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|3110440_3110665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|3110789_3111062_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|3111072_3111483_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|3111479_3111731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|3112101_3114234_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|3114230_3114530_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|3114535_3114778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|3114767_3114959_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|3114958_3115144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|3115136_3115334_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|3115359_3116103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|3116160_3116349_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|3116713_3117943_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|3118191_3119313_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3119361_3120588_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3120837_3121974_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3121957_3122821_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3123184_3124546_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3124606_3124882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3127190_3130592_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3131182_3133531_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3133550_3133640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3133652_3133889_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3133834_3134572_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3134625_3135504_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3135806_3135917_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3136026_3136281_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|3136297_3136996_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|3136995_3137337_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|3137329_3140572_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3140624_3140834_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3140929_3141304_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|3141309_3142026_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|3142084_3142429_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3142425_3142872_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3142868_3143219_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3143228_3143555_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001304108.1|3143557_3146137_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_001063094.1|3146082_3146304_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|3146348_3148286_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001507810.1|3148349_3150011_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	0.0e+00
WP_000958416.1|3150007_3150571_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3150860_3151226_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3151267_3151453_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3151582_3151723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3152079_3152304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3152368_3152575_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3152802_3152949_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3152948_3153518_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3153788_3154322_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3154372_3154717_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3154721_3154937_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3155012_3155282_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3155319_3155502_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3155649_3157587_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3157901_3158069_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3158665_3159487_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3159483_3159858_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265168.1|3159870_3160920_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3160921_3161200_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3161367_3161580_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3161768_3161873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3161988_3162576_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3162578_3162770_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3162771_3163209_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3163195_3163513_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3163466_3163784_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3163773_3164076_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3164072_3164354_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3164386_3165103_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3165136_3165679_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3165590_3166628_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3166696_3167122_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3167105_3167429_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3167553_3168030_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3168345_3168498_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3168612_3169128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3169260_3169650_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3169711_3169981_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3169949_3171068_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3171234_3172029_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3172025_3173072_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3173227_3174049_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3180706:3180726	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 10
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	3279553	3343389	5513087	transposase,integrase,protease	Escherichia_phage(23.53%)	59	3331305:3331320	3349205:3349220
WP_162829197.1|3279553_3280766_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	99.7	1.1e-168
WP_001287881.1|3281360_3281552_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3281604_3281838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3281933_3282557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3282645_3283155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3283612_3284071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3285424_3286549_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3287278_3287476_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3287541_3287757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3288401_3288581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3288632_3288827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3289607_3289943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3290575_3290794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3292246_3294337_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000301248.1|3295658_3296234_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3296302_3296881_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3296929_3297970_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3297992_3298448_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3298470_3299628_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3299627_3300209_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3300531_3301590_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3301599_3302742_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3302734_3303508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3303509_3304589_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3304588_3305545_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3305555_3306764_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3306781_3307249_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3307509_3307839_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3307825_3308167_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3309109_3310723_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3310753_3311104_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3311100_3311526_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000397129.1|3313863_3314535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3315406_3315547_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3315848_3316112_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3317323_3317941_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3317952_3318627_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3318627_3319092_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3319101_3320805_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3320797_3321118_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3321126_3321429_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|3321519_3322218_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3322598_3322874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591997.1|3323098_3324718_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3324810_3325170_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001304211.1|3325855_3326146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|3326169_3326421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028913479.1|3326468_3327074_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_162829202.1|3328856_3330070_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3330155_3330503_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998081.1|3330552_3332091_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
3331305:3331320	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_000136079.1|3332509_3332686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233452.1|3332847_3335208_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|3335362_3335926_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335698.1|3336746_3338132_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3338350_3338548_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|3338774_3339071_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282209.1|3340182_3342000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|3342186_3343389_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
3349205:3349220	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
>prophage 11
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	3402844	3554468	5513087	protease,integrase,head,tail,holin,transposase,terminase,bacteriocin,capsid,portal	Escherichia_phage(33.33%)	176	3501014:3501029	3556233:3556248
WP_001028088.1|3402844_3403339_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|3403359_3404688_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|3404770_3404878_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_000203859.1|3405867_3406497_+	phage antirepressor Ant	NA	A0A1I9LJV2	Stx_converting_phage	100.0	1.5e-113
WP_000763353.1|3406544_3406766_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|3406762_3407047_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_001120841.1|3407524_3407932_+	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	99.3	7.1e-80
WP_000426668.1|3407931_3408327_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|3408560_3408773_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|3408892_3409237_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_001507013.1|3409787_3418169_-	hypothetical protein	NA	A0A1I9LJU4	Stx_converting_phage	100.0	0.0e+00
WP_000012450.1|3418238_3419504_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3419514_3419766_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|3419775_3420222_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|3420224_3420881_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3420974_3421376_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3421432_3421573_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|3421805_3422540_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|3422630_3423248_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3423253_3423532_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|3423546_3424815_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|3424811_3426437_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|3426731_3426920_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3427059_3427329_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|3427330_3429268_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|3429264_3429915_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|3429914_3430478_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3430461_3430923_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3430972_3431362_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3431417_3432632_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3432655_3433663_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3433820_3435965_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3435964_3437671_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3437651_3438458_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000738505.1|3438866_3439160_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_015971382.1|3439250_3439436_-	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3439663_3439810_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3439809_3440379_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3440649_3441183_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3441187_3441403_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3441479_3441752_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3441792_3441972_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|3442106_3444044_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000738068.1|3444530_3444800_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3444811_3445771_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001507023.1|3446554_3446989_-	phage antitermination Q family protein	NA	A0A0P0ZCW9	Stx2-converting_phage	100.0	2.8e-82
WP_000144764.1|3446981_3447176_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|3447172_3447778_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_001004020.1|3447777_3448500_-	phage antirepressor KilAC domain-containing protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_000335902.1|3448651_3449701_-	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_000153280.1|3449882_3450410_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3450406_3450853_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3450809_3451046_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3451056_3451272_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3451404_3451683_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145931.1|3451753_3452044_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788928.1|3452040_3452742_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000185454.1|3452738_3453677_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438541.1|3453709_3454006_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|3454144_3454372_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3454450_3455158_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885203.1|3455218_3455560_+	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_001221211.1|3455627_3456089_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|3456082_3457129_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745483.1|3457131_3457296_+	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000198444.1|3457784_3458168_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|3458226_3458697_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065377.1|3458847_3459216_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198863.1|3459288_3459453_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000372941.1|3459421_3459565_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|3459640_3459937_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3459942_3460728_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3460724_3461402_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|3461401_3461584_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|3461556_3461748_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_162829202.1|3461801_3463015_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001444000.1|3463071_3463353_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3463451_3463673_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_021497462.1|3463669_3464443_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	100.0	2.3e-143
WP_000797281.1|3464594_3464783_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|3464784_3465000_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|3465001_3465220_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3465221_3465509_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001303965.1|3466484_3466784_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|3466869_3467154_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|3467206_3468517_+	DUF3596 domain-containing protein	NA	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000607020.1|3468513_3469092_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3469112_3469340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044286.1|3469377_3470619_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|3472426_3473347_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|3473346_3473652_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|3473805_3474405_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|3474401_3476948_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|3476947_3478120_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|3478249_3478942_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|3478914_3479943_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_000818441.1|3482841_3483915_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|3483963_3484098_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|3484125_3484356_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3484330_3484519_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3484529_3484742_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3485027_3485240_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|3485681_3485987_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|3486093_3486738_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|3486734_3487481_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|3487480_3489577_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|3489622_3490762_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3490749_3491196_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|3491215_3493396_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|3493515_3494820_-	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000270305.1|3494899_3494992_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460778.1|3495004_3496141_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|3496152_3497697_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|3497830_3498688_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|3498684_3499083_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|3499079_3499667_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3499663_3500371_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3500389_3502183_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3501014:3501029	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3502179_3503298_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3505571_3505841_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001230444.1|3507220_3507820_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|3507887_3511361_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|3511494_3512022_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_050546863.1|3512212_3512845_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3512790_3513534_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3513544_3514243_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3514242_3514572_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082450.1|3514568_3517148_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000533402.1|3517128_3517542_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3517568_3518000_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3518013_3518754_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3518735_3519002_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3519059_3519407_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3519443_3520949_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3520938_3522531_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3522527_3522734_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3522717_3524646_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|3524909_3526448_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3526497_3526845_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3526841_3527222_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3527297_3527573_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3528323_3528530_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3528785_3529058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3529217_3529751_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3529971_3530085_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3530306_3530492_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3531019_3531334_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3532690_3534541_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3535308_3536022_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3536642_3537461_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3537612_3537984_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3537973_3538345_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3538357_3539407_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3539408_3539687_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3539854_3540010_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3540111_3540249_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3540614_3541388_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3541739_3542153_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3542168_3542939_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3542960_3543707_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3543713_3544805_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3544883_3545339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3545545_3545971_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3545954_3546227_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3546335_3546737_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3546764_3546956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3546955_3547243_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3547520_3547676_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3547817_3548207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3548393_3548579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3549152_3549341_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3549337_3549529_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3549622_3552094_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3552161_3552404_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3552381_3553401_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3553808_3554468_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3556233:3556248	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	3842518	3881928	5513087	protease,integrase,tail,holin,transposase,terminase,lysis,portal	Enterobacteria_phage(50.0%)	51	3842103:3842117	3882002:3882016
3842103:3842117	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3842518_3843217_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3843447_3844329_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3844498_3844660_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3845156_3846176_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3846209_3847190_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3847366_3847636_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3847637_3848954_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3849013_3849613_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3849683_3853097_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3853157_3853766_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3853702_3854446_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3854451_3855150_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3855159_3855489_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3855488_3858554_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3858525_3858855_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3858863_3859250_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3859310_3860054_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3860064_3860466_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3860462_3861041_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3861052_3861328_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_162829202.1|3861465_3862678_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_171877144.1|3862681_3862957_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	2.1e-35
WP_001136597.1|3863043_3865071_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_151121012.1|3865015_3865351_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	98.2	3.5e-56
WP_010904538.1|3865472_3866597_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3866524_3866737_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3866733_3868836_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3868835_3869327_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3870001_3870154_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3870141_3870609_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3870605_3871103_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3871102_3871318_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3871460_3871859_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3871939_3872098_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3872183_3872927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3873110_3873800_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3873814_3873937_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3874274_3875234_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3875445_3876111_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3876107_3876728_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3876720_3876891_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3876887_3877070_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3877767_3878448_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3878444_3878627_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3878599_3878791_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3878801_3879083_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3879181_3879403_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3879613_3880216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3880458_3880626_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3880665_3880884_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3881157_3881928_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3882002:3882016	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	4425052	4476658	5513087	transposase,integrase,tail	Enterobacteria_phage(34.78%)	56	4418209:4418225	4474104:4474120
4418209:4418225	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000998048.1|4425052_4426591_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4426640_4426988_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4426984_4427365_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4427628_4427892_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4427891_4428032_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4428101_4428293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4429117_4429660_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4429734_4430322_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4430379_4431048_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4431073_4433599_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4433588_4435232_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4435200_4435911_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4436223_4436553_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4436800_4437415_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4437832_4438522_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|4438518_4439475_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4439471_4441670_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121321.1|4441679_4442636_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171064.1|4442814_4443942_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4444083_4445142_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4445387_4446290_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4446992_4447271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4447437_4448160_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4448258_4449158_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4449833_4450790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4450922_4453256_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4453269_4453593_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4453592_4453814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4453810_4454368_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4454364_4454625_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4455558_4456311_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4456307_4456859_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4456864_4457137_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4457546_4458113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4458112_4458703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4458733_4459366_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4459358_4459817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4459816_4460434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4460406_4460823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4460826_4462008_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4462970_4463714_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4464537_4465311_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4465368_4465923_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4465952_4466363_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4466383_4466827_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4466798_4467392_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4467391_4468186_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4468185_4468497_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4469448_4469742_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4469860_4470061_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4470161_4470875_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4471002_4471392_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4471631_4471877_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4472946_4474200_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4474104:4474120	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|4474211_4475315_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4475602_4476658_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 14
NZ_CP038321	Escherichia coli O157:H7 strain NE1127 chromosome, complete genome	5513087	4495444	4518143	5513087	transposase,plate	uncultured_Caudovirales_phage(66.67%)	18	NA	NA
WP_000027427.1|4495444_4496617_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4496697_4496883_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4496797_4497061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4497262_4499023_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4499025_4500162_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001356493.1|4500907_4501453_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4501521_4505736_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103125.1|4505811_4507953_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4508162_4508681_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4509377_4509878_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4509912_4510137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4510187_4511579_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4511669_4512083_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4512086_4513937_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4513900_4514983_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4515007_4516288_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4516284_4516809_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4516811_4518143_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP038323	Escherichia coli O157:H7 strain NE1127 plasmid pNE1127-1, complete sequence	92701	81020	89812	92701	integrase,transposase	Macacine_betaherpesvirus(66.67%)	6	77155:77168	92002:92015
77155:77168	attL	GCAAGGGAAGCCGC	NA	NA	NA	NA
WP_000138832.1|81020_82745_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
WP_000817031.1|84044_85016_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|85015_86182_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_071525396.1|86769_87108_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_162829202.1|87069_88282_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000016989.1|89005_89812_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
92002:92015	attR	GCAAGGGAAGCCGC	NA	NA	NA	NA
>prophage 1
NZ_CP038322	Escherichia coli O157:H7 strain NE1127 plasmid pNE1127-2, complete sequence	145329	18006	40923	145329	transposase,protease	Salmonella_phage(40.0%)	23	NA	NA
WP_001067855.1|18006_18711_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|19261_19966_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001206356.1|20961_21753_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|21916_22264_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|22257_23097_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|23501_25043_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000256638.1|25164_25782_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	G3BM17	Salmonella_phage	28.3	2.3e-05
WP_001274976.1|25807_26254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143450.1|26234_26795_-	trimethoprim-resistant dihydrofolate reductase DfrA23	NA	A0A076FMI9	Aureococcus_anophage	29.0	1.6e-05
WP_042849136.1|26794_27142_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	39.4	2.6e-06
WP_001138073.1|27633_30606_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|30608_31166_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001067855.1|31749_32454_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|32459_32600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|33085_33823_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|33819_34044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|34254_35748_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_021598067.1|35778_36663_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_023300759.1|36879_38094_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|38121_38427_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|38693_39893_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|39998_40649_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|40680_40923_-|transposase	transposase	transposase	NA	NA	NA	NA
