The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	1219036	1226090	5452405	transposase,tail	Enterobacteria_phage(50.0%)	7	NA	NA
WP_162829202.1|1219036_1220250_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1220467_1220737_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1220897_1221320_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1221449_1222508_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1222586_1223237_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001217542.1|1224513_1224762_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1225607_1226090_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	1506118	1511544	5452405	integrase	Enterobacteria_phage(50.0%)	6	1495106:1495122	1513740:1513756
1495106:1495122	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1506118_1506688_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1506687_1507155_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1507141_1507822_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1507831_1508968_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1509142_1510300_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1510611_1511544_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1513740:1513756	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	1756006	1843128	5452405	protease,tRNA,transposase,holin,integrase,terminase,tail,portal	Enterobacteria_phage(49.35%)	98	1762228:1762287	1839798:1841108
WP_000569336.1|1756006_1756933_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1756937_1757669_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1757649_1757757_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1757816_1758518_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1758538_1759825_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1759858_1760113_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556581.1|1760131_1760266_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_000457728.1|1760269_1760512_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1760599_1760962_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1760958_1761315_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1761648_1761825_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_153023035.1|1761826_1762273_-	hypothetical protein	NA	A0A0P0ZBW7	Stx2-converting_phage	94.5	3.1e-76
1762228:1762287	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_162829202.1|1762269_1763483_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_153023034.1|1763508_1764087_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	99.5	2.6e-99
WP_000763383.1|1764083_1764305_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1764403_1764685_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1764695_1764887_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1764859_1765042_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1765041_1765719_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1765715_1766501_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1766506_1766803_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|1766878_1767085_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1767565_1767943_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1767920_1768982_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000858974.1|1769062_1769752_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|1769856_1770087_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|1770156_1770696_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_000147876.1|1770692_1771712_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_000788810.1|1771708_1772410_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145915.1|1772406_1772709_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|1772776_1773109_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|1773200_1773308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1773365_1774892_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|1775356_1775908_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1775917_1776715_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1776831_1776933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054341.1|1776929_1777385_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_000224916.1|1777384_1777555_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1777547_1777838_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|1777834_1778197_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1778193_1778334_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1778419_1778854_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1779105_1779258_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1780061_1782008_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1782144_1782324_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1782364_1782610_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1782687_1782903_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1782907_1783441_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1783711_1784281_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1784280_1784427_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1784654_1784840_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1785357_1785834_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077621.1|1785830_1786838_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000114064.1|1786999_1788238_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|1788230_1788455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038670.1|1788514_1789096_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_088136225.1|1789076_1789796_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335965.1|1789788_1790013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551748.1|1790005_1790599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|1790795_1791038_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761774.1|1791034_1792849_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_001399692.1|1793136_1793382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|1793378_1793801_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000860403.1|1794458_1796348_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|1796605_1796887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102414.1|1798379_1798592_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1798591_1800094_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1800038_1802063_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1802150_1802477_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1802469_1802751_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1802753_1803377_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1803389_1803788_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1803795_1804548_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1804561_1804984_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1805010_1805319_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|1805362_1808008_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1808004_1808334_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1808333_1809032_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1809042_1809786_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_071601640.1|1809731_1810361_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_000514991.1|1810601_1814075_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001228302.1|1814142_1814742_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000268979.1|1814806_1816120_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001023381.1|1816121_1816391_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_001261937.1|1816758_1817007_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1817521_1819207_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1819203_1819923_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1819969_1820440_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1820481_1820943_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1821067_1823071_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1823067_1824204_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1824196_1824928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1824946_1826476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1826486_1827575_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1828815_1829133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1829194_1832824_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|1838601_1839814_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001301615.1|1841094_1843128_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
1839798:1841108	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGAATGGTCTTCCGTAAACTCAAGAAGTATCCGGCTTACACCGCGCACCCCATTATTTGCCAACAACATTGCCAGATAAGCGCGAAAATTACGAAAATCACGATACAACGGTGGGAAGTCGTATTTTTCCACTGTACTCAGAGCAGTATCATCGGTTATCACCAGTCTTAACCAGGTCATCGCCGGGACGTTTTGGTCTGCATAGCGTAGATCTATAGCATGGGCGATATCCGGGCGTTCAGGGAGCAGTAACGCCGCAAAAGGTTGCCGTGCGGGGGATAGCGTCGGAATGGCGGTGAGTACTTTATCTACACAGCGTTGCCACTCATCTTCTGAAGCGAGTGAAAGATGATGACATAGACGTTGATGCTAACTAGGTAGCGATTCTGCTTCGTGATTAGGTGGAATGATGGTGGTTACTGCGCCTTTTACTGGTTTATATTTGAGTTGAAGGGCAAAAAGGACGATTTCAACGGCGCTTTCCAGACCACAGCGAATGACTAAGTCATCGACCAGTTCATCTGCAGAGTAAGAGTTCCAAAAACTCCAGAGCAATGCTGCATCAGATTGCGCACTCCCTGTCTGTTGATTATCCAGAATTCGCCTTTGTAACTCAGCAAAAGCCTGCTGCCAGTTTTCAGGATAAGAGCGGTAATTGTTGTCGGGATCATATGCCCTGGTGTTATCTGCAATACGCTTCCATATCTCACCGTCTTTGCGCAGATAATTGATCTCTCTGGGGCGAGAGCGATGAGGAAAAGCAAATCGGTTAATATCGTCAGTTACCGGAATAACTGCATCATCAGCCAGCCACGGGCGTTGGTTTTTACTCTCAGGGGAAGTTTCAACTTCAGGAGTGGCTTTGGTGATGGGGGGGATATGCACGTTTGCTGAAGCATTTTCCACATAGCCTTTTTTCGTTTTCTCCGCGATAAGCTTCAGTTTCGCTTTTTCCGCTGCTGCAACATCCGCAAAACTTTTTATCTGGCTTTGCCCGTTAGTGCCGACTTTGCCCCAGTTGATATGCAGCTCGTTTCCCTGCTGCTCAACCGCCCAGAATTTATGTGATTTTTCGTCCTGATAGATAAAGTGTCTCATTCTGCATCCCTGTAATTTTATCCAGTTGAATGCAGATGCTACCAGTATTTATACGGGTTAGAGAGAGACAAAATCGTAAGAAAACAACTTTAGGAATTTATAAAGAAAAGGCGCTGTCGATGCAGCGCCTTGAAGGGGGATTATTTCACCTGAT	NA	NA	NA	NA
>prophage 4
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	1958084	2034012	5452405	lysis,head,protease,capsid,transposase,holin,integrase,terminase,tail,portal	Stx2-converting_phage(48.24%)	99	1949035:1949049	1965769:1965783
1949035:1949049	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|1958084_1959263_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1959243_1959435_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1959512_1959857_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1960044_1960395_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|1960391_1960748_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1961081_1961258_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289930.1|1961259_1962207_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|1962203_1962425_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1962523_1962805_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_162829202.1|1962858_1964072_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000548544.1|1964128_1964320_-	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_000682306.1|1964292_1964475_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_032084544.1|1964471_1965152_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	3.5e-132
WP_001301718.1|1965148_1965934_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
1965769:1965783	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|1965939_1966236_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|1966310_1966454_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1966422_1966587_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1966659_1967028_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1967210_1967462_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1967520_1967793_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1967770_1967953_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1968521_1969043_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1969544_1970240_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1970315_1970531_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_062946147.1|1970672_1970837_+	Cro/Cl family transcriptional regulator	NA	A4KWW1	Enterobacteria_phage	90.0	6.9e-18
WP_162829202.1|1970839_1972053_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_077881356.1|1972051_1972282_+	hypothetical protein	NA	Q37927	Escherichia_phage	87.9	2.2e-25
WP_000166961.1|1972314_1972476_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|1972462_1973284_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|1973280_1974657_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1974727_1975006_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1975138_1975354_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1975364_1975601_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1975557_1976004_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1976000_1976528_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1976524_1976707_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208502.1|1976981_1977740_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_000849633.1|1977995_1978676_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|1978750_1979473_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|1979472_1980078_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|1980074_1980746_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1980736_1981225_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1981874_1982834_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1982845_1983115_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1983411_1983735_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143109.1|1983978_1985916_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_000143458.1|1986052_1986232_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1986272_1986545_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1986621_1986837_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1986836_1987334_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1987330_1987768_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1987970_1988468_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1988464_1988722_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1989184_1989412_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|1989453_1989819_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_062946146.1|1990111_1990675_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	98.9	6.8e-89
WP_001301491.1|1990671_1992333_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1992396_1994334_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1994378_1994600_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001303195.1|1994545_1997047_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.2	0.0e+00
WP_000126019.1|1997126_1997453_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1997462_1997813_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1997809_1998256_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1998252_1998597_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1998655_1999372_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1999377_1999752_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1999847_2000057_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212920.1|2000108_2003351_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|2003343_2003685_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001302649.1|2004427_2004748_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2004855_2005029_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001414206.1|2005099_2006023_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
WP_000967278.1|2006077_2006815_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	3.8e-148
WP_122994717.1|2006760_2007393_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_171877079.1|2007631_2011111_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.8	0.0e+00
WP_001230514.1|2011178_2011778_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_062946144.1|2011842_2013156_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.4	1.4e-81
WP_001023455.1|2013157_2013427_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000491542.1|2013567_2014443_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2014667_2015318_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2016641_2017808_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2017926_2018400_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2018598_2019657_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2019828_2020158_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2020258_2020441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2020929_2021043_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2021055_2021250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2021708_2022077_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2022150_2022372_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2022434_2022911_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860080.1|2022925_2023405_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	5.2e-13
WP_001234544.1|2023486_2024308_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2024528_2024939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2024954_2025638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2025773_2026844_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2026840_2027746_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_061069249.1|2027742_2028597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966626.1|2028878_2031026_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2032473_2034012_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 5
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	2058397	2102910	5452405	head,capsid,transposase,holin,integrase,terminase,tail	Stx2-converting_phage(43.48%)	53	2038668:2038682	2062522:2062536
2038668:2038682	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000533600.1|2058397_2059420_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2059419_2059623_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2059681_2062153_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2062248_2062437_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2062433_2062622_-	cell division inhibitor	NA	NA	NA	NA	NA
2062522:2062536	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2063102_2063255_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2063529_2064174_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2064271_2064499_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2064495_2064921_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2064989_2066027_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2065938_2066481_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2066515_2067214_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2067235_2067460_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2067456_2067813_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2067845_2067998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2067994_2068306_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2068432_2068996_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2069105_2069210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2069396_2069609_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2069776_2070055_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2070056_2071106_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2071118_2071478_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2071474_2072164_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2072797_2073226_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2073703_2075554_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2075635_2076849_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024180155.1|2077159_2077375_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2077379_2077724_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2077774_2078308_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2078578_2079148_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2079147_2079294_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2079521_2079707_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2080131_2080359_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2080400_2080766_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958392.1|2081055_2081619_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_001303179.1|2081615_2083277_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_062946127.1|2083340_2085278_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001063023.1|2085322_2085544_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125988.1|2087584_2087911_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007901.1|2087920_2088271_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2088267_2088714_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001275508.1|2089113_2089830_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2089835_2090210_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2090305_2090515_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212925.1|2090566_2093809_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807954.1|2093801_2094143_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303180.1|2094142_2094841_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.4	2.9e-129
WP_000194720.1|2094851_2095595_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2095540_2096173_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000514693.1|2096515_2098084_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.2	1.1e-298
WP_001230508.1|2100661_2101261_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268847.1|2101325_2102639_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|2102640_2102910_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	2160429	2180415	5452405	transposase,tail,integrase	Enterobacteria_phage(75.0%)	28	2173551:2173564	2183557:2183570
WP_032161583.1|2160429_2161566_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2161516_2161840_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2161997_2163182_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2163181_2163694_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2163748_2164114_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2164122_2164278_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2167080_2167569_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2167725_2168298_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2168341_2168872_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2169963_2170278_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2170282_2171242_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2171318_2174141_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2173551:2173564	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2174147_2174513_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2174509_2175127_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2175138_2175438_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2175434_2175701_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2175697_2175901_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2175924_2176341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2176433_2176547_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2176543_2176786_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2176797_2177076_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2177086_2177437_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2177458_2177662_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2177733_2177871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2177960_2178365_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2178380_2179031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2179060_2179408_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2179413_2180415_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2183557:2183570	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	2499640	2614260	5452405	head,protease,capsid,transposase,holin,tail,terminase,portal	Stx2-converting_phage(41.9%)	135	NA	NA
WP_001260835.1|2499640_2500462_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2500561_2500645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2500737_2501073_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2501469_2502723_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2502829_2503723_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2503857_2505078_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2505202_2505898_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2505850_2507143_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2507300_2507915_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2507957_2508812_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2508813_2509431_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2509441_2511865_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2511925_2514352_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2514550_2514856_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2514963_2515674_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2515676_2516237_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2516271_2516613_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2516747_2517074_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2518062_2518314_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2518386_2520858_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2520950_2521142_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2521138_2521327_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2521727_2521892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2521895_2522114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2522185_2522485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2522836_2523115_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2523116_2523308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2523328_2523700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2523797_2524100_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2524096_2524522_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2524544_2525507_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2525513_2526254_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2527064_2527460_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2527516_2528101_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2528216_2528321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2528509_2528722_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2528889_2529168_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_062946124.1|2529169_2530219_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	4.2e-108
WP_001217455.1|2530231_2530591_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2530587_2531277_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2531913_2532342_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2532820_2534671_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2535110_2535326_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2535330_2535675_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2535725_2536259_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2536529_2537099_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2537098_2537245_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2537472_2537658_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2538082_2538310_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2538351_2538717_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958360.1|2539007_2539571_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_001301491.1|2539567_2541229_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2541292_2543230_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2543274_2543496_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001356761.1|2543441_2546021_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.0	0.0e+00
WP_000125988.1|2546023_2546350_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2546359_2546710_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2546706_2547153_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2547149_2547494_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2547559_2548276_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2548290_2548665_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2548760_2548970_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_062946125.1|2549017_2552260_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_000807954.1|2552252_2552594_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|2552593_2553031_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_062946126.1|2553218_2556695_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_001230508.1|2556762_2557362_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2557426_2558650_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2558651_2558921_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2559034_2559610_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2560320_2560971_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2561553_2563092_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2563141_2563489_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_171877084.1|2563485_2563866_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
WP_001120551.1|2564828_2565071_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2565781_2567026_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2567118_2567307_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2567303_2567492_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2568056_2568266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2568266_2568905_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2568916_2569069_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2569361_2569700_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2570091_2570334_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2570317_2570743_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001356791.1|2570811_2571867_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.7	1.6e-83
WP_000139447.1|2571859_2572321_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2572354_2573071_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2573103_2573385_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2573381_2573609_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2573601_2573913_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2574040_2574259_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2574260_2574818_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2575051_2575264_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2575383_2575728_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191871.1|2575849_2576122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265229.1|2576123_2577173_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2577185_2577491_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2577553_2578108_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2578332_2578530_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2578665_2579379_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2579829_2580261_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2580738_2582589_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2583027_2583243_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2583247_2583592_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2583642_2584176_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2584446_2585016_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2585015_2585162_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2585389_2585575_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2585999_2586227_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2586268_2586634_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958392.1|2586923_2587487_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_001303179.1|2587483_2589145_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_062946127.1|2589208_2591146_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001063023.1|2591190_2591412_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125988.1|2593452_2593779_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007901.1|2593788_2594139_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2594135_2594582_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001275508.1|2594981_2595698_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2595703_2596078_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2596173_2596383_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212925.1|2596434_2599677_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807954.1|2599669_2600011_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303180.1|2600010_2600709_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.4	2.9e-129
WP_000194720.1|2600719_2601463_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2601408_2602041_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000514693.1|2602383_2603952_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.2	1.1e-298
WP_001230508.1|2606529_2607129_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268849.1|2607193_2608507_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001023407.1|2608508_2608778_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2608891_2609467_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2609539_2610169_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2610250_2610892_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2611053_2611296_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2611427_2612711_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2612799_2614260_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
>prophage 8
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	2885535	2961534	5452405	lysis,head,protease,capsid,transposase,tail,holin,terminase,integrase,portal	Enterobacteria_phage(33.33%)	85	2901037:2901064	2961697:2961724
WP_000422055.1|2885535_2886585_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2886804_2887563_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2887559_2888150_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2888189_2889062_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2889274_2890858_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2890885_2891506_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2891502_2892384_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2892521_2892566_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2892657_2894220_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2894219_2895815_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2895815_2897177_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2897188_2898382_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2898381_2899188_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2899568_2899748_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2899833_2900334_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2900379_2900886_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2901037:2901064	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001345079.1|2902199_2902850_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|2904356_2904947_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2905130_2905778_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2905914_2906061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2906488_2906767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2907106_2907487_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2907483_2907831_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2907880_2909419_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2910384_2910954_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2911019_2911931_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2912037_2912160_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2913757_2915083_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2916109_2916379_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_115448892.1|2916380_2917694_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	97.7	2.9e-74
WP_001228334.1|2917845_2918445_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_062946197.1|2918512_2921368_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.6	0.0e+00
WP_071601640.1|2921608_2922238_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_000194801.1|2922183_2922927_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|2922937_2923636_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2923635_2923965_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_062946195.1|2923961_2926574_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.8	0.0e+00
WP_000533440.1|2926554_2926968_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2926994_2927417_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2927430_2928183_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2928190_2928586_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2928582_2929116_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2929130_2929484_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2929495_2929894_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2929935_2930961_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2931016_2931349_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2931358_2932678_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2932658_2934260_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2934256_2934463_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2934459_2936385_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2936359_2936905_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2937291_2937516_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2937597_2937912_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001082601.1|2938375_2938843_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_000539792.1|2938850_2938997_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2938996_2939566_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2939836_2940370_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2940420_2940765_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2940769_2940985_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_062946194.1|2941134_2942988_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.6	0.0e+00
WP_000917750.1|2944992_2945190_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2945431_2945962_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2945970_2946330_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2946342_2947389_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2947390_2947669_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_162829202.1|2947996_2949210_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000961820.1|2949529_2949742_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2950020_2950779_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2951477_2951642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2951638_2952220_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2952406_2952949_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2952860_2953901_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2953872_2954424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2954407_2954635_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2954711_2955119_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2955382_2955682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2955754_2955973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2955995_2956403_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2956380_2956614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2956607_2956775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2957172_2957361_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090196.1|2957357_2957549_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2957641_2960113_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2960177_2960426_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2960403_2961534_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2961697:2961724	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	3008256	3117250	5452405	lysis,head,protease,tRNA,capsid,transposase,tail,holin,terminase,integrase,portal	Enterobacteria_phage(46.43%)	113	3044121:3044136	3111153:3111168
WP_001299679.1|3008256_3009513_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3009726_3010350_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3010349_3011201_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3011351_3012299_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3012423_3014103_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3014157_3014436_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3014713_3015298_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3015414_3016506_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3017349_3020235_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3020334_3022254_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3022481_3023552_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3023562_3024195_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3024205_3025624_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3027655_3027856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3027963_3028986_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3028985_3029966_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3029962_3030721_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3031539_3032394_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3032419_3034390_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3034439_3034694_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020151.1|3034894_3035626_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|3035627_3036239_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3036338_3037253_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3037348_3039085_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3039242_3040456_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3040793_3041864_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3041873_3043172_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3043534_3045067_+	SpoVR family protein	NA	NA	NA	NA	NA
3044121:3044136	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3045118_3045838_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_054632508.1|3046059_3047601_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3047746_3048277_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3048322_3049591_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3049590_3050010_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3050382_3051294_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3051500_3051962_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3052038_3052698_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3052769_3053063_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3053074_3053233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3053303_3053705_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3053807_3054176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3054695_3055391_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3055414_3056227_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3056230_3056497_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3057662_3058876_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3059049_3059634_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3060132_3061086_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3061272_3062757_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998042.1|3063059_3064598_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|3064647_3064995_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3064991_3065372_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3065447_3065696_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3065752_3066421_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3066918_3067101_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3067179_3067680_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3067716_3068223_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3068241_3069132_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3069251_3069833_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3069832_3072748_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3072812_3073412_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3073478_3076877_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3076937_3077570_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3077506_3078250_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3078255_3078954_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3078953_3079283_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_062946192.1|3079279_3081829_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.2	0.0e+00
WP_000459457.1|3081821_3082256_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3082237_3082660_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3082675_3083416_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3083423_3083819_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3083815_3084394_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3084405_3084759_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3084770_3085169_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3085210_3086236_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3086291_3086624_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3086633_3087953_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3087933_3089535_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3089531_3089738_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3089734_3091660_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3091634_3092180_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3092568_3092763_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3092927_3093134_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_171877087.1|3093419_3093830_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	6.1e-71
WP_162829202.1|3094018_3095232_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738495.1|3095434_3095728_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3095818_3096001_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3096217_3096694_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3096680_3096986_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3097307_3097997_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3097993_3098134_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3098130_3098493_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3098489_3098780_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3098772_3098943_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3098942_3099398_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709088.1|3099899_3101426_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3101483_3101606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3101670_3102003_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3102070_3102373_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3102369_3103071_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3103995_3104232_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3104221_3105364_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3105477_3106728_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3106899_3107553_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3107562_3108024_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3108077_3109184_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3109219_3109861_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3109864_3111235_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3111153:3111168	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3111403_3112075_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3112074_3113535_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3114135_3114417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3114672_3115215_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_062946191.1|3115420_3115834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3115846_3116182_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3116194_3117250_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	3123342	3180694	5452405	head,capsid,tail,integrase,terminase,holin,portal	Stx2-converting_phage(26.79%)	71	3166261:3166281	3187351:3187371
WP_000085256.1|3123342_3124572_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3124820_3125942_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3125990_3127217_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3127466_3128603_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3128586_3129450_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3129813_3131175_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3131235_3131511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3133819_3137221_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3137811_3140160_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3140179_3140269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3140281_3140518_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3140463_3141201_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3141254_3142133_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3142435_3142546_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3142655_3142910_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3142926_3143625_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807950.1|3143624_3143966_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212850.1|3143958_3147201_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_001453698.1|3147253_3147463_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|3147558_3147933_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3147947_3148664_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3148729_3149074_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3149070_3149517_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3149513_3149864_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3149873_3150200_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001356761.1|3150202_3152782_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.0	0.0e+00
WP_001063099.1|3152727_3152949_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3152993_3154931_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3154994_3156656_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3156652_3157216_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_065225440.1|3157505_3157871_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	3.8e-64
WP_001302295.1|3157912_3158098_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3158227_3158368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3158724_3158949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3159013_3159220_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3159447_3159594_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3159593_3160163_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3160433_3160967_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3161017_3161362_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3161366_3161582_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3161657_3161927_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3161964_3162147_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3162294_3164232_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3164546_3164714_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3165310_3166132_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3166128_3166503_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3166261:3166281	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3166515_3167565_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3167566_3167845_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3168012_3168225_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3168413_3168518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3168633_3169221_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3169223_3169415_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3169416_3169854_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3169840_3170158_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3170111_3170429_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3170418_3170721_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3170717_3170999_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3171031_3171748_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3171781_3172324_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3172235_3173273_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3173341_3173767_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3173750_3174074_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3174198_3174675_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3174990_3175143_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3175257_3175773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3175905_3176295_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3176356_3176626_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3176594_3177713_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3177879_3178674_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3178670_3179717_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3179872_3180694_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3187351:3187371	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	3455363	3510970	5452405	head,protease,capsid,transposase,tail,holin,portal	Escherichia_phage(26.19%)	61	NA	NA
WP_000003653.1|3455363_3455951_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3455947_3456655_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3456673_3458467_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001301613.1|3458463_3459582_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3461854_3462124_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3462125_3463439_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230444.1|3463503_3464103_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_171877088.1|3464170_3467644_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_000649829.1|3467777_3468305_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3468495_3469128_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_050946666.1|3469073_3469817_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	8.6e-148
WP_001151105.1|3469827_3470526_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3470525_3470855_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082464.1|3470851_3473431_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.2	0.0e+00
WP_000533402.1|3473411_3473825_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3473851_3474283_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3474296_3475037_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3475018_3475285_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3475342_3475690_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3475726_3477232_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3477221_3478814_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3478810_3479017_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3481193_3482732_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3482781_3483129_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3483125_3483506_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3483581_3483857_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3484607_3484814_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3485069_3485342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3485501_3486035_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3486255_3486369_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3486590_3486776_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3487303_3487618_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3487822_3489036_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3489211_3491062_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3491829_3492543_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3493163_3493982_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3494133_3494505_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3494494_3494866_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3494878_3495928_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3495929_3496208_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3496375_3496531_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3496632_3496770_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3497135_3497909_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3498260_3498674_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3498689_3499460_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788745.1|3499481_3500228_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_072141648.1|3500234_3501320_-	DNA-binding protein	NA	V5URT9	Shigella_phage	70.4	3.0e-133
WP_000273724.1|3501398_3501854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3502060_3502486_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3502469_3502742_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3502850_3503252_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3503279_3503471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3503470_3503758_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3504035_3504191_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3504332_3504722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3504908_3505094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3505667_3505856_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3505852_3506044_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3506137_3508609_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3508676_3508919_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375128.1|3510310_3510970_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
>prophage 12
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	3741897	3779998	5452405	lysis,protease,tail,holin,terminase,integrase,portal	Enterobacteria_phage(48.84%)	50	3741482:3741496	3780072:3780086
3741482:3741496	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3741897_3742596_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951025.1|3742826_3743708_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_072127173.1|3743877_3744039_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3744535_3745555_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3745588_3746569_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_062946182.1|3746793_3747015_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.6	1.4e-34
WP_089558299.1|3747016_3748333_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001233141.1|3748392_3748992_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3749062_3752476_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3752536_3753145_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3753081_3753825_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_171877090.1|3753830_3754529_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	4.3e-133
WP_000447253.1|3754538_3754868_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3754867_3757933_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3757904_3758234_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3758242_3758629_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3758689_3759433_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3759443_3759845_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3759841_3760420_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3760431_3760707_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3760699_3761023_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3761109_3763137_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3763081_3763417_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3763538_3764663_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3764590_3764803_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934096.1|3764799_3766902_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3766901_3767393_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3768067_3768220_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3768207_3768675_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3768671_3769169_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3769168_3769384_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3769526_3769925_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3770005_3770164_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3770249_3770993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3771176_3771866_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3771880_3772003_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3772340_3773300_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3773511_3774177_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3774173_3774794_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3774786_3774957_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3774953_3775136_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3775833_3776514_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3776510_3776693_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3776665_3776857_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3776867_3777149_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3777247_3777469_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3777679_3778282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3778524_3778692_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3778731_3778950_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3778927_3779998_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3780072:3780086	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	4310301	4421577	5452405	transposase,tail,integrase,plate	Enterobacteria_phage(25.0%)	106	4310260:4310319	4372095:4373404
4310260:4310319	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_162829202.1|4310301_4311515_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001301722.1|4312021_4312891_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.5e-53
WP_000621002.1|4313139_4313997_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092592.1|4314117_4318371_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001038968.1|4319704_4320061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301573.1|4320348_4321275_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860023.1|4321431_4322352_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000182335.1|4322586_4323729_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000998048.1|4324540_4326079_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4326128_4326476_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4326472_4326853_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4327116_4327380_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4327379_4327520_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4327589_4327781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4328605_4329148_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4329222_4329810_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4329867_4330536_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4330561_4333087_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4333076_4334720_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4334688_4335399_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4335711_4336041_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4336288_4336903_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4337320_4338010_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4338006_4338963_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4338959_4341158_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4341167_4342124_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4342302_4343430_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4343571_4344630_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4344875_4345778_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4346480_4346759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4346925_4347648_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4347746_4348646_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4349321_4350278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4350410_4352744_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4352757_4353081_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4353080_4353302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4353298_4353856_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4353852_4354113_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4355046_4355799_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4355795_4356347_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4356352_4356625_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4357034_4357601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647286.1|4357800_4358190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4358220_4358853_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4358845_4359304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4359303_4359921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4359893_4360310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4360313_4361495_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4362457_4363201_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4364024_4364798_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4364855_4365410_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4365439_4365850_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4365870_4366314_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4366285_4366879_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4366878_4367673_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4367672_4367984_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4368935_4369229_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4369347_4369548_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4369648_4370362_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_062946174.1|4370489_4370873_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	35.3	2.9e-06
WP_162829202.1|4370898_4372111_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303805.1|4372438_4372684_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4373753_4375007_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4372095:4373404	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCATAACCAATTGTATTTATTTTAAAATTAATAGGTGCAACTCACTAAACAACGCAATTCTGATCTCTCGATCACCTCCCAAGCCACACAACCCTGCAAAAAATAAATCTATATAAAAAACATACAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTGTTGACACAAATACCACTAGCGGTGATACTAAGCACATCAGCAGGACGCACTAACCACCATGAAGGTGATGCTCTTAAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGTGTGTGTGATACGAAACGAAGCATTGGCCGGAAGTGCGAATCCGGATTAGCAGCCAATGTGCCATTGCGGGGTGTTTTCGTTCAGGACTACGACTCCCACACACAACCAAAGCTAACTAACAGGAGAATCCAGATGGATGCACAAACACGCCGCCGCGAACGTCGCGCAGAGAAACAGGCTCAATGGAAAGCAGATCGGATTCTGGCTTCAACATTTCGCAGGAATGCAACTAAGAGACATTACTGAATCAAAAATTTATTCAGCAATGCAGAAAATGACGAACCGGCGTCATGAGGAAAACTGGAAACTCAGGGCAGAAGCATGCAGAAAAAAAGGGAAACCTGTTCCAGAATACACGCCAAAACCAGCGTCCGTTGCAACGAAGGCTACGCATCTTTCATTTATAAAGGCCCTGCTAAGAGCCGCAGAGCGTGAATGGAAAATGCTCGATAAGGCACCAATTATTAAAGTGCCTCAACCAAAGAATAAACGGATCCGCTGGCTGGAGCCCCATGAAGCACAAAGGCTGATTGATGAATGTCCGGAGCCATTAAAGTCTGTTGTTGAATTTGCACTGGCAACAGGCTTAAGACGCTCGAACATCATCAACCTTGAATGGCAACAAATAGATATGCAGCGCCGGGTGGCATGGATAAACCCGGAAGAGAGTAAATCAAACCGCGCAATTGGCGTTGCGCTGAATGATACTGCATGTCGCGTATTGAAAAAACAAATCGGTAATCATCACCGTTGGGTATTTGTGTACAAGGAAAGCTGTACCAAACCAGACGGAACGAAAGCGCCAACAGTAAGGAAGATGCGGTATGACGCAAACACAGCCTGGAAAGCGGCGCTGAGACGGGCTGGTATTGATGATTTCAGATTTCACGACTTGAGACACACCTGGGCAAGTTGGCTGGTTCAAGCCGGAGTCCCGTTGTCAGTGTTACAGGAAATGGGAGGCTG	NA	NA	NA	NA
WP_001285288.1|4375018_4376122_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4376409_4377465_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4377503_4377905_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4377962_4379207_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4379298_4379757_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4380017_4381475_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4381531_4382089_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4382000_4382267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4382573_4383026_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4383035_4383434_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4383436_4383730_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4383781_4384837_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4384907_4385693_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001303130.1|4385637_4387377_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4388194_4388968_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4389153_4389414_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4389432_4389693_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4389848_4390589_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4390559_4391327_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4391431_4392010_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4392249_4394694_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4394736_4395210_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4395363_4396134_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4396251_4397424_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4397504_4397690_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4397604_4397868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4398069_4399830_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4399832_4400969_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001690273.1|4401714_4402314_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339420.1|4402382_4403891_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_000995683.1|4404072_4404789_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_062946173.1|4404928_4409170_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103125.1|4409245_4411387_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4411596_4412115_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4412811_4413312_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4413346_4413571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4413621_4415013_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4415103_4415517_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4415520_4417371_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4417334_4418417_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4418441_4419722_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4419718_4420243_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4420245_4421577_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 14
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	4676252	4751359	5452405	protease,tRNA,tail,holin,terminase,integrase,portal	Enterobacteria_phage(42.11%)	79	4702246:4702271	4754420:4754445
WP_001223147.1|4676252_4676939_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4677338_4677479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4677574_4678291_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920320.1|4678350_4679703_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219596.1|4679760_4681185_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	2.1e-09
WP_001188676.1|4681184_4681874_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|4681886_4682360_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4682570_4683440_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4683436_4684084_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_171877094.1|4684135_4684648_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4684794_4685121_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|4685210_4687148_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_062946172.1|4687358_4689026_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	6.4e-42
WP_000007440.1|4689132_4689300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093817.1|4689333_4690566_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	4.7e-82
WP_062946171.1|4690586_4691969_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|4692017_4692986_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000105832.1|4693763_4694780_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566150.1|4694811_4695075_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224877.1|4695235_4695955_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4696011_4697235_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|4697286_4698609_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|4698735_4699515_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001088433.1|4701293_4702157_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
4702246:4702271	attL	CGGATGCGGCGTGAACGCCTTATCCG	NA	NA	NA	NA
WP_000563014.1|4702370_4703153_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000531527.1|4703149_4704223_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4704344_4704506_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001301888.1|4704632_4705238_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4705630_4707217_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217540.1|4707436_4707685_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_001023420.1|4708052_4708322_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_078267904.1|4708323_4709637_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_136750231.1|4709701_4710301_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.5	6.3e-109
WP_171877095.1|4710367_4713844_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.8	0.0e+00
WP_097454001.1|4714084_4714714_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_078342983.1|4714659_4715403_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.8	2.9e-148
WP_001365123.1|4715413_4716112_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_000847298.1|4716111_4716441_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_171877096.1|4716437_4719083_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	98.6	0.0e+00
WP_000532073.1|4719126_4719435_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|4719461_4719884_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|4719897_4720650_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|4720657_4721056_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|4721068_4721692_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|4721694_4721976_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|4721968_4722295_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001365078.1|4722382_4724362_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_000974567.1|4724351_4725854_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|4725853_4726066_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|4726062_4728186_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|4728182_4728659_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|4729134_4729320_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092872.1|4729838_4730372_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	6.2e-100
WP_001041949.1|4730883_4731675_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284518.1|4731678_4731894_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290230.1|4731971_4732217_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|4732257_4732437_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_171877097.1|4732573_4734520_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.0	0.0e+00
WP_000115362.1|4735228_4735654_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	98.6	1.0e-73
WP_001047089.1|4735934_4736687_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	2.6e-136
WP_123122822.1|4736700_4737690_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	8.1e-194
WP_001072673.1|4737697_4738513_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.9e-149
WP_062882411.1|4738675_4739071_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	96.0	9.1e-64
WP_000066918.1|4739067_4739721_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_047661536.1|4739815_4740646_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	97.1	3.5e-118
WP_000620690.1|4740642_4740867_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	97.3	4.8e-38
WP_171877098.1|4740863_4742012_-	Rha family transcriptional regulator	NA	K7PLX4	Enterobacteria_phage	84.1	4.2e-170
WP_062859755.1|4742008_4742593_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	9.3e-57
WP_001231956.1|4742620_4742818_-	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|4742913_4743567_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_000135680.1|4744024_4744387_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|4744452_4745277_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|4745404_4745941_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_032276167.1|4745931_4746282_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	97.4	7.8e-59
WP_047661319.1|4746278_4746923_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	97.2	4.1e-130
WP_078280241.1|4746919_4748092_+	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	42.8	3.2e-64
WP_001061360.1|4748091_4748307_+	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	98.4	1.1e-31
WP_000566662.1|4748537_4749764_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_001218280.1|4750135_4751359_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	97.8	1.5e-234
4754420:4754445	attR	CGGATGCGGCGTGAACGCCTTATCCG	NA	NA	NA	NA
>prophage 15
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	4884978	4943989	5452405	transposase,protease	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|4884978_4886331_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4886424_4886976_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4887131_4888505_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4888680_4889679_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4889711_4890707_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4890693_4891716_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000265942.1|4893371_4894328_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4894637_4895168_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4895247_4895598_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4895591_4895843_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4896054_4896396_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4896398_4900178_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4900174_4901908_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4902113_4902752_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4903074_4904418_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4904496_4904703_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4905027_4905582_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937659.1|4905644_4906583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4906794_4907535_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4907724_4909668_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4909785_4910166_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4910254_4911115_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4911222_4912188_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4912295_4912958_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4913002_4914415_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4914723_4915344_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4915561_4916200_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4916334_4917543_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4917550_4917982_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4918604_4919399_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4919469_4919919_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4919960_4920188_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4920192_4920507_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4920513_4920909_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4921235_4921511_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4921639_4922326_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949515.1|4922325_4923180_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4923189_4923840_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4923853_4924318_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4924327_4924633_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4924648_4926046_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4926400_4927465_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4927572_4928328_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4928324_4929074_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4929255_4929585_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4929733_4930009_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4930125_4931751_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4931834_4932998_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4933000_4933639_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4933648_4934047_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4934064_4934724_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4934774_4935473_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4935491_4935893_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4936019_4936751_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4936931_4939373_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4939411_4939837_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4940041_4941340_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4941443_4941641_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4941722_4942727_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4942729_4943989_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 16
NZ_CP038319	Escherichia coli O157:H7 strain NE122 chromosome, complete genome	5452405	5080869	5095534	5452405	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	5076710:5076725	5094239:5094254
5076710:5076725	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5080869_5082285_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5082367_5083351_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5083516_5083759_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5083892_5084930_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5085018_5086116_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5086177_5086426_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5086586_5087228_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5087309_5087939_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5088011_5088584_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5088695_5088965_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268962.1|5088966_5090280_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230514.1|5090344_5090944_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5092265_5092802_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5092792_5093143_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5093139_5093424_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5093759_5093957_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5094301_5094583_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5094239:5094254	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5094630_5094804_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5095000_5095534_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038320	Escherichia coli O157:H7 strain NE122 plasmid pNE122-1, complete sequence	95338	19657	28768	95338	transposase,integrase	Stx2-converting_phage(50.0%)	9	15559:15572	30764:30777
15559:15572	attL	TACATCCCGTCAGC	NA	NA	NA	NA
WP_000987091.1|19657_21778_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|21781_23221_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|23287_23482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|23671_24052_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|24048_24396_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|24445_25984_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_010891288.1|26414_26645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|26765_27506_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|27790_28768_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
30764:30777	attR	TACATCCCGTCAGC	NA	NA	NA	NA
