The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	1173531	1244687	5492443	integrase,holin,transposase,tail,tRNA	Enterobacteria_phage(19.23%)	66	1173484:1173498	1236451:1236465
1173484:1173498	attL	ACGCTGGAGCTGGTG	NA	NA	NA	NA
WP_000047193.1|1173531_1176162_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1176396_1176582_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|1177809_1178376_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287450.1|1178372_1178801_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611788.1|1178873_1180430_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130215.1|1180579_1181095_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1181158_1182697_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001302673.1|1182713_1183886_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1184012_1184543_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119749.1|1184633_1184969_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1184958_1185696_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000165714.1|1185819_1187004_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216525.1|1187195_1188188_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774978.1|1188244_1189309_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985501.1|1189301_1190504_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.9e-27
WP_000777971.1|1190859_1191819_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.9e-132
WP_000246553.1|1191828_1193973_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.9e-196
WP_000080947.1|1193945_1194356_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|1194352_1194598_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000209792.1|1194806_1195238_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001138451.1|1195325_1196660_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001295174.1|1196809_1197139_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1197290_1197635_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1197671_1198121_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1198788_1199193_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229446.1|1199245_1199764_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000138003.1|1199773_1200073_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1200255_1200414_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|1200497_1200947_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1200947_1201610_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001301367.1|1201630_1203031_-	GABA permease	NA	NA	NA	NA	NA
WP_000097647.1|1203268_1204549_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_000772884.1|1204562_1206011_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271966.1|1206033_1207302_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001301435.1|1207321_1208299_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000906745.1|1212276_1213626_+	DUF5507 domain-containing protein	NA	NA	NA	NA	NA
WP_072145424.1|1214013_1214223_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.2	1.7e-08
WP_001120794.1|1214377_1214497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|1217870_1219083_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000800629.1|1220886_1221738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001071599.1|1221837_1222044_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000540864.1|1222366_1223572_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1223573_1224887_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001052051.1|1226529_1226928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1227025_1227439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077890312.1|1227834_1229211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1229286_1229622_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1229624_1230380_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1230709_1231276_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1231250_1231862_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1231858_1232524_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1232520_1233144_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1233396_1234140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1234225_1234393_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1234800_1236654_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
1236451:1236465	attR	ACGCTGGAGCTGGTG	NA	NA	NA	NA
WP_000284517.1|1236803_1237019_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1237023_1237368_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1237724_1238105_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1238101_1238449_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1239066_1239336_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1239496_1239919_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1240048_1241107_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1241185_1241836_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1242018_1242609_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1243110_1243359_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1244204_1244687_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	1387202	1449706	5492443	transposase,head,plate,protease,tail,tRNA	Shigella_phage(55.0%)	77	NA	NA
WP_000489651.1|1387202_1388666_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000892044.1|1388878_1389940_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_001244742.1|1389977_1390826_-	formate transporter	NA	NA	NA	NA	NA
WP_001251535.1|1390847_1392860_-	DNA-binding transcriptional regulator HyfR	NA	NA	NA	NA	NA
WP_001301950.1|1392889_1393303_-	hydrogenase 4 assembly chaperone HyfJ	NA	NA	NA	NA	NA
WP_000075555.1|1393295_1394054_-	hydrogenase 4 catalytic subunit HyfI	NA	NA	NA	NA	NA
WP_000916078.1|1394050_1394596_-	hydrogenase 4 subunit H	NA	NA	NA	NA	NA
WP_001102329.1|1394605_1396321_-	hydrogenase 4 catalytic subunit HyfG	NA	NA	NA	NA	NA
WP_000122526.1|1396310_1397891_-	hydrogenase 4 subunit F	NA	NA	NA	NA	NA
WP_000077537.1|1398479_1399010_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|1399200_1399449_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289290.1|1399450_1401541_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_000129790.1|1401611_1402544_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000268103.1|1402546_1402768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|1402780_1403035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|1403036_1403318_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|1403314_1403587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|1403591_1403885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|1403896_1404427_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|1404524_1405067_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564283.1|1405070_1405604_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000465559.1|1405603_1406119_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000977060.1|1406122_1406674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|1406670_1406856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021235.1|1406894_1407227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|1407219_1407417_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|1407406_1407703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|1407699_1408209_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852377.1|1408278_1408704_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|1408775_1409276_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|1409310_1409739_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|1409722_1409941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342746.1|1409950_1410178_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|1410158_1410467_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279084.1|1410463_1410754_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000360581.1|1410756_1411338_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057672.1|1411337_1413002_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000532593.1|1413001_1414591_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_000046893.1|1414574_1415900_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000094804.1|1416018_1416492_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000850811.1|1416668_1417793_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_001142982.1|1417792_1418740_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002060.1|1418783_1419152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|1419148_1419568_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|1419564_1420125_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|1420125_1420371_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|1420367_1421870_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|1421878_1422244_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|1422258_1422735_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|1422861_1424937_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000146116.1|1424923_1426273_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|1426256_1427381_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|1427370_1427985_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|1427977_1428415_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|1428414_1429497_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|1429487_1430048_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|1430047_1430959_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|1430993_1431515_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|1431594_1431798_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|1432020_1432581_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|1432680_1434720_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|1434866_1435049_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|1435084_1435330_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|1435368_1435833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|1435947_1436148_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|1436101_1436839_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_000429091.1|1437299_1438739_-	hydrogenase 4 subunit HyfD	NA	NA	NA	NA	NA
WP_001301932.1|1438755_1439703_-	hydrogenase 4 subunit HyfC	NA	NA	NA	NA	NA
WP_000339489.1|1439713_1441732_-	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_001301767.1|1441731_1442349_-	hydrogenase 4 subunit HyfA	NA	NA	NA	NA	NA
WP_001068682.1|1442601_1443072_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_000176187.1|1443071_1443644_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_001295469.1|1443789_1444668_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_001301951.1|1444684_1445719_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_001295467.1|1445931_1446645_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
WP_001267498.1|1446812_1447676_+	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000829317.1|1447690_1449706_+|tRNA	tRNA cytosine(34) acetyltransferase TmcA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	1562324	1567750	5492443	integrase	Enterobacteria_phage(50.0%)	6	1551312:1551328	1569946:1569962
1551312:1551328	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1562324_1562894_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1562893_1563361_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1563347_1564028_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1564037_1565174_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1565348_1566506_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1566817_1567750_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1569946:1569962	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	1812031	1912976	5492443	terminase,holin,portal,protease,tail,tRNA	Enterobacteria_phage(50.68%)	110	NA	NA
WP_000569336.1|1812031_1812958_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1812962_1813694_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1813674_1813782_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1813841_1814543_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1814563_1815850_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1815883_1816138_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1816156_1816291_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1816294_1816537_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1816624_1816987_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1816983_1817340_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1817673_1817850_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1817851_1818799_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1818795_1819017_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1819115_1819397_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1819407_1819599_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_032195523.1|1819571_1819754_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000186740.1|1819753_1820431_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1820427_1821213_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1821218_1821515_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1821590_1821881_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1822384_1823992_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1824098_1824791_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1825154_1825694_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1825690_1826710_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1826706_1827408_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1827404_1827689_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1827916_1828114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1828157_1828439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1828529_1828631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1828627_1829083_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1829082_1829253_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1829245_1829536_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1829532_1829895_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1829891_1830032_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1830117_1830552_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1830800_1830953_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1831756_1833703_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1833840_1834020_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1834060_1834306_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1834383_1834599_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1834603_1835137_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1835407_1835977_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1835976_1836123_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1836350_1836536_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1837053_1837530_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1837526_1839650_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1839646_1839859_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1839858_1841361_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_171878184.1|1841305_1843330_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.5	0.0e+00
WP_001097065.1|1843417_1843744_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1843736_1844018_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1844020_1844644_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1844656_1845055_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_024748478.1|1845062_1845815_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000479062.1|1845828_1846251_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1846277_1846586_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_115333668.1|1846629_1849275_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|1849271_1849601_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1849600_1850299_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1850309_1851053_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_071601640.1|1850998_1851628_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_024748476.1|1851868_1855348_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230509.1|1855415_1856015_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_088136427.1|1856079_1857249_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|1857250_1857520_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1857680_1858097_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1858178_1858820_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1858981_1859230_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1859744_1861430_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1861426_1862146_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1862192_1862663_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1862704_1863166_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1863290_1865294_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1865290_1866427_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1866419_1867151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1867169_1868699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1868709_1869798_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1871038_1871356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1871417_1875047_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1882003_1884037_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1884168_1885278_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1885539_1885821_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1886112_1886655_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1886742_1887417_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1887432_1889913_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1889923_1890958_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1891039_1891378_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1891595_1892447_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1892567_1892840_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1892949_1893264_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1893273_1893621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1894671_1894911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1895244_1896033_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1896029_1896830_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1896894_1897713_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1897764_1898511_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1898484_1899450_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1899446_1900451_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_024177454.1|1900447_1901725_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1901981_1903034_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1903332_1904187_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1904215_1905478_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1905487_1905940_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1905970_1906255_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490697.1|1906258_1907614_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1907661_1908702_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1908801_1909581_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1909662_1910562_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1910967_1911285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1911614_1912976_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 5
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	1998993	2140653	5492443	lysis,terminase,holin,integrase,transposase,portal,head,capsid,protease,tail	Stx2-converting_phage(42.74%)	161	1995611:1995625	2100863:2100877
1995611:1995625	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|1998993_2000172_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|2000152_2000344_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2000421_2000766_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2000953_2001304_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|2002170_2003118_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2003114_2003336_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2003434_2003716_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2003726_2003918_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2003890_2004073_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|2004069_2004750_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001302855.1|2004746_2005532_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|2005537_2005834_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2005908_2006052_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2006020_2006185_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2006257_2006626_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2006808_2007060_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2007118_2007391_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2007368_2007551_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2008119_2008641_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2009142_2009838_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2009912_2010128_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2010269_2010566_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2010598_2010760_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2010746_2011568_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2011564_2012941_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001220560.1|2013019_2013631_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000344569.1|2014094_2014427_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103678.1|2014559_2014775_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2014785_2015022_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2014978_2015425_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2015421_2015949_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2015945_2016128_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|2016402_2017167_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|2017241_2017964_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2017963_2018569_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2018565_2019237_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2019227_2019716_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2020365_2021325_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2021336_2021606_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2021902_2022226_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143112.1|2022469_2024407_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.8	0.0e+00
WP_000143458.1|2024543_2024723_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2024763_2025036_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2025112_2025328_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2025327_2025825_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2025821_2026259_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2026461_2026959_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2026955_2027213_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2027675_2027903_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2027944_2028310_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|2028601_2029165_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_162829202.1|2029833_2031047_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000173024.1|2032199_2034137_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001063023.1|2034181_2034403_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|2036929_2037256_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2037265_2037616_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2037612_2038059_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2038055_2038400_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2038458_2039175_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2039180_2039555_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2039650_2039860_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015994262.1|2039911_2043154_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2043146_2043488_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|2043487_2044186_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_001302649.1|2044202_2044523_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2044630_2044804_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2044874_2045798_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_024748453.1|2045851_2046589_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	98.4	5.0e-148
WP_129137391.1|2046534_2047167_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_000515107.1|2047427_2050907_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_001230314.1|2050973_2051573_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_171878185.1|2051637_2052951_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.8	9.1e-84
WP_001023452.1|2052952_2053222_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2053362_2054238_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2054462_2055113_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2056436_2057603_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2057721_2058195_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2058393_2059452_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2059623_2059953_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2060053_2060236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2060724_2060838_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2060850_2061045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2061503_2061872_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2061945_2062167_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2062229_2062706_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2062720_2063200_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2063281_2064103_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2064323_2064734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2064749_2065433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2065568_2066639_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2066635_2067541_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2067537_2068419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2068402_2069616_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_001509211.1|2069987_2072135_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2073582_2075121_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2075170_2075518_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2075514_2075895_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2076256_2076802_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2076798_2077542_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2077553_2078633_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2078694_2079630_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2080086_2081004_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2081105_2082056_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2082173_2083817_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2084442_2085159_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2085501_2086956_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2087057_2088374_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2088687_2089740_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2090001_2097984_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2098473_2099271_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001509205.1|2099481_2100516_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.1	7.8e-99
WP_000094838.1|2100515_2100719_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2100777_2103249_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2100863:2100877	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2103344_2103533_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2103529_2103718_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2104198_2104351_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2104625_2105270_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2105367_2105595_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2105591_2106017_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_171878186.1|2106085_2107123_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2107034_2107577_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2107611_2108310_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2108331_2108556_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2108552_2108909_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2108941_2109094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2109090_2109402_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2109528_2110092_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2110201_2110306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2110492_2110705_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2110872_2111151_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2111152_2112202_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2112214_2112574_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2112570_2113260_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2114799_2116650_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2116731_2117945_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2118255_2118471_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2118475_2118820_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2118870_2119404_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2119559_2119742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2119754_2119886_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2120113_2120299_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2120825_2121140_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2121221_2121446_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2121840_2122350_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2124234_2124441_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2124437_2126030_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_171878187.1|2126019_2127525_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	2.1e-100
WP_000256723.1|2127561_2127909_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2127966_2128233_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2128214_2128955_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2128968_2129400_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2129426_2129840_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_128484525.1|2129820_2132400_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847298.1|2132396_2132726_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_024748502.1|2132725_2133424_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	7.6e-130
WP_024748514.1|2133434_2134178_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_148936303.1|2134123_2134756_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	1.7e-104
WP_171878188.1|2135002_2138482_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.0	0.0e+00
WP_001230496.1|2138548_2139148_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_088136427.1|2139212_2140382_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|2140383_2140653_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
>prophage 6
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	2198236	2218222	5492443	tail,transposase,integrase	Enterobacteria_phage(75.0%)	28	2211358:2211371	2221364:2221377
WP_032161583.1|2198236_2199373_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2199323_2199647_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2199804_2200989_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2200988_2201501_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2201555_2201921_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2201929_2202085_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2204887_2205376_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2205532_2206105_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2206148_2206679_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2207770_2208085_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2208089_2209049_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2209125_2211948_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2211358:2211371	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2211954_2212320_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2212316_2212934_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2212945_2213245_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2213241_2213508_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2213504_2213708_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2213731_2214148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2214240_2214354_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2214350_2214593_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2214604_2214883_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2214893_2215244_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2215265_2215469_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2215540_2215678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2215767_2216172_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2216187_2216838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2216867_2217215_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001303019.1|2217220_2218222_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
2221364:2221377	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	2483517	2534621	5492443	transposase,head,plate,protease,tail,tRNA	Shigella_phage(55.0%)	71	NA	NA
WP_001266279.1|2483517_2483784_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	46.0	1.4e-07
WP_087497971.1|2483794_2485885_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	44.9	4.4e-165
WP_000129790.1|2485955_2486888_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000268103.1|2486890_2487112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|2487124_2487379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2487380_2487662_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|2487658_2487931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|2487935_2488229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|2488240_2488771_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|2488868_2489411_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564283.1|2489414_2489948_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000465559.1|2489947_2490463_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000977060.1|2490466_2491018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|2491014_2491200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021235.1|2491238_2491571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|2491563_2491761_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|2491750_2492047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|2492043_2492553_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852377.1|2492622_2493048_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|2493119_2493620_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|2493654_2494083_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|2494066_2494285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342746.1|2494294_2494522_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|2494502_2494811_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279084.1|2494807_2495098_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000360581.1|2495100_2495682_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057672.1|2495681_2497346_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000532593.1|2497345_2498935_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_000046893.1|2498918_2500244_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000094804.1|2500362_2500836_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000850811.1|2501012_2502137_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_001142982.1|2502136_2503084_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002060.1|2503127_2503496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|2503492_2503912_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|2503908_2504469_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|2504469_2504715_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|2504711_2506214_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|2506222_2506588_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|2506602_2507079_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|2507205_2509281_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000146116.1|2509267_2510617_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|2510600_2511725_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|2511714_2512329_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|2512321_2512759_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|2512758_2513841_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|2513831_2514392_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|2514391_2515303_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|2515337_2515859_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|2515938_2516142_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|2516364_2516925_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|2517024_2519064_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|2519210_2519393_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|2519428_2519674_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|2519712_2520177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|2520291_2520492_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|2520445_2521183_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001282281.1|2521575_2522223_-	ribonuclease T	NA	NA	NA	NA	NA
WP_001237796.1|2522325_2522733_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_000093602.1|2522813_2523911_-	N-ethylmaleimide reductase	NA	NA	NA	NA	NA
WP_001032947.1|2523947_2524547_-	DNA-binding transcriptional regulator NemR	NA	NA	NA	NA	NA
WP_000840481.1|2524649_2524889_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_001296937.1|2525914_2526436_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000994327.1|2526436_2528449_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001302065.1|2528448_2529306_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000670998.1|2529308_2529545_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_001296943.1|2529745_2530180_+	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_000597196.1|2530226_2530694_-	outer membrane lipoprotein SlyB	NA	NA	NA	NA	NA
WP_000835042.1|2530966_2532076_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_000178045.1|2532173_2532503_+	C-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001282321.1|2532561_2533218_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_001295400.1|2533346_2534621_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 8
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	2577713	2661478	5492443	terminase,holin,portal,transposase,head,capsid,protease,tail	Stx2-converting_phage(35.85%)	88	NA	NA
WP_001260835.1|2577713_2578535_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2578634_2578718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2578810_2579146_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2579542_2580796_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2580902_2581796_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2581930_2583151_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2583275_2583971_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2583923_2585216_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2585373_2585988_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2586030_2586885_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2586886_2587504_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2587514_2589938_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2589998_2592425_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2592623_2592929_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2593036_2593747_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2593749_2594310_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2594344_2594686_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2594820_2595147_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2596135_2596387_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2596459_2598931_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2599023_2599215_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2599211_2599400_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2599800_2599965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2599968_2600187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2600258_2600558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2600910_2601189_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2601190_2601382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2601402_2601774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2601871_2602174_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2602170_2602596_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095670.1|2602618_2603581_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000788936.1|2603587_2604328_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_001118159.1|2605138_2605534_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2605590_2606175_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2606290_2606395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2606583_2606796_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2606963_2607242_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2607243_2608293_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2608305_2608665_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2608661_2609351_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2609987_2610416_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_024748470.1|2610894_2612745_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_024180155.1|2613184_2613400_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2613404_2613749_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2613799_2614333_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2614603_2615173_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2615172_2615319_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2615546_2615732_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2616156_2616384_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2616425_2616791_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2617080_2617644_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001301491.1|2617640_2619302_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2619365_2621303_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2621347_2621569_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2621514_2624016_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2624095_2624422_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2624431_2624782_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2624778_2625225_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2625221_2625566_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275499.1|2625624_2626341_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	8.0e-127
WP_000710952.1|2626355_2626730_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2626825_2627035_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2627082_2630325_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2630317_2630659_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2630658_2631357_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_046671488.1|2631367_2632111_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_129137391.1|2632056_2632689_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_024748464.1|2632935_2636415_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_001230495.1|2636481_2637081_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_024748463.1|2637145_2638459_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
WP_001023426.1|2638460_2638730_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_171878191.1|2640378_2641592_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	8.7e-166
WP_001079499.1|2646127_2646634_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2646679_2647180_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2647265_2647445_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2647825_2648632_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2648631_2649825_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983855.1|2649836_2651198_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000763503.1|2651198_2652794_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2652793_2654356_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2654447_2654492_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2654629_2655511_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2655507_2656128_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2656155_2657739_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2657951_2658824_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2658863_2659454_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2659450_2660209_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2660428_2661478_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 9
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	2934122	3043895	5492443	terminase,holin,integrase,portal,transposase,head,capsid,tail	Enterobacteria_phage(29.09%)	133	2940927:2940944	3045107:3045121
WP_000214712.1|2934122_2934326_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2934361_2935822_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2935910_2937194_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2937325_2937568_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2937729_2938371_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2938452_2939082_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2939154_2939730_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2939843_2940113_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_024748460.1|2940114_2941428_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
2940927:2940944	attL	CGGCTGCACTTTCTGCCG	NA	NA	NA	NA
WP_001230508.1|2941492_2942092_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
2940927:2940944	attL	CGGCTGCACTTTCTGCCG	NA	NA	NA	NA
WP_171878193.1|2942159_2945636_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	94.9	0.0e+00
WP_129137391.1|2945882_2946515_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_153038087.1|2946460_2947204_-	Mov34/MPN/PAD-1 family protein	NA	A0A0P0ZE89	Stx2-converting_phage	96.0	1.5e-144
WP_001302968.1|2947214_2947913_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|2947912_2948242_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081804.1|2948238_2950851_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533440.1|2950831_2951245_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2951271_2951694_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2951707_2952460_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2952467_2952863_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2952859_2953393_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2953407_2953761_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2953772_2954171_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_024748468.1|2954212_2955238_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	9.6e-190
WP_001295978.1|2955293_2955626_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2955635_2956955_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2956935_2958537_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2958533_2958740_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024748469.1|2958736_2960662_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000867498.1|2960636_2961182_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2961568_2961793_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2961874_2962189_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2962714_2962900_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2963122_2963269_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2963268_2963838_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2964108_2964642_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2964692_2965037_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2965041_2965257_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_171878194.1|2965696_2967547_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001302123.1|2968024_2968456_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2968906_2969620_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2969755_2969953_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2970177_2970732_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2970794_2971100_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2971112_2972162_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2972163_2972436_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2972557_2972902_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2973021_2973234_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2973467_2974025_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2974026_2974245_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2974372_2974684_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2974676_2974904_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2974900_2975182_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2975214_2975931_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2975964_2976426_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2976418_2977462_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2977530_2977956_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2977939_2978182_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2978573_2978912_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2979204_2979357_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2979368_2980007_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2980007_2980217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|2980781_2980970_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2980966_2981155_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102181.1|2981247_2983692_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000113189.1|2983756_2984005_+	excisionase	NA	NA	NA	NA	NA
WP_001500821.1|2983982_2985113_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.9	4.9e-102
WP_001345079.1|2986412_2987063_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|2988569_2989160_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2989343_2989991_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2990127_2990274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2990701_2990980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2991319_2991700_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2991696_2992044_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2992093_2993632_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001025672.1|2996296_2997622_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2998648_2998918_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_024748516.1|2998919_3000233_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
2999609:2999626	attR	CGGCTGCACTTTCTGCCG	NA	NA	NA	NA
WP_001228304.1|3000384_3000984_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
2999609:2999626	attR	CGGCTGCACTTTCTGCCG	NA	NA	NA	NA
WP_129137390.1|3001051_3003397_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|3003348_3004524_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3004866_3005499_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_046671488.1|3005444_3006188_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_001303038.1|3006198_3006897_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|3006896_3007238_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3007230_3010473_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3010520_3010730_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3010825_3011200_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275499.1|3011214_3011931_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	8.0e-127
WP_000133388.1|3011989_3012334_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3012330_3012777_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3012773_3013124_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3013133_3013460_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3013539_3016041_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3015986_3016208_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3016252_3018190_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3018253_3019915_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_001303051.1|3019911_3020475_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|3020764_3021130_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3021171_3021399_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3021823_3022009_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3022236_3022383_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3022382_3022952_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3023222_3023756_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3023806_3024151_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|3024155_3024371_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_171878195.1|3024810_3026661_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000935548.1|3027457_3028516_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3028666_3028864_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3029105_3029636_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3029644_3030004_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3030016_3031063_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3031064_3031343_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3031412_3031670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3031890_3032103_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3032381_3033140_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3033838_3034003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3033999_3034581_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3034767_3035310_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3035221_3036262_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3036233_3036785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3036768_3036996_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3037072_3037480_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3037743_3038043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3038115_3038334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3038356_3038764_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3038741_3038975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3038968_3039136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3039533_3039722_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3039718_3039910_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048549.1|3040002_3042474_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_000113189.1|3042538_3042787_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3042764_3043895_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3045107:3045121	attR	AGCGGCAGTAGTGGG	NA	NA	NA	NA
>prophage 10
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	3090591	3184283	5492443	lysis,terminase,holin,integrase,transposase,portal,head,capsid,protease,tail,tRNA	Enterobacteria_phage(49.06%)	100	3113789:3113804	3178186:3178201
WP_001299679.1|3090591_3091848_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3092061_3092685_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3092684_3093536_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3093686_3094634_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3094758_3096438_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3096492_3096771_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3097048_3097633_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3097749_3098841_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3099684_3102570_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3102669_3104589_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|3105295_3105907_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3106006_3106921_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3107016_3108753_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3108910_3110124_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3110461_3111532_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3111541_3112840_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3113202_3114735_+	SpoVR family protein	NA	NA	NA	NA	NA
3113789:3113804	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3114786_3115506_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3115727_3117269_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3117414_3117945_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3117990_3119259_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3119258_3119678_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3120050_3120962_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3121168_3121630_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3121706_3122366_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3122437_3122731_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3122742_3122901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3122971_3123373_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3123475_3123844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3124363_3125059_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3125082_3125895_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3125898_3126165_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3127396_3127981_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3128479_3129433_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3129619_3131104_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3131406_3132945_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3132994_3133342_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3133338_3133719_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3133794_3134043_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3134099_3134768_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3135265_3135448_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3135526_3136027_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3136063_3136570_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3136588_3137479_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3137598_3138180_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3138179_3141095_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3141159_3141759_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3141825_3145224_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3145284_3145917_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3145853_3146597_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3146602_3147301_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3147300_3147630_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001509030.1|3147626_3150176_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.2	0.0e+00
WP_000459457.1|3150168_3150603_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3150584_3151007_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3151022_3151763_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3151770_3152166_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3152162_3152741_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3152752_3153106_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3153117_3153516_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063233.1|3153557_3154583_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_001295978.1|3154637_3154970_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3154979_3156299_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3156279_3157881_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3157877_3158084_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024748455.1|3158080_3160006_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3159980_3160526_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3160914_3161109_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3161273_3161480_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3161765_3162176_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3162467_3162761_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3162851_3163034_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3163250_3163727_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3163713_3164019_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3164340_3165030_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3165026_3165167_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3165163_3165526_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3165522_3165813_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3165805_3165976_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3165975_3166431_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3166932_3168459_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3168516_3168639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3168703_3169036_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3169103_3169406_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3169402_3170104_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088657.1|3171028_3171265_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3171254_3172397_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3172510_3173761_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3173932_3174586_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3174595_3175057_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3175110_3176217_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3176252_3176894_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3176897_3178268_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3178186:3178201	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3178436_3179108_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3179107_3180568_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3181168_3181450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3181705_3182248_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3182453_3182867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3182879_3183215_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3183227_3184283_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 11
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	3190375	3249029	5492443	integrase,terminase,holin,portal,transposase,head,capsid,tail	Enterobacteria_phage(26.32%)	72	3234596:3234616	3255686:3255706
WP_032174463.1|3190375_3191593_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_162829200.1|3191591_3192804_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001301987.1|3193166_3194288_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3194336_3195563_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3195812_3196949_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3196932_3197796_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3198159_3199521_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3199581_3199857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3202165_3205567_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3206157_3208506_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3208525_3208615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3208627_3208864_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3208809_3209547_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3209600_3210479_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3210781_3210892_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3211001_3211256_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3211272_3211971_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3211970_3212312_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3212304_3215547_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3215594_3215804_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3215899_3216274_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275499.1|3216288_3217005_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	8.0e-127
WP_000133388.1|3217063_3217408_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3217404_3217851_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3217847_3218198_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3218207_3218534_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3218613_3221115_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3221060_3221282_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3221326_3223264_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3223327_3224989_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3224985_3225549_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3225840_3226206_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3226247_3226433_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3226562_3226703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3227059_3227284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3227348_3227555_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3227782_3227929_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3227928_3228498_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3228768_3229302_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3229352_3229697_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3229701_3229917_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3229992_3230262_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3230299_3230482_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023167.1|3230629_3232567_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3232881_3233049_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3233645_3234467_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3234463_3234838_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3234596:3234616	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3234850_3235900_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3235901_3236180_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3236347_3236560_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3236748_3236853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3236968_3237556_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3237558_3237750_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3237751_3238189_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3238175_3238493_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3238446_3238764_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3238753_3239056_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3239052_3239334_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3239366_3240083_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3240116_3240659_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3240570_3241608_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693962.1|3241676_3242102_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3242085_3242409_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3242533_3243010_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3243325_3243478_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3243592_3244108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3244240_3244630_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3244691_3244961_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3244929_3246048_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3246214_3247009_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3247005_3248052_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3248207_3249029_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3255686:3255706	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	3500006	3555352	5492443	integrase,holin,portal,transposase,head,capsid,protease,tail	Escherichia_phage(27.91%)	62	3501941:3501956	3557117:3557132
WP_000003653.1|3500006_3500594_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3500590_3501298_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3501316_3503110_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3501941:3501956	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3503106_3504225_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3506217_3506487_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3506488_3507802_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230444.1|3507866_3508466_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_171878196.1|3508533_3512007_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.1	0.0e+00
WP_000649827.1|3512140_3512668_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_050546863.1|3512858_3513491_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3513436_3514180_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001302968.1|3514190_3514889_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3514888_3515218_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3515214_3517794_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3517774_3518188_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3518214_3518646_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3518659_3519400_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3519381_3519648_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3519705_3520053_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3520089_3521595_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3521584_3523177_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3523173_3523380_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3525557_3527096_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3527145_3527493_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3527489_3527870_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3527945_3528221_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3528971_3529178_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3529433_3529706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3529865_3530399_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3530619_3530733_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3530954_3531140_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3531667_3531982_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3532186_3533400_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3533575_3535426_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3536192_3536906_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3537526_3538345_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3538496_3538868_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3538857_3539229_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3539241_3540291_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3540292_3540571_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3540738_3540894_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3540995_3541133_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3541498_3542272_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3542623_3543037_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3543052_3543823_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3543844_3544591_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3544597_3545689_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3545767_3546223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3546429_3546855_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3546838_3547111_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3547219_3547621_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3547648_3547840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3547839_3548127_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3548404_3548560_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3548701_3549091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3549277_3549463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3550036_3550225_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3550221_3550413_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3550506_3552978_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3553045_3553288_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3553265_3554285_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3554692_3555352_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3557117:3557132	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	3786281	3824376	5492443	lysis,terminase,holin,integrase,portal,protease,tail	Enterobacteria_phage(51.22%)	48	3785866:3785880	3824450:3824464
3785866:3785880	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3786281_3786980_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3787210_3788092_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3788260_3788422_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3788918_3789938_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3789971_3790952_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3791128_3791398_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3791399_3792716_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3792775_3793375_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_001508920.1|3796919_3797528_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.6	7.1e-100
WP_000194779.1|3797464_3798208_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3798213_3798912_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3798921_3799251_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3799250_3802316_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3802287_3802617_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3802625_3803012_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3803072_3803816_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3803826_3804228_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3804224_3804803_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3804814_3805090_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3805082_3805406_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3805492_3807520_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3807464_3807800_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3807921_3809046_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3808973_3809186_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3809182_3811285_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001139679.1|3812449_3812602_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3812589_3813057_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3813053_3813551_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3813550_3813766_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3813908_3814307_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3814387_3814546_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3814631_3815375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3815558_3816248_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3816262_3816385_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3816722_3817682_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3817893_3818559_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3818555_3819176_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3819168_3819339_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3819335_3819518_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3820215_3820896_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3820892_3821075_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3821047_3821239_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3821249_3821531_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3821629_3821851_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3822061_3822664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3822906_3823074_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3823113_3823332_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3823605_3824376_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3824450:3824464	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	4367429	4447985	5492443	lysis,integrase,terminase,holin,transposase,portal,head,capsid,plate,protease,tail	Shigella_phage(43.33%)	96	4404547:4404593	4444083:4444129
WP_000998048.1|4367429_4368968_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4369017_4369365_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4369361_4369742_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4370005_4370269_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4370268_4370409_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4370478_4370670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4371494_4372037_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4372111_4372699_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4372756_4373425_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4373450_4375976_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4375965_4377609_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4377577_4378288_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4378600_4378930_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4379177_4379792_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4380209_4380899_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4380895_4381852_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4381848_4384047_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4384056_4385013_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4385191_4386319_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4386460_4387519_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4387764_4388667_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4389369_4389648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4389814_4390537_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4390635_4391535_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4392210_4393167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4393299_4395633_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4395646_4395970_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4395969_4396191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4396187_4396745_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4396741_4397002_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4397935_4398688_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4398684_4399236_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4399241_4399514_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4399923_4400490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4400489_4401080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4401110_4401743_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4401735_4402194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4402193_4402811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4402783_4403200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4403203_4404385_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4404547:4404593	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4405347_4406091_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4406915_4407689_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4407749_4408304_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145352.1|4408334_4408853_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000368084.1|4408852_4409455_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|4409426_4409870_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_032195359.1|4409890_4410286_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_000383550.1|4410556_4411141_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4411131_4412190_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4412176_4412602_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4412601_4413150_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4413149_4414229_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4414225_4415554_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4415614_4417450_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4417591_4417861_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4417860_4418217_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4418216_4419713_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4419696_4419867_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4419875_4420436_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4420432_4420939_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4420913_4421324_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4421320_4421644_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4421722_4422952_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4422962_4423565_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4423557_4424784_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4424773_4424935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4424931_4426428_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4426661_4427156_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_162829202.1|4427558_4428771_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738423.1|4429470_4429764_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4429854_4430037_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4430253_4430730_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4430733_4431069_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4431205_4431499_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4431777_4432011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4432154_4432694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4432908_4433661_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4433674_4434664_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4434671_4435481_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4435500_4435890_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4435886_4436213_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4436209_4436863_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4436862_4437357_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4437353_4438295_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4438284_4438464_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4438639_4439191_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4439183_4439444_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4439541_4440234_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4440511_4440808_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4441484_4442021_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4442011_4442374_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4442373_4442679_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4442905_4444069_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4444273_4445527_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4444083:4444129	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4445538_4446642_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4446929_4447985_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 15
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	4879983	4892559	5492443	integrase	Enterobacteria_phage(81.82%)	15	4879017:4879032	4897512:4897527
4879017:4879032	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|4879983_4880811_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4881028_4881223_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001509359.1|4881578_4883912_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|4883926_4884247_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|4884382_4884838_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|4884830_4885118_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|4885110_4885701_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|4885697_4885964_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|4886515_4887250_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|4887246_4887747_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4887820_4888393_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000095622.1|4888718_4889963_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|4890000_4890735_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|4890811_4891117_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|4891284_4892559_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
4897512:4897527	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 16
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	4924979	4984007	5492443	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4924979_4926332_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4926425_4926977_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4927132_4928506_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4928681_4929680_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4929712_4930708_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4930694_4931717_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4931730_4933233_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4933372_4934329_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4934638_4935169_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4935248_4935599_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4935592_4935844_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4936055_4936397_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4936399_4940179_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4940175_4941909_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4942114_4942753_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4943075_4944419_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4944514_4944721_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|4945045_4945600_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4945662_4946601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4946812_4947553_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|4947742_4949686_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|4949803_4950184_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4950272_4951133_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4951240_4952206_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4952313_4952976_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4953020_4954433_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4954741_4955362_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4955579_4956218_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4956352_4957561_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4957568_4958000_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4958622_4959417_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4959487_4959937_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4959978_4960206_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4960210_4960525_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4960531_4960927_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4961253_4961529_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4961657_4962344_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4962343_4963198_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4963207_4963858_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4963871_4964336_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4964345_4964651_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4964666_4966064_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4967590_4968346_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4968342_4969092_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4969273_4969603_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4969751_4970027_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4970143_4971769_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4971852_4973016_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4973018_4973657_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4973666_4974065_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4974082_4974742_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4974792_4975491_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4975509_4975911_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4976037_4976769_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4976949_4979391_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4979429_4979855_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4980059_4981358_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4981461_4981659_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4981740_4982745_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4982747_4984007_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 17
NZ_CP038305	Escherichia coli O157:H7 strain SS NE 1040-1 chromosome, complete genome	5492443	5120887	5135552	5492443	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	5116728:5116743	5134257:5134272
5116728:5116743	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5120887_5122303_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5122385_5123369_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5123534_5123777_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5123910_5124948_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5125036_5126134_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5126195_5126444_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5126604_5127246_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5127327_5127957_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5128029_5128602_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5128713_5128983_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5128984_5130298_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5130362_5130962_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5132283_5132820_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5132810_5133161_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5133157_5133442_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5133777_5133975_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5134319_5134601_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5134257:5134272	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5134648_5134822_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5135018_5135552_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
