The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038295	Escherichia coli O157:H7 strain TB182A chromosome, complete genome	5219269	1566833	1572259	5219269	integrase	Enterobacteria_phage(50.0%)	6	1555821:1555837	1574455:1574471
1555821:1555837	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1566833_1567403_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403518.1|1567402_1567870_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	1.8e-63
WP_000960724.1|1567856_1568537_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1568546_1569683_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958698.1|1569857_1571015_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	99.7	1.4e-221
WP_000368131.1|1571326_1572259_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1574455:1574471	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 2
NZ_CP038295	Escherichia coli O157:H7 strain TB182A chromosome, complete genome	5219269	1817431	1826877	5219269		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569336.1|1817431_1818358_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1818362_1819094_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1819074_1819182_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1819241_1819973_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001359340.1|1820194_1821880_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.8	5.1e-305
WP_000598641.1|1821876_1822596_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1822642_1823113_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001359339.1|1823154_1823616_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_001087225.1|1823740_1825744_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001359338.1|1825740_1826877_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
>prophage 3
NZ_CP038295	Escherichia coli O157:H7 strain TB182A chromosome, complete genome	5219269	1988055	2064122	5219269	head,protease,capsid,integrase,holin,terminase,tail,transposase,portal	Enterobacteria_phage(30.95%)	69	1981222:1981237	2045181:2045196
1981222:1981237	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_085959019.1|1988055_1989269_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_000502860.1|1989695_1990334_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	2.1e-54
WP_001419103.1|1990704_1992852_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000973176.1|1994523_1995069_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1995065_1995809_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1995820_1996900_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986329.1|1996961_1997897_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1998353_1999271_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1999372_2000323_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|2002709_2003426_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2003768_2005223_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2005324_2006641_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2006955_2008008_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001302302.1|2016741_2017539_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533608.1|2017774_2018800_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	56.7	2.9e-101
WP_000094838.1|2018799_2019003_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000990641.1|2019061_2021479_-	exonuclease	NA	V5UQJ3	Shigella_phage	60.1	6.0e-174
WP_000199480.1|2021571_2021760_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449169.1|2021756_2021945_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000559929.1|2022486_2023002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379559.1|2023115_2023268_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_001003381.1|2023461_2023869_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476994.1|2023946_2024174_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705361.1|2024157_2024679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054513.1|2024659_2025625_+	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.2e-55
WP_001151172.1|2025665_2026073_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	1.8e-62
WP_000101550.1|2026513_2027473_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000813254.1|2027844_2028000_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001004959.1|2028165_2028816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|2028796_2029900_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000975564.1|2030054_2030315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2030384_2030663_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265288.1|2030664_2031714_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.0e-110
WP_001217436.1|2031726_2032098_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|2032087_2032459_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265268.1|2032611_2033430_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261911.1|2034050_2034764_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874327.1|2035531_2037382_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411813.1|2037674_2037881_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000731214.1|2037885_2038875_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_001092850.1|2038917_2039451_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	3.9e-102
WP_032140280.1|2040005_2040092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122991286.1|2040313_2040499_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	6.0e-18
WP_000347012.1|2041185_2041323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2041459_2041645_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235436.1|2042046_2042556_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001418004.1|2042527_2044456_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000259002.1|2044439_2044646_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831776.1|2044642_2046235_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
2045181:2045196	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001253995.1|2046224_2047730_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256821.1|2047766_2048114_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_000522655.1|2048171_2049200_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.5e-113
WP_000201512.1|2049251_2049635_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|2049627_2049981_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974984.1|2049996_2050530_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.9e-56
WP_000683079.1|2050526_2050922_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235113.1|2050929_2051682_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	2.7e-133
WP_000479105.1|2051695_2052127_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533426.1|2052153_2052567_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.3e-41
WP_171878544.1|2052547_2055127_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.3	0.0e+00
WP_000847304.1|2055123_2055453_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001419081.1|2055452_2056151_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000194791.1|2056156_2056900_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.8	2.7e-149
WP_050546863.1|2056845_2057478_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|2057668_2058196_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515116.1|2058329_2061806_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	94.0	0.0e+00
WP_001230271.1|2061873_2062473_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	2.0e-107
WP_171878545.1|2062537_2063851_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.3	5.9e-75
WP_001023432.1|2063852_2064122_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
>prophage 4
NZ_CP038295	Escherichia coli O157:H7 strain TB182A chromosome, complete genome	5219269	2438959	2504072	5219269	head,protease,capsid,integrase,holin,terminase,tail,portal	Enterobacteria_phage(37.93%)	81	2443063:2443078	2475311:2475326
WP_001260837.1|2438959_2439781_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2439880_2439964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2440056_2440392_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2440788_2442042_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2442148_2443042_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2443063:2443078	attL	CCCGAAAAATGTGCTG	NA	NA	NA	NA
WP_000225276.1|2443176_2444397_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2444521_2445217_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2445169_2446462_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148719.1|2446619_2447234_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2447276_2448131_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2448132_2448750_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000642739.1|2448760_2451157_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	3.7e-208
WP_000041706.1|2451244_2453671_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	5.5e-212
WP_000778147.1|2453869_2454175_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2454282_2454993_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2454995_2455556_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2455590_2455932_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001358609.1|2456066_2456393_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001358608.1|2456598_2457813_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	3.1e-46
WP_000836042.1|2457824_2458844_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
WP_001531709.1|2458901_2459006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206152.1|2459031_2460327_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	7.4e-155
WP_000005551.1|2460346_2460598_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_000048562.1|2460669_2463141_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	57.4	1.4e-53
WP_001090185.1|2463220_2463424_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449178.1|2463420_2463609_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000559928.1|2464157_2464673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2464787_2464940_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000104592.1|2465205_2465922_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	40.8	6.7e-49
WP_000471546.1|2465971_2466187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693859.1|2466183_2466609_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000770544.1|2466633_2467599_+	hypothetical protein	NA	U5P0A0	Shigella_phage	65.0	4.3e-59
WP_001151255.1|2467639_2468065_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	4.8e-63
WP_000935420.1|2468491_2468704_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000256993.1|2468736_2468955_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	86.1	1.1e-26
WP_000224233.1|2468956_2469220_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207995.1|2469230_2470100_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	77.2	1.0e-120
WP_001278454.1|2470215_2470320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278454.1|2470322_2470427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|2470616_2470829_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001302544.1|2470870_2471056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001417850.1|2470996_2471275_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265028.1|2471276_2472323_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001217410.1|2472335_2472710_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762928.1|2472706_2473528_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000216629.1|2474124_2474292_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|2474606_2476544_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
2475311:2475326	attR	CCCGAAAAATGTGCTG	NA	NA	NA	NA
WP_001213059.1|2476691_2476874_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2476911_2477181_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2477256_2477472_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731256.1|2477476_2477821_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	98.2	2.9e-58
WP_000992167.1|2477871_2478405_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|2478675_2479245_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2479244_2479391_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2479618_2479804_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000105085.1|2480228_2480456_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.1e-34
WP_000235436.1|2480850_2481360_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001418004.1|2481331_2483260_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000259002.1|2483243_2483450_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831776.1|2483446_2485039_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253995.1|2485028_2486534_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256821.1|2486570_2486918_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_000522655.1|2486975_2488004_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.5e-113
WP_000201512.1|2488055_2488439_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|2488431_2488785_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974984.1|2488800_2489334_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.9e-56
WP_000683079.1|2489330_2489726_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235113.1|2489733_2490486_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	2.7e-133
WP_000479105.1|2490499_2490931_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533426.1|2490957_2491371_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.3e-41
WP_000082476.1|2491351_2493931_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000847379.1|2493927_2494257_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152525.1|2494256_2494955_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000140753.1|2494960_2495704_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_000090855.1|2495640_2496249_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	2.2e-101
WP_000515299.1|2496309_2499708_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.6	0.0e+00
WP_001230405.1|2499774_2500374_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	8.8e-111
WP_100661943.1|2500438_2501752_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.6	2.6e-75
WP_001023432.1|2501753_2502023_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
WP_001131642.1|2502135_2502711_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121226.1|2503421_2504072_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
>prophage 5
NZ_CP038295	Escherichia coli O157:H7 strain TB182A chromosome, complete genome	5219269	2685948	2740368	5219269	protease,holin,terminase,tail,tRNA,portal	Escherichia_phage(33.87%)	68	NA	NA
WP_000837948.1|2685948_2687082_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	1.1e-117
WP_001295593.1|2687222_2687657_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2688237_2688879_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001359536.1|2688960_2689590_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	5.1e-77
WP_001131659.1|2689662_2690238_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023994.1|2690350_2690620_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	96.6	1.9e-44
WP_000268808.1|2690621_2691935_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.6	1.4e-76
WP_001230550.1|2691999_2692599_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_171878546.1|2692669_2696161_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	97.9	0.0e+00
WP_139003283.1|2696407_2697043_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	1.3e-99
WP_014640516.1|2696988_2697732_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.0e-145
WP_001419068.1|2697742_2698441_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000847298.1|2698440_2698770_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918244.1|2698766_2701412_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000532075.1|2701455_2701764_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479056.1|2701790_2702213_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	98.6	4.3e-72
WP_000235130.1|2702228_2702978_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	95.2	8.7e-132
WP_000682718.1|2702985_2703384_-	hypothetical protein	NA	Q9EYD7	Enterobacteria_phage	99.2	1.7e-70
WP_000974951.1|2703396_2704020_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	93.7	3.1e-98
WP_001281346.1|2704022_2704304_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_001097065.1|2704296_2704623_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114423.1|2704710_2706735_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974568.1|2706679_2708182_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|2708181_2708394_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|2708390_2710514_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373409.1|2710510_2710987_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_171815854.1|2711247_2711424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343114.1|2711500_2711788_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	3.1e-29
WP_001139680.1|2711866_2712019_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_123005736.1|2712047_2712254_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	94.1	2.9e-29
WP_000455406.1|2712481_2712631_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056883.1|2712630_2713200_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000087714.1|2713474_2714008_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_000284510.1|2714012_2714228_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290217.1|2714304_2714577_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_014640514.1|2714617_2714797_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	98.3	1.1e-24
WP_000874523.1|2714934_2716881_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_001064874.1|2718142_2718811_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	8.7e-59
WP_001217425.1|2718807_2719167_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
WP_001265237.1|2719179_2720229_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	8.5e-109
WP_032207160.1|2720230_2720509_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_000284536.1|2720941_2721418_-	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	33.3	1.7e-16
WP_001219082.1|2721420_2721780_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.9	7.1e-23
WP_000128514.1|2722024_2722237_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_000137945.1|2722471_2722948_-	hypothetical protein	NA	O64352	Escherichia_phage	44.4	1.1e-07
WP_001209468.1|2723045_2723654_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	68.9	8.2e-72
WP_001266130.1|2723650_2723947_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141104.1|2723943_2724336_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	5.9e-39
WP_000450861.1|2724351_2725122_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.8	1.2e-80
WP_000790459.1|2725151_2725892_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000095674.1|2725898_2726867_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
WP_000693888.1|2726889_2727315_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|2727298_2727580_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|2727680_2728100_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379610.1|2728365_2728518_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000449175.1|2729007_2729196_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2729192_2729381_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102126.1|2729473_2732146_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	96.1	6.2e-172
WP_000166313.1|2732138_2732948_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2733003_2733153_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2733190_2733379_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2733478_2733694_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2733695_2734931_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000662472.1|2734982_2735918_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_000123746.1|2736046_2737420_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001625136.1|2737452_2737623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2737897_2738881_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2739135_2740368_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 6
NZ_CP038295	Escherichia coli O157:H7 strain TB182A chromosome, complete genome	5219269	2823998	2891125	5219269	head,protease,capsid,integrase,holin,terminase,tail,transposase	Stx2-converting_phage(31.25%)	74	2846131:2846144	2891778:2891791
WP_000422055.1|2823998_2825048_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2825267_2826026_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278896.1|2826022_2826613_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2826652_2827525_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001419072.1|2827737_2829321_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2829348_2829969_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2829965_2830847_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2830984_2831029_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194629.1|2831120_2832683_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2832682_2834278_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2834278_2835640_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2835651_2836845_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443044.1|2836844_2837651_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2838031_2838211_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2838296_2838797_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079491.1|2838842_2839349_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000938103.1|2841808_2842378_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2842443_2843355_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2843461_2843584_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_106423857.1|2845593_2845788_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_000767050.1|2845732_2846275_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
2846131:2846144	attL	TTAACCAGGATTCT	NA	NA	NA	NA
WP_001023357.1|2846495_2846765_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_171878547.1|2846766_2847927_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	97.2	2.0e-79
WP_100661937.1|2847991_2848630_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.7	1.2e-68
WP_085959019.1|2848648_2849861_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_000514957.1|2849943_2853420_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	98.4	0.0e+00
WP_064761467.1|2853660_2854290_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_014640511.1|2854235_2854979_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	3.8e-148
WP_001419047.1|2854989_2855688_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	96.6	1.3e-129
WP_000807954.1|2855687_2856029_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212946.1|2856021_2859288_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.7	0.0e+00
WP_001453698.1|2859339_2859549_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030057.1|2859644_2860019_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275473.1|2860024_2860741_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	3.3e-128
WP_000141141.1|2860807_2861152_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	3.6e-56
WP_000573390.1|2861148_2861595_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_001007889.1|2861591_2861942_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125996.1|2861952_2862279_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001063105.1|2864805_2865027_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	93.2	4.6e-33
WP_000173049.1|2865071_2867009_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	97.4	0.0e+00
WP_001417827.1|2867072_2868734_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_001419048.1|2868730_2869294_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	9.2e-86
WP_001359494.1|2869409_2869940_-	HNH endonuclease	NA	H6WZK7	Escherichia_phage	92.6	2.6e-90
WP_000074669.1|2869981_2870206_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2870287_2870602_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|2871129_2871315_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075122.1|2871531_2872029_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_024164617.1|2872028_2872244_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000023143.1|2872682_2874533_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000216644.1|2874847_2875015_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.6	1.2e-09
WP_001059384.1|2876051_2876741_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|2876737_2877103_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|2877103_2878159_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_010917803.1|2878160_2878439_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_000975564.1|2878508_2878769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|2878987_2879200_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|2879478_2880237_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_157803421.1|2880935_2881100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450692.1|2881096_2881831_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_158000104.1|2881864_2882407_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	2.2e-84
WP_000020556.1|2882318_2883359_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|2883330_2883882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2883865_2884093_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2884169_2884577_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2884841_2885141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2885213_2885432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2885454_2885862_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2885839_2886073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2886066_2886234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2886631_2886820_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2886816_2887008_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048548.1|2887100_2889551_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	3.5e-57
WP_000113189.1|2889615_2889864_+	excisionase	NA	NA	NA	NA	NA
WP_000113678.1|2889841_2891125_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	4.2e-102
2891778:2891791	attR	AGAATCCTGGTTAA	NA	NA	NA	NA
>prophage 7
NZ_CP038295	Escherichia coli O157:H7 strain TB182A chromosome, complete genome	5219269	3450686	3495566	5219269	protease,lysis,integrase,holin,terminase,tail,portal	Enterobacteria_phage(50.0%)	63	3450271:3450285	3495640:3495654
3450271:3450285	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247931.1|3450686_3451385_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3451615_3452497_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3452665_3452827_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3453323_3454343_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3454376_3455357_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001101707.1|3455533_3455803_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_000279047.1|3455804_3457118_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.7	2.4e-76
WP_001230272.1|3457182_3457782_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_000515306.1|3457851_3461265_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
WP_000090845.1|3461325_3461934_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.1e-100
WP_001419734.1|3461870_3462614_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.5e-149
WP_001152339.1|3462619_3463318_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3463327_3463657_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371991.1|3463656_3466722_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_001161009.1|3466693_3467023_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3467031_3467418_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3467478_3468222_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3468232_3468634_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677100.1|3468630_3469209_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	9.4e-102
WP_001283153.1|3469220_3469496_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3469488_3469812_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_000985949.1|3471870_3473379_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	4.5e-289
WP_001072975.1|3473378_3473591_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934091.1|3473587_3475690_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3475689_3476181_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3476855_3477008_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092264.1|3476995_3477463_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
WP_000075144.1|3477459_3477957_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|3477956_3478172_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3478314_3478713_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3478793_3478952_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3479037_3479781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3479966_3480656_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3480670_3480793_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750160.1|3481130_3482090_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3482301_3482967_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108059.1|3482963_3483584_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_000567000.1|3483576_3483747_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|3483743_3483926_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000736913.1|3483922_3484363_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145894.1|3484436_3484727_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000788868.1|3484723_3485425_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	2.9e-129
WP_000185433.1|3485421_3486321_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.7	2.5e-173
WP_000251069.1|3486353_3486647_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_001194218.1|3486766_3486982_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|3487085_3487718_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_000618044.1|3487714_3488119_+	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	98.5	5.6e-69
WP_000340011.1|3488470_3488794_+	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
WP_000281856.1|3488794_3489277_-	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213973.1|3489543_3489744_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	9.3e-33
WP_001198861.1|3489967_3490132_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3490100_3490244_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995449.1|3490317_3490614_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001418384.1|3490619_3491405_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000186844.1|3491401_3492082_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3492078_3492261_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3492233_3492425_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|3492435_3492717_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763358.1|3492815_3493037_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_000120060.1|3493247_3493850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3494092_3494260_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3494299_3494518_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3494495_3495566_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3495640:3495654	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
NZ_CP038295	Escherichia coli O157:H7 strain TB182A chromosome, complete genome	5219269	3721163	3786395	5219269	head,protease,capsid,lysis,integrase,holin,terminase,tail,tRNA,transposase,portal	Enterobacteria_phage(61.82%)	75	3729641:3729687	3776189:3776235
WP_000420895.1|3721163_3722300_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383931.1|3722565_3724803_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001301880.1|3724789_3727762_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224578.1|3727762_3728653_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|3728835_3729597_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3729641:3729687	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001359465.1|3730039_3730477_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|3730501_3731086_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201812.1|3731584_3732538_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226369.1|3732724_3734209_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|3734753_3735422_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885620.1|3735476_3736061_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
WP_000279124.1|3736060_3738967_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	4.2e-57
WP_001230405.1|3739031_3739631_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	8.8e-111
WP_000515299.1|3739697_3743096_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.6	0.0e+00
WP_000090855.1|3743156_3743765_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	2.2e-101
WP_000140753.1|3743701_3744445_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_171878549.1|3744450_3745149_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847379.1|3745148_3745478_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000235332.1|3745474_3747802_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.5	0.0e+00
WP_000840184.1|3747811_3748036_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	100.0	4.4e-31
WP_000459484.1|3748028_3748463_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	5.0e-63
WP_000479153.1|3748444_3748867_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|3748882_3749623_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|3749630_3750026_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975054.1|3750022_3750601_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000753019.1|3750612_3750966_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000710708.1|3750977_3751373_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.3e-54
WP_000063260.1|3751414_3752440_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_001299443.1|3752495_3752828_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123237.1|3752837_3754157_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.0e-232
WP_001359455.1|3754137_3755739_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|3755735_3755942_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027277.1|3755938_3757864_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_001300120.1|3758771_3758966_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3759130_3759337_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001417742.1|3759622_3760033_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	3.9e-70
WP_000738495.1|3760324_3760618_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_122993458.1|3760708_3760891_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	1.1e-16
WP_001180487.1|3761107_3761584_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3761570_3761876_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097226.1|3762197_3762887_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	49.4	1.5e-58
WP_000971093.1|3762883_3763024_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3763020_3763383_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3763379_3763670_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3763662_3763833_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|3763832_3764288_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|3764284_3764386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|3764476_3764758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145438.1|3765226_3765511_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	95.7	1.1e-42
WP_000788830.1|3765507_3766209_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	3.2e-128
WP_000147923.1|3766205_3767225_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	2.8e-109
WP_001182879.1|3767221_3767761_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
WP_000184665.1|3767791_3768019_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712399.1|3768129_3768822_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001417737.1|3768928_3770536_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000233576.1|3771124_3771331_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3771406_3771703_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3771708_3772494_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186801.1|3772490_3773171_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.9e-131
WP_000149536.1|3773167_3773329_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.0	1.3e-21
WP_001419148.1|3773321_3773834_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	64.2	4.6e-52
WP_001386642.1|3773888_3774170_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|3774268_3774487_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3774534_3774813_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001359450.1|3775011_3776175_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	6.3e-198
WP_001359679.1|3776509_3777142_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3776189:3776235	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001255114.1|3777144_3777660_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691070.1|3777670_3778678_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_100661919.1|3778690_3781300_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988382.1|3781330_3782023_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3782242_3782785_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729155.1|3783264_3784131_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3784132_3784345_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|3784452_3784974_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912351.1|3785009_3786395_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 9
NZ_CP038295	Escherichia coli O157:H7 strain TB182A chromosome, complete genome	5219269	4120477	4173195	5219269	head,capsid,lysis,protease,integrase,holin,terminase,tail	Enterobacteria_phage(37.7%)	65	4121822:4121867	4169294:4169339
WP_001130496.1|4120477_4121659_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.6	1.1e-144
4121822:4121867	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000950786.1|4124067_4125048_-	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	50.5	5.9e-88
WP_001132163.1|4126047_4126638_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144082.1|4126820_4127447_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.7e-25
WP_001117988.1|4128186_4128759_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	52.7	2.1e-45
WP_001024023.1|4128870_4129140_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	97.8	8.4e-45
WP_000741872.1|4129141_4130458_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	94.5	3.5e-67
WP_001233141.1|4130517_4131117_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090854.1|4134660_4135263_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	1.2e-88
WP_000140754.1|4135199_4135943_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_001152569.1|4135948_4136647_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	1.3e-129
WP_000847379.1|4136646_4136976_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840280.1|4136972_4139552_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.9	0.0e+00
WP_000459456.1|4139544_4139979_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479189.1|4139960_4140383_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	1.3e-60
WP_001419284.1|4140398_4141139_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.3	1.2e-128
WP_000683050.1|4141146_4141542_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.2	7.2e-69
WP_000155463.1|4141538_4142072_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	71.4	2.0e-61
WP_001204539.1|4142083_4142437_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	68.4	7.4e-41
WP_000201530.1|4142429_4142804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522651.1|4142855_4143884_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000256840.1|4143941_4144289_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253897.1|4144325_4145831_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	6.1e-100
WP_100661945.1|4146452_4147958_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	69.1	3.3e-207
WP_000235440.1|4147959_4148469_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	7.2e-13
WP_013009113.1|4148870_4149095_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001302690.1|4149175_4149490_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_072020783.1|4150016_4150199_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	1.4e-14
WP_000075122.1|4150415_4150913_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_024164617.1|4150912_4151128_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000026511.1|4151565_4153407_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	77.9	3.6e-288
WP_001419325.1|4153703_4153835_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000512795.1|4154330_4154855_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	97.1	3.8e-94
WP_001028867.1|4154845_4155517_-	serine/threonine protein phosphatase	NA	H6WZJ4	Escherichia_phage	95.0	1.1e-125
WP_001107957.1|4155513_4156119_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	8.1e-96
WP_000566862.1|4156111_4156282_-	protein ninF	NA	K7PMD9	Enterobacterial_phage	96.4	9.3e-26
WP_001254239.1|4156278_4156461_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	1.9e-29
WP_000153282.1|4156457_4156985_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_000736913.1|4156981_4157422_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145894.1|4157495_4157786_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000788868.1|4157782_4158484_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	2.9e-129
WP_000185433.1|4158480_4159380_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.7	2.5e-173
WP_000251069.1|4159412_4159706_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_001194218.1|4159825_4160041_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|4160144_4160777_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_000618044.1|4160773_4161178_+	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	98.5	5.6e-69
WP_000340011.1|4161529_4161853_+	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
WP_000281856.1|4161853_4162336_-	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213973.1|4162602_4162803_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	9.3e-33
WP_001198861.1|4163026_4163191_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|4163159_4163303_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995449.1|4163376_4163673_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001418384.1|4163678_4164464_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000186844.1|4164460_4165141_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|4165137_4165320_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|4165292_4165484_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|4165494_4165776_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763359.1|4165874_4166096_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	4.6e-33
WP_001289865.1|4166092_4166599_+	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	86.7	3.1e-56
WP_000103020.1|4166595_4167360_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.5	4.5e-51
WP_001281200.1|4167460_4167805_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_000023577.1|4168118_4169279_+|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	99.5	7.2e-226
WP_000893281.1|4169483_4170737_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	4.4e-96
4169294:4169339	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4170748_4171852_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749889.1|4172139_4173195_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
>prophage 10
NZ_CP038295	Escherichia coli O157:H7 strain TB182A chromosome, complete genome	5219269	4190740	4250209	5219269	plate,tRNA,transposase	uncultured_Caudovirales_phage(40.0%)	45	NA	NA
WP_000027429.1|4190740_4191913_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4191993_4192179_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4192093_4192357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145881.1|4192558_4194319_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4194321_4195458_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001419315.1|4196203_4196713_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339432.1|4196781_4198290_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_100661913.1|4198471_4199188_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000509136.1|4199326_4203559_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103347.1|4203634_4205776_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_001142958.1|4205985_4206504_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|4207200_4207701_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4207735_4207960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000611742.1|4209492_4209906_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4209909_4211760_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4211723_4212806_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001080154.1|4214106_4214631_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246448.1|4214633_4215965_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343294.1|4215969_4216731_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614382.1|4216739_4219511_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	3.6e-82
WP_000088854.1|4219507_4220251_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240517.1|4220255_4221668_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_157803423.1|4221776_4225211_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087743.1|4225221_4226631_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284959.1|4226596_4227076_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001414527.1|4227096_4227249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|4227396_4227993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|4227995_4228445_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001086136.1|4228922_4229723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301976.1|4230259_4230991_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|4231055_4231523_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001307587.1|4231519_4232242_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4232275_4233031_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|4233102_4234461_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211697.1|4234508_4235279_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4235356_4236157_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|4236397_4237312_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|4237308_4238112_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140187.1|4243858_4244434_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4244621_4245653_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294606.1|4245645_4246299_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874227.1|4246338_4247154_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202328.1|4247271_4247676_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094000.1|4247672_4248380_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260720.1|4248490_4250209_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP038299	Escherichia coli O157:H7 strain TB182A plasmid pTB182A-5, complete sequence	70894	27488	34128	70894	transposase	Escherichia_phage(28.57%)	10	NA	NA
WP_001043260.1|27488_28304_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000131876.1|28640_28844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251694.1|28834_29056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001415369.1|29290_29620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|29806_30667_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|30957_31662_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000571065.1|31757_32267_+	trimethoprim-resistant dihydrofolate reductase DfrA8	NA	A0A1Y0SUI9	Pseudomonas_phage	38.8	6.5e-14
WP_000144779.1|32263_32920_+	metallophosphoesterase	NA	A0A2H4P756	Pseudomonas_phage	43.7	7.0e-45
WP_001067855.1|32956_33661_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001696636.1|33747_34128_-	HTH domain-containing protein	NA	A0A2I7RTF0	Vibrio_phage	46.8	5.7e-23
