The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	1229986	1243423	5455720	tail,holin	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1229986_1230598_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230594_1231260_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1231256_1231880_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1232132_1232876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232961_1233129_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1233536_1235390_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1235539_1235755_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235759_1236104_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236460_1236841_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236837_1237185_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1237802_1238072_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1238232_1238655_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1238784_1239843_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1239921_1240572_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1240754_1241345_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1241846_1242095_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1242940_1243423_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	1521003	1526429	5455720	integrase	Enterobacteria_phage(50.0%)	6	1509991:1510007	1528625:1528641
1509991:1510007	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1521003_1521573_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1521572_1522040_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1522026_1522707_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1522716_1523853_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1524027_1525185_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1525496_1526429_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1528625:1528641	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	1770710	1871662	5455720	protease,holin,tRNA,portal,tail,terminase	Enterobacteria_phage(50.68%)	110	NA	NA
WP_000569336.1|1770710_1771637_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1771641_1772373_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1772353_1772461_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1772520_1773222_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1773242_1774529_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1774562_1774817_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1774835_1774970_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1774973_1775216_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1775303_1775666_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1775662_1776019_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1776352_1776529_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1776530_1777478_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1777474_1777696_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1777794_1778076_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1778086_1778278_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_032195523.1|1778250_1778433_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000186740.1|1778432_1779110_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1779106_1779892_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1779897_1780194_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1780269_1780560_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1781063_1782671_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1782777_1783470_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1783833_1784373_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1784369_1785389_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1785385_1786087_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1786083_1786368_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1786595_1786793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1786836_1787118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1787208_1787310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1787306_1787762_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1787761_1787932_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1787924_1788215_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1788211_1788574_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1788570_1788711_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1788796_1789231_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1789479_1789632_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1790435_1792382_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1792519_1792699_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1792739_1792985_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1793062_1793278_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1793282_1793816_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1794086_1794656_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1794655_1794802_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1795029_1795215_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1795732_1796209_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1796205_1798329_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1798325_1798538_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1798537_1800040_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114421.1|1799984_1802009_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|1802096_1802423_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1802415_1802697_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1802699_1803323_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1803335_1803734_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_024748478.1|1803741_1804494_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000479062.1|1804507_1804930_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1804956_1805265_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_171878302.1|1805308_1807954_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000847298.1|1807950_1808280_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1808279_1808978_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1808988_1809732_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_140439784.1|1809677_1810310_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	1.0e-101
WP_024748476.1|1810554_1814034_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230509.1|1814101_1814701_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_088136427.1|1814765_1815935_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|1815936_1816206_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1816366_1816783_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1816864_1817506_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1817667_1817916_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1818430_1820116_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1820112_1820832_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1820878_1821349_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1821390_1821852_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1821976_1823980_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1823976_1825113_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1825105_1825837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1825855_1827385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1827395_1828484_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1829724_1830042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1830103_1833733_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1840689_1842723_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1842854_1843964_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1844225_1844507_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1844798_1845341_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1845428_1846103_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1846118_1848599_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1848609_1849644_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1849725_1850064_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1850281_1851133_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1851253_1851526_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1851635_1851950_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1851959_1852307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1853357_1853597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1853930_1854719_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1854715_1855516_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1855580_1856399_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1856450_1857197_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1857170_1858136_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1858132_1859137_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1859133_1860411_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1860667_1861720_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1862018_1862873_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1862901_1864164_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1864173_1864626_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1864656_1864941_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490697.1|1864944_1866300_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1866347_1867388_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1867487_1868267_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1868348_1869248_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1869653_1869971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1870300_1871662_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	1957679	2036433	5455720	integrase,capsid,head,transposase,protease,holin,tail,terminase,lysis	Stx2-converting_phage(58.75%)	94	1948630:1948644	1965366:1965380
1948630:1948644	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|1957679_1958858_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1958838_1959030_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_162829202.1|1959274_1960487_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000610373.1|1960952_1961303_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|1962169_1963117_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|1963113_1963335_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1963433_1963715_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|1963725_1963917_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1963889_1964072_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|1964068_1964749_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001302855.1|1964745_1965531_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
1965366:1965380	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|1965536_1965833_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|1965907_1966051_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1966019_1966184_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1966256_1966625_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_162829202.1|1966999_1968213_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000088203.1|1968430_1968703_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1968680_1968863_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1969431_1969953_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1970454_1971150_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1971224_1971440_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1971581_1971878_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1971910_1972072_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|1972058_1972880_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|1972876_1974253_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001220560.1|1974331_1974943_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000344569.1|1975406_1975739_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103678.1|1975871_1976087_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1976097_1976334_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1976290_1976737_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1976733_1977261_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1977257_1977440_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|1977714_1978479_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|1978553_1979276_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001028858.1|1979877_1980549_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1980539_1981028_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1981677_1982637_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1982648_1982918_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1983214_1983538_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_171888295.1|1983781_1985719_+	DUF1737 domain-containing protein	NA	A0A0P0ZDW4	Stx2-converting_phage	99.4	0.0e+00
WP_000143458.1|1985856_1986036_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1986076_1986349_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1986425_1986641_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1986640_1987138_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1987134_1987572_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1987774_1988272_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1988268_1988526_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|1988988_1989216_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1989257_1989623_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|1989914_1990478_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_162829202.1|1991146_1992360_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_171878299.1|1993512_1995450_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_001063023.1|1995494_1995716_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|1998242_1998569_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1998578_1998929_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1998925_1999372_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1999368_1999713_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1999771_2000488_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2000493_2000868_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2000963_2001173_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015994262.1|2001224_2004467_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2004459_2004801_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|2004800_2005499_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_001302649.1|2005515_2005836_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2005943_2006117_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2006187_2007111_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2007164_2007902_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2007847_2008480_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000515107.1|2008739_2012219_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_001230314.1|2012285_2012885_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000268993.1|2012949_2014263_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001023452.1|2014264_2014534_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2014674_2015550_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2015774_2016425_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2017748_2018915_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2019033_2019507_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2019705_2020764_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2020935_2021265_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2021365_2021548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2022036_2022150_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2022162_2022357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2022815_2023184_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2023257_2023479_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2023541_2024018_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2024032_2024512_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2024593_2025415_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2025635_2026046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2026061_2026745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2026880_2027951_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2027947_2028853_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2028849_2029731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2029714_2030928_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2031299_2033447_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2034894_2036433_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 5
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	2060818	2101976	5455720	integrase,capsid,head,transposase,holin,portal,tail,terminase	Escherichia_phage(33.33%)	52	2041089:2041103	2064943:2064957
2041089:2041103	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000533600.1|2060818_2061841_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2061840_2062044_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2062102_2064574_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2064669_2064858_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2064854_2065043_-	cell division inhibitor	NA	NA	NA	NA	NA
2064943:2064957	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2065523_2065676_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2065950_2066595_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2066692_2066920_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2066916_2067342_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2067410_2068448_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2068359_2068902_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2068936_2069635_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2069656_2069881_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2069877_2070234_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2070266_2070419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2070415_2070727_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2070853_2071417_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2071526_2071631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2071817_2072030_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2072197_2072476_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2072477_2073527_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2073539_2073899_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2073895_2074585_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2076124_2077975_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2078056_2079270_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2079580_2079796_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2079800_2080145_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2080195_2080729_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2080884_2081067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2081079_2081211_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2081438_2081624_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2082150_2082465_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2082546_2082771_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2083165_2083675_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2083646_2085575_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2085558_2085765_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2085761_2087354_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2087343_2088849_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2088885_2089233_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2089290_2089557_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2089538_2090279_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2090292_2090724_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2090750_2091164_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_128484525.1|2091144_2093724_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847298.1|2093720_2094050_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|2094049_2094748_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000194801.1|2094758_2095502_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_140439784.1|2095447_2096080_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	1.0e-101
WP_024748476.1|2096324_2099804_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230509.1|2099871_2100471_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_000268854.1|2100535_2101705_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001023396.1|2101706_2101976_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
>prophage 6
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	2159560	2179546	5455720	transposase,tail,integrase	Enterobacteria_phage(75.0%)	28	2172682:2172695	2182688:2182701
WP_032161583.1|2159560_2160697_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2160647_2160971_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2161128_2162313_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2162312_2162825_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2162879_2163245_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2163253_2163409_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2166211_2166700_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2166856_2167429_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2167472_2168003_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2169094_2169409_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2169413_2170373_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2170449_2173272_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2172682:2172695	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2173278_2173644_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2173640_2174258_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2174269_2174569_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2174565_2174832_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2174828_2175032_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2175055_2175472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2175564_2175678_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2175674_2175917_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2175928_2176207_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2176217_2176568_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2176589_2176793_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2176864_2177002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2177091_2177496_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2177511_2178162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2178191_2178539_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001303019.1|2178544_2179546_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
2182688:2182701	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	2500093	2674156	5455720	capsid,integrase,head,transposase,protease,holin,portal,tail,terminase	Stx2-converting_phage(29.7%)	206	2567577:2567636	2621528:2623969
WP_001260835.1|2500093_2500915_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2501014_2501098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2501190_2501526_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2501922_2503176_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2503282_2504176_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2504310_2505531_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2505655_2506351_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2506303_2507596_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2507753_2508368_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2508410_2509265_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2509266_2509884_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2509894_2512318_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_171878297.1|2512378_2514805_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	8.6e-213
WP_000778147.1|2515003_2515309_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2515416_2516127_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2516129_2516690_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2516724_2517066_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2517200_2517527_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2518515_2518767_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2518839_2521311_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2521403_2521595_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2521591_2521780_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2522180_2522345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2522348_2522567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2522638_2522938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2523290_2523569_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2523570_2523762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2523782_2524154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2524251_2524554_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2524550_2524976_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095670.1|2524998_2525961_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000788936.1|2525967_2526708_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_001118159.1|2527518_2527914_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2527970_2528555_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2528670_2528775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2528963_2529176_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2529343_2529622_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2529623_2530673_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2530685_2531045_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2531041_2531731_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2532368_2532797_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_024748470.1|2533275_2535126_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_024180155.1|2535565_2535781_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2535785_2536130_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2536180_2536714_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2536984_2537554_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2537553_2537700_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2537927_2538113_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2538537_2538765_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2538806_2539172_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2539461_2540025_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|2540021_2541683_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|2541746_2543684_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2543728_2543950_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2543895_2546397_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2546476_2546803_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2546812_2547163_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2547159_2547606_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2547602_2547947_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2548005_2548722_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2548727_2549102_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2549197_2549407_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2549459_2552702_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2552694_2553036_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2553035_2553734_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_046671488.1|2553744_2554488_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|2554433_2555066_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2555408_2556584_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_128484559.1|2556535_2556796_+	hypothetical protein	NA	A0A0P0ZBW1	Stx2-converting_phage	98.6	8.1e-37
WP_162829348.1|2556798_2558012_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_001228304.1|2560261_2560861_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_024748516.1|2561012_2562326_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|2562327_2562597_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2563623_2564949_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
2567577:2567636	attL	GTAAGCGTACAGCGAGGGCCGTATTGACGGGGATGTGTTATTCAGCTGGCAGTGCTATGC	NA	NA	NA	NA
WP_000998048.1|2567613_2569152_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2569201_2569549_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2569545_2569926_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2570265_2570544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2570971_2571118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2571254_2571902_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2572085_2572676_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2574182_2574833_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001500821.1|2576132_2577263_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000113189.1|2577240_2577489_-	excisionase	NA	NA	NA	NA	NA
WP_000102181.1|2577553_2579998_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|2580090_2580279_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2580275_2580464_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|2580951_2581104_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|2581273_2581663_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|2581765_2582041_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|2582024_2582450_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2582472_2583426_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2583432_2584173_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|2584202_2584973_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|2584988_2585384_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|2585440_2585797_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|2585845_2586058_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|2586093_2586465_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|2586461_2586824_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|2586939_2587044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2587232_2587445_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000998188.1|2587741_2587909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304183.1|2587974_2588253_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|2589316_2589691_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|2589687_2590509_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|2590735_2590933_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|2591083_2592142_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_171877039.1|2592633_2594484_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_024164617.1|2594920_2595136_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075112.1|2595135_2595633_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|2595849_2596035_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2596562_2596877_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2596958_2597183_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2597224_2597590_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|2597878_2598442_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2598438_2600100_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2600163_2602101_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2602145_2602367_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_106378527.1|2602312_2604652_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	92.6	0.0e+00
WP_000126019.1|2604731_2605058_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2605067_2605418_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2605414_2605861_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2605857_2606202_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2606260_2606977_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2606982_2607357_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2607452_2607662_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2607714_2610957_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2610949_2611291_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2611290_2611728_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_162829348.1|2611849_2613063_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_012779365.1|2613228_2616489_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_001304111.1|2616491_2616707_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2616774_2617374_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2617438_2618662_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2618663_2618933_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2619046_2619622_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2620331_2620982_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2621564_2623103_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2623152_2623500_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2623496_2623877_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2624839_2625082_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
2621528:2623969	attR	GTAAGCGTACAGCGAGGGCCGTATTGACGGGGATGTGTTATTCAGCTGGCAGTGCTATGCGCCACGGAAGCAGTTCGCTGACCCGGTTGACCGGCCAGTCTGCTATGACGCCAAGCACATGGCGAAGGTAGCTTTCTGGATCCACGTCATTCAGTTTGCACGTCCCGATCAGGCTGTACAGTAGCGCTCCCCGCTCACCACCATGATCAGAGCCGAAGAACAGGAAGTTTTTACGACCCAGACTGACCGCCCGCAGGGCATTTTCAGCGATGTTGTTGTCGATTTCCACCCAGCCATCGTTCGCATAGTACGTCAGTGCCGGCCACTGGTTAAGTGCGTACGCGAACGCCTTCGCCAACTCTGAGTGTCGCGACAGGGTCTTCATCTTTTCACGCAACCAGCTTTCCAGGGATTTCAACAACGGTTTCGTTTTTCGCTGACGTTCAGCAAGCCGCTGCTCTGCCGGCATTCCCCTTATATCCGCCTCTATGGCGTACAACTGACCGATCTGCTCCAGGGCTTCTTCCGTCAGTGCTGACGGGATGCGGACGTGCACATCGTGGATCTTTCGGCGGGCATGAGCCCAGCAGGCAGCTTCCGTTATCCCACCATTGCGATACAGCTCGTTGAACCCGGCGTACGCATCCGCTTGCAGCACACCGCTGAAGCAGGCAAGATGAGTCTGCGGATGGATGCCTTTTCTGTCCGGGCTGTAAGCGAACCACACTGCAGGTGCCAACGCTGACCCTGCATTGCGGTCATCACGAACATACGCCCACAACCGCCCGGTCTTCGTCTTCTTATTACCCGGCAGCAGTACCTGGACCGGGGTATCATCGGCATGGAGTTTGCCGTCAGTCATGACATAGCCATGAAGCGCCTCTTCCAGCGGAGACAGCAGCCGGCAGCATGCATCCACCCAGCCCGACAGCAGTGAACGCCTCAGCTCCACACCTTGCCGGCCGTATATTTCTGACTGGCGATACAGCGGGGTGTGCTCTGCATACTTCGAGGTCAGCACGCGGGCCAGCAGCCCCGGTCCGGCGATACCCCGCTCGATGGGCCGCGAAGGTGCAGGTGCCTGCACGATGGCATCGCACTGAGTACAGGCATGTTTTTCCCGTACCGTCCGGATAACCCGGAAGGCGCTACGCATCAACTCCAGCTGTTCGGCGGTATCCTCGCCCAGATAGCTCAGTGAACCGCCGCAGTTCGGGCAGCACGGCGCCGCAGGCAACAGTCGCTTTTCGTCACGGGGTAGTGATTCAGGGAACGGCTTACGGGTGCGGGTCTGACGCAACGGACGCTGTACTGCCGGGTCATACACCCTACCAGTCAGCGTATCGCTCTCTTTCTGAAGCCGGTTCAGATCGGCTTCCATTTGTGCGATACGGCGGGAGACTTTTTCGGAACGACTGCCGAAGTTCATCCGGCGGAGTTTATCCAGCTGCGCCTGCAGATGGTCTATTTCGCGCTCCCGGTTGCTCAGCTTTTCCTGCAGGGCGTGGATCAGCGCTTCCTGTTCGGCCAGGCGCTGTTTCAGCAGGAAGATGTCGTCAGAAGAGATGTCGTTCATAAGCCCGTATTTTACCGGGCTTATTCTGTGACAACCAGGATAAAGAGATTTACAGCATGGTCAGGGAGGTCAGCAGCCGCTTAGGCTGTCGCCAGTCGATACCTTCCAGCAGCATCGCCAGCTGCGCCTGCGTAAGGAACACTTTGCCATCACGGGCTGACGGCCAGGCGAAGCGCCCACGCTCCAGCCGTTTGGTCAGGAGGCACAGTCCGTCACCGGTGGACCACAGCAGTTTAACCTGACTGCCGCTGCGGCCCCGGAAAATGAAAACATGGCCGGACATGGGATCGTCTTTCAGCGCCGTTTGTACTTTCGCAGCCAGGCCGTTGAAGCCATTTCTCATATCGGTGATACCGGCAACCAGCCAAATTTTGGTCCCGGAAGGTAACGGGATCATCGCTTCAGTTCCTGTATCAGCAGAGTCAGGAGCTTTTCGCTGACATTGCCATTGAAGCGGAGCGTCCCGTGCCGGAACGTTACCTCACAGCTGATACTGAGGGTTTCCGGGTCCTCTGCGAGCGATTCTGGCTGTTCGGCAGCTGCATCGAGAGTCACAGGAAGTAGCTGGGGGCTCTCTGAAGAAGGTAATAGCAGCTTTCCCTCGCGCCATTGTTGTCGCCATTTGAACAACAGATTGGCGTTAATGCCATTTTCAAGAGCAAGTTTTGAGATGGATATCCCGGGTTCACAGGAGGCAGCAACGAGCTGCTGTTTAAATTCGGGAGGATAATTAGGGCAGCCTTTTCGCCTGCCGGGAGTCACATTTTTCTGCATATCTGATACTTTGGTTCCCACTACTTATTTGGTGGACACCACTTTGTCTAATTCGTCAGATTCTGACCAGACGGTTCAGGCTGTACGCTTAC	NA	NA	NA	NA
WP_000102123.1|2625792_2627037_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2627129_2627318_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2627314_2627503_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2628067_2628277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2628277_2628916_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2628927_2629080_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2629372_2629711_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2630102_2630345_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2630328_2630754_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_128484576.1|2630822_2631866_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2631858_2632320_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2632353_2633070_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2633102_2633384_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2633380_2633608_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2633600_2633912_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2634039_2634258_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2634259_2634817_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2635050_2635263_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2635382_2635727_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2635848_2636121_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2636122_2637172_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2637184_2637490_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2637552_2638107_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2638331_2638529_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2638664_2639378_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2639828_2640260_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_128484575.1|2640737_2642588_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2643027_2643243_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2643247_2643592_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2643642_2644176_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2644446_2645016_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2645015_2645162_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2645384_2645570_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2646095_2646410_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2646491_2646716_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2647102_2647648_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2647622_2649548_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2649544_2649751_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2649747_2651349_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2651329_2652649_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2652658_2652991_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2653046_2654072_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2654113_2654512_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2654523_2654877_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2654891_2655425_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2655421_2655817_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2655824_2656577_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2656590_2657013_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2657039_2657453_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2657433_2660046_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2660042_2660372_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001416783.1|2660371_2661070_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_171888297.1|2661080_2661824_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	97.2	1.8e-145
WP_071601640.1|2661769_2662399_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_024748476.1|2662639_2666119_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230508.1|2666186_2666786_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_024748460.1|2666850_2668164_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2668165_2668435_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2668548_2669124_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2669196_2669826_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2669907_2670549_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2670710_2670953_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_171888298.1|2671084_2672368_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2672456_2673917_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2673952_2674156_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	2944272	3010478	5455720	capsid,integrase,head,protease,holin,portal,tail,terminase	Stx2-converting_phage(37.5%)	72	2959774:2959801	3010615:3010642
WP_000422055.1|2944272_2945322_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2945541_2946300_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2946296_2946887_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2946926_2947799_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2948011_2949595_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2949622_2950243_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2950239_2951121_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2951258_2951303_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2951394_2952957_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763503.1|2952956_2954552_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983855.1|2954552_2955914_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000209521.1|2955925_2957119_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2957118_2957925_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2958305_2958485_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2958570_2959071_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2959116_2959623_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2959774:2959801	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001023426.1|2965699_2965969_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_024748463.1|2965970_2967284_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
WP_001230495.1|2967348_2967948_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_024748464.1|2968014_2971494_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_129137391.1|2971740_2972373_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2972318_2973062_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303038.1|2973072_2973771_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|2973770_2974112_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|2974104_2977347_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2977399_2977609_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2977704_2978079_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2978084_2978801_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2978859_2979204_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2979200_2979647_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2979643_2979994_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2980003_2980330_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2980409_2982911_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2982856_2983078_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2983122_2985060_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2985123_2986785_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2986781_2987345_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_015994246.1|2987634_2988000_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|2988041_2988269_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2988693_2988879_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2989106_2989253_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2989252_2989822_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2990092_2990626_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2990676_2991021_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2991025_2991241_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2991390_2993244_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2994040_2995099_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2995249_2995447_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2995688_2996219_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2996227_2996587_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2996599_2997646_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2997647_2997926_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2997995_2998253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2998473_2998686_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2998964_2999723_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3000421_3000586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3000582_3001164_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3001350_3001893_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3001804_3002845_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3002816_3003368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3003351_3003579_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3003655_3004063_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3004326_3004626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3004698_3004917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3004939_3005347_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3005324_3005558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3005551_3005719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3006116_3006305_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3006301_3006493_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048549.1|3006585_3009057_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_000113189.1|3009121_3009370_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3009347_3010478_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3010615:3010642	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	3057174	3149516	5455720	capsid,integrase,head,transposase,protease,holin,tRNA,portal,tail,terminase,lysis	Enterobacteria_phage(50.0%)	99	3079022:3079037	3143419:3143434
WP_001299679.1|3057174_3058431_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3058644_3059268_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3059267_3060119_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3060269_3061217_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3061341_3063021_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3063075_3063354_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3063631_3064216_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3064332_3065424_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3066267_3069153_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3069252_3071172_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|3071878_3072490_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3072589_3073504_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3073599_3075336_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3075727_3076798_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3076807_3078106_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3078435_3079968_+	SpoVR family protein	NA	NA	NA	NA	NA
3079022:3079037	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3080019_3080739_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3080960_3082502_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3082647_3083178_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3083223_3084492_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3084491_3084911_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3085283_3086195_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3086401_3086863_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3086939_3087599_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3087670_3087964_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3087975_3088134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3088204_3088606_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3088708_3089077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3089596_3090292_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3090315_3091128_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3091131_3091398_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3092629_3093214_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3093712_3094666_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3094852_3096337_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3096639_3098178_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3098227_3098575_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3098571_3098952_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3099027_3099276_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3099332_3100001_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3100498_3100681_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3100759_3101260_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3101296_3101803_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3101821_3102712_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3102831_3103413_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3103412_3106328_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3106392_3106992_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3107058_3110457_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3110517_3111150_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3111086_3111830_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3111835_3112534_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3112533_3112863_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3112859_3115409_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3115401_3115836_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3115817_3116240_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3116255_3116996_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3117003_3117399_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3117395_3117974_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3117985_3118339_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3118350_3118749_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063233.1|3118790_3119816_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_001295978.1|3119870_3120203_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3120212_3121532_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3121512_3123114_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3123110_3123317_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3123313_3125239_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3125213_3125759_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3126147_3126342_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3126506_3126713_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3126998_3127409_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3127700_3127994_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3128084_3128267_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3128483_3128960_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3128946_3129252_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3129573_3130263_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3130259_3130400_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3130396_3130759_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3130755_3131046_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3131038_3131209_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3131208_3131664_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3132165_3133692_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3133749_3133872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3133936_3134269_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3134336_3134639_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3134635_3135337_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088657.1|3136261_3136498_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3136487_3137630_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3137743_3138994_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3139165_3139819_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3139828_3140290_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3140343_3141450_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3141485_3142127_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3142130_3143501_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3143419:3143434	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3143669_3144341_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3144340_3145801_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3146401_3146683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3146938_3147481_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3147686_3148100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3148112_3148448_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3148460_3149516_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	3155608	3212949	5455720	integrase,capsid,head,holin,portal,tail,terminase	Stx2-converting_phage(26.79%)	71	3198516:3198536	3219606:3219626
WP_000085256.1|3155608_3156838_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3157086_3158208_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3158256_3159483_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3159732_3160869_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3160852_3161716_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3162079_3163441_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3163501_3163777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3166085_3169487_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3170077_3172426_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3172445_3172535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3172547_3172784_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3172729_3173467_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3173520_3174399_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3174701_3174812_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3174921_3175176_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3175192_3175891_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3175890_3176232_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3176224_3179467_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3179514_3179724_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3179819_3180194_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275499.1|3180208_3180925_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	8.0e-127
WP_000133388.1|3180983_3181328_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_171877933.1|3181324_3181771_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	4.0e-76
WP_001007901.1|3181767_3182118_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3182127_3182454_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_171888299.1|3182533_3185035_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	98.5	0.0e+00
WP_001063099.1|3184980_3185202_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3185246_3187184_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3187247_3188909_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3188905_3189469_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3189760_3190126_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3190167_3190353_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3190482_3190623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3190979_3191204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3191268_3191475_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3191702_3191849_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3191848_3192418_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3192688_3193222_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3193272_3193617_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3193621_3193837_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3193912_3194182_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3194219_3194402_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023167.1|3194549_3196487_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3196801_3196969_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3197565_3198387_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_128484529.1|3198383_3198758_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	6.0e-33
3198516:3198536	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3198770_3199820_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_128484528.1|3199821_3200100_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_000887477.1|3200267_3200480_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3200668_3200773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3200888_3201476_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3201478_3201670_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3201671_3202109_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3202095_3202413_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3202366_3202684_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3202673_3202976_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3202972_3203254_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3203286_3204003_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3204036_3204579_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3204490_3205528_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693962.1|3205596_3206022_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3206005_3206329_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3206453_3206930_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3207245_3207398_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3207512_3208028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3208160_3208550_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3208611_3208881_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3208849_3209968_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3210134_3210929_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3210925_3211972_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3212127_3212949_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3219606:3219626	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	3463937	3519280	5455720	capsid,integrase,head,transposase,protease,holin,portal,tail	Escherichia_phage(27.91%)	62	3465872:3465887	3521045:3521060
WP_000003653.1|3463937_3464525_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3464521_3465229_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3465247_3467041_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3465872:3465887	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3467037_3468156_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3470148_3470418_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3470419_3471733_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230466.1|3471797_3472397_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_000515109.1|3472464_3475938_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_000649827.1|3476071_3476599_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_050546863.1|3476789_3477422_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3477367_3478111_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_024748502.1|3478121_3478820_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	7.6e-130
WP_000847298.1|3478819_3479149_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_128484525.1|3479145_3481725_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|3481705_3482119_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3482145_3482577_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3482590_3483331_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3483312_3483579_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3483636_3483984_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3484020_3485526_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3485515_3487108_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3487104_3487311_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3489485_3491024_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3491073_3491421_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3491417_3491798_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3491873_3492149_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3492899_3493106_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3493361_3493634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3493793_3494327_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3494547_3494661_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3494882_3495068_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3495595_3495910_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3496114_3497328_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3497503_3499354_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3500120_3500834_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3501454_3502273_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3502424_3502796_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3502785_3503157_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3503169_3504219_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3504220_3504499_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3504666_3504822_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3504923_3505061_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3505426_3506200_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3506551_3506965_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3506980_3507751_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3507772_3508519_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_128484534.1|3508525_3509617_-	DNA-binding protein	NA	V5URT9	Shigella_phage	69.8	1.1e-132
WP_000273724.1|3509695_3510151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3510357_3510783_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3510766_3511039_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3511147_3511549_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3511576_3511768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3511767_3512055_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3512332_3512488_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3512629_3513019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3513205_3513391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3513964_3514153_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3514149_3514341_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3514434_3516906_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3516973_3517216_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3517193_3518213_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3518620_3519280_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3521045:3521060	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	3626501	3637619	5455720	capsid,integrase,terminase	uncultured_Caudovirales_phage(25.0%)	17	3627713:3627727	3639038:3639052
WP_000562896.1|3626501_3627425_-|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
WP_000006076.1|3627414_3627576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001229493.1|3627587_3628076_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
3627713:3627727	attL	GCTTAAACGCGGCAT	NA	NA	NA	NA
WP_001018605.1|3628205_3628367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391152.1|3628370_3628565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000164427.1|3628695_3628941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761784.1|3629292_3631041_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.6	8.6e-90
WP_000770151.1|3631037_3631337_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001302929.1|3631342_3631585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659213.1|3631574_3631766_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_001368837.1|3631944_3632148_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000201464.1|3632347_3632527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075374.1|3632661_3632886_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_000775337.1|3632977_3633751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085207.1|3633747_3634971_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.6e-127
WP_000410785.1|3635375_3635600_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188174.1|3635672_3637619_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
3639038:3639052	attR	ATGCCGCGTTTAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	3759400	3769283	5455720	transposase,tail,protease	Enterobacteria_phage(42.86%)	10	NA	NA
WP_000998048.1|3759400_3760939_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000767391.1|3761206_3761683_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001247925.1|3762189_3762888_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3763118_3764000_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3764168_3764330_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3764826_3765846_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3765879_3766860_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3767036_3767306_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3767307_3768624_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_171888303.1|3768683_3769283_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.0	4.0e-103
>prophage 14
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	3772827	3800284	5455720	integrase,protease,holin,portal,tail,terminase,lysis	Enterobacteria_phage(51.43%)	40	3761774:3761788	3800358:3800372
3761774:3761788	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_000090841.1|3772827_3773436_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3773372_3774116_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3774121_3774820_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3774829_3775159_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3775158_3778224_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3778195_3778525_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3778533_3778920_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3778980_3779724_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3779734_3780136_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3780132_3780711_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3780722_3780998_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3780990_3781314_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3781400_3783428_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3783372_3783708_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3783829_3784954_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3784881_3785094_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3785090_3787193_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001139679.1|3788357_3788510_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3788497_3788965_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3788961_3789459_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3789458_3789674_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3789816_3790215_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3790295_3790454_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3790539_3791283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3791466_3792156_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3792170_3792293_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3792630_3793590_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3793801_3794467_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3794463_3795084_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3795076_3795247_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3795243_3795426_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3796123_3796804_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3796800_3796983_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3796955_3797147_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3797157_3797439_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3797537_3797759_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3797969_3798572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3798814_3798982_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3799021_3799240_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3799513_3800284_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3800358:3800372	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 15
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	4343450	4439988	5455720	integrase,transposase,holin,tail,plate,lysis	Shigella_phage(31.91%)	109	4380568:4380614	4404912:4404958
WP_000998048.1|4343450_4344989_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4345038_4345386_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4345382_4345763_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4346026_4346290_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4346289_4346430_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4346499_4346691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484533.1|4347515_4348058_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4348132_4348720_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4348777_4349446_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4349471_4351997_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4351986_4353630_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4353598_4354309_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4354621_4354951_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4355198_4355813_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4356230_4356920_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4356916_4357873_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_171888304.1|4357869_4360068_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.5	9.6e-38
WP_000121344.1|4360077_4361034_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4361212_4362340_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4362481_4363540_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4363785_4364688_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4365390_4365669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4365835_4366558_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4366656_4367556_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4368231_4369188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4369320_4371654_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4371667_4371991_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4371990_4372212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4372208_4372766_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4372762_4373023_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4373956_4374709_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4374705_4375257_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4375262_4375535_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4375944_4376511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4376510_4377101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4377131_4377764_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4377756_4378215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484511.1|4378214_4378832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4378804_4379221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4379224_4380406_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4380568:4380614	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_128484510.1|4381368_4382112_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4382936_4383710_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4383770_4384325_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145350.1|4384355_4384766_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_001008234.1|4384786_4385230_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000368084.1|4385201_4385804_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_000554706.1|4385803_4386574_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000383550.1|4386577_4387162_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4387152_4388211_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4388197_4388623_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_162829202.1|4388714_4389927_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738423.1|4390299_4390593_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4390683_4390866_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4391082_4391559_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4391562_4391898_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4392034_4392328_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4392606_4392840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4392983_4393523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4393737_4394490_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4394503_4395493_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4395500_4396310_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4396329_4396719_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4396715_4397042_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4397038_4397692_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4397691_4398186_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4398182_4399124_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4399113_4399293_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4399468_4400020_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4400012_4400273_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4400370_4401063_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4401340_4401637_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4402313_4402850_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4402840_4403203_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4403202_4403508_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_128484509.1|4403734_4404898_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	1.0e-227
WP_000893282.1|4405102_4406356_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4404912:4404958	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4406367_4407471_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4407758_4408814_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4408852_4409254_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4409311_4410556_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4410647_4411106_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4411366_4412824_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4412880_4413438_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4413349_4413616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4413922_4414375_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4414384_4414783_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4414785_4415079_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4415130_4416186_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4416256_4417042_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4416986_4418726_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4419543_4420317_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4420502_4420763_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4420781_4421042_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4421197_4421938_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4421908_4422676_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4422780_4423359_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4423598_4426043_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4426085_4426559_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4426712_4427483_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4427600_4428773_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4428853_4429039_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4428953_4429217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484508.1|4429418_4433642_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000103335.1|4433717_4435859_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4436068_4436587_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4437282_4437783_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4437817_4438042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4438092_4439484_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4439574_4439988_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 16
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	4840715	4855850	5455720	transposase,integrase	Enterobacteria_phage(64.29%)	18	4839858:4839873	4860803:4860818
4839858:4839873	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_000998048.1|4840715_4842254_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4842303_4842651_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4842647_4843028_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001301682.1|4843274_4844102_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4844319_4844514_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_000783684.1|4844869_4847203_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|4847217_4847538_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|4847673_4848129_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|4848121_4848409_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|4848401_4848992_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|4848988_4849255_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|4849806_4850541_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|4850537_4851038_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4851111_4851684_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000095622.1|4852009_4853254_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|4853291_4854026_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|4854102_4854408_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|4854575_4855850_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
4860803:4860818	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 17
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	4888270	4947298	5455720	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4888270_4889623_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4889716_4890268_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4890423_4891797_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4891972_4892971_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4893003_4893999_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4893985_4895008_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4895021_4896524_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4896663_4897620_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4897929_4898460_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4898539_4898890_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4898883_4899135_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4899346_4899688_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4899690_4903470_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4903466_4905200_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4905405_4906044_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4906366_4907710_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4907805_4908012_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|4908336_4908891_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4908953_4909892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4910103_4910844_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|4911033_4912977_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|4913094_4913475_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4913563_4914424_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4914531_4915497_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4915604_4916267_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4916311_4917724_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4918032_4918653_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4918870_4919509_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4919643_4920852_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4920859_4921291_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4921913_4922708_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4922778_4923228_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4923269_4923497_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4923501_4923816_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4923822_4924218_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4924544_4924820_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4924948_4925635_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4925634_4926489_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4926498_4927149_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4927162_4927627_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4927636_4927942_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4927957_4929355_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4930881_4931637_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4931633_4932383_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4932564_4932894_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4933042_4933318_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4933434_4935060_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4935143_4936307_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4936309_4936948_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4936957_4937356_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4937373_4938033_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4938083_4938782_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4938800_4939202_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4939328_4940060_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4940240_4942682_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4942720_4943146_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4943350_4944649_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4944752_4944950_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4945031_4946036_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4946038_4947298_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 18
NZ_CP038287	Escherichia coli O157:H7 strain TX 376-2 chromosome, complete genome	5455720	5084177	5098842	5455720	tail,integrase,tRNA	Enterobacteria_phage(43.75%)	19	5080018:5080033	5097547:5097562
5080018:5080033	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5084177_5085593_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5085675_5086659_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5086824_5087067_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5087200_5088238_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5088326_5089424_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5089485_5089734_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5089894_5090536_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5090617_5091247_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5091319_5091892_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5092003_5092273_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5092274_5093588_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5093652_5094252_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5095573_5096110_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5096100_5096451_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5096447_5096732_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5097067_5097265_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5097609_5097891_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5097547:5097562	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5097938_5098112_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5098308_5098842_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038289	Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-1, complete sequence	96920	24315	86415	96920	protease,transposase,integrase	Macacine_betaherpesvirus(26.32%)	55	11888:11903	53424:53439
11888:11903	attL	GTGTTTTTCTGGCCGG	NA	NA	NA	NA
WP_001066920.1|24315_25056_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|25340_26318_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|26725_26926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|26922_27543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|27539_28223_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|28681_28900_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|28901_29207_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|29207_30014_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|30736_31950_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000852148.1|32025_32781_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|33368_34535_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|34534_35506_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|36114_37017_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|37020_37326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|37402_38086_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_001104869.1|38086_38308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|38201_38756_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001310284.1|39450_40023_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|40118_40421_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|40467_40890_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|40886_41078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|41196_41586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|42073_42304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|42355_43717_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|43763_44327_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001492078.1|44412_44856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|44925_45132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|45157_45610_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|45666_45900_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|45965_47924_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|47978_48413_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|48409_49171_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|49402_49561_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|51783_52215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581719.1|53973_63483_+	toxin B	NA	NA	NA	NA	NA
53424:53439	attR	CCGGCCAGAAAAACAC	NA	NA	NA	NA
WP_001171554.1|64477_64858_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|64854_65202_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|65251_66790_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000205762.1|68191_68938_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|68996_69857_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|69959_70520_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|70652_70865_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233853.1|71109_71571_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302200.1|71616_71826_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|71863_72202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|72441_72696_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|72931_73006_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|72998_73856_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|74767_75052_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|75051_75327_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|75421_75628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|77127_78340_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000592771.1|78643_80854_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|80897_81287_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034097.1|82512_86415_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
>prophage 1
NZ_CP038288	Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-2, complete sequence	99810	0	99714	99810	head,integrase,tail,transposase	Escherichia_phage(68.75%)	102	13052:13068	59636:59652
WP_000888906.1|641_1526_+	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	99.7	1.4e-160
WP_001285362.1|2796_3993_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038868.1|4009_5011_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	3.7e-178
WP_000067713.1|5236_6943_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000085155.1|7003_8593_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	99.2	6.2e-305
WP_000041774.1|8602_9418_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_000035299.1|9453_10035_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.9	2.1e-101
WP_000509943.1|10046_10556_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	1.1e-90
WP_001313475.1|10672_10828_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_001369095.1|11009_11255_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_001369093.1|11305_12151_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.2	2.1e-150
WP_001187870.1|12180_12981_-	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.2	2.1e-147
13052:13068	attL	AATTTATTAGAGCAAAT	NA	NA	NA	NA
WP_000743174.1|13145_14189_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	93.4	1.1e-172
WP_000245711.1|14185_14407_-	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	98.6	4.8e-38
WP_001448353.1|14807_15326_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	94.0	5.2e-19
WP_000780954.1|15414_15921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217773.1|15907_17092_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000188920.1|17246_17813_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_000523975.1|17823_18435_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	98.0	2.7e-107
WP_000926352.1|18449_19331_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	2.8e-174
WP_032271816.1|19412_22787_+	transglycosylase SLT domain-containing protein	NA	A0A077SK38	Escherichia_phage	84.7	0.0e+00
WP_000002800.1|22786_23143_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000047923.1|23139_24573_+	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_001189831.1|24572_25409_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
WP_001286326.1|25487_25922_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_044683623.1|25933_28783_+|tail	tail fiber protein	tail	Q71TP5	Escherichia_phage	91.9	0.0e+00
WP_024220676.1|28782_29361_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
WP_122993347.1|29404_29977_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_077625665.1|30465_30963_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	63.1	1.4e-24
WP_001312286.1|30943_31060_+	hypothetical protein	NA	Q37876	Escherichia_phage	100.0	8.0e-13
WP_000580776.1|31056_31500_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_001345482.1|31486_32089_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000434689.1|32090_34010_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.7	0.0e+00
WP_000175491.1|34006_34372_+	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_032326569.1|34384_37372_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.3	0.0e+00
WP_032271837.1|37361_37682_+	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	92.5	3.5e-42
WP_032271836.1|37885_38173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000432105.1|38419_39202_-	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	100.0	1.9e-145
WP_001376650.1|39208_39886_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	99.6	1.2e-127
WP_000068865.1|40083_40572_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
WP_001345478.1|40741_41299_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_001038142.1|41291_41546_+	hypothetical protein	NA	Q71TF4	Escherichia_phage	100.0	3.6e-37
WP_000786064.1|41590_42610_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.2	6.4e-178
WP_000774692.1|42602_44312_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
WP_001369290.1|44387_45251_+	SAM-dependent DNA methyltransferase	NA	Q1MVN7	Enterobacteria_phage	99.3	8.7e-160
WP_044683683.1|45663_51156_+	helicase	NA	A0A077SK04	Escherichia_phage	98.6	0.0e+00
WP_024220496.1|51189_51630_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	99.3	8.5e-79
WP_000747846.1|51626_51875_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_001100381.1|51936_52887_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_072096992.1|52919_53672_-	hypothetical protein	NA	Q71TG2	Escherichia_phage	92.0	6.5e-119
WP_024224078.1|53750_54311_-	Ref family protein	NA	Q71TG3	Escherichia_phage	98.4	7.7e-101
WP_001224246.1|54558_54870_-	hypothetical protein	NA	Q71TG4	Escherichia_phage	100.0	1.6e-47
WP_044683333.1|54920_55952_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.4	8.4e-194
WP_000874156.1|56776_56986_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_023441713.1|57096_57948_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000908421.1|59094_59571_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	3.4e-25
WP_000124159.1|59654_61139_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
59636:59652	attR	AATTTATTAGAGCAAAT	NA	NA	NA	NA
WP_023442315.1|61138_62332_-	hypothetical protein	NA	A0A077SL59	Escherichia_phage	99.5	1.4e-179
WP_001326849.1|62417_62870_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_023442316.1|62958_64002_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.1	4.8e-205
WP_024224144.1|64029_64209_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	2.3e-22
WP_001216044.1|64213_64594_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.8e-62
WP_001190712.1|64593_64815_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_024224146.1|64887_65277_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	98.4	4.1e-69
WP_032353386.1|65451_66024_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	96.3	5.3e-105
WP_024224114.1|66030_66282_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	97.6	1.4e-38
WP_001408981.1|66596_66857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000057453.1|67129_67780_-	hypothetical protein	NA	A0A077SK55	Escherichia_phage	94.5	2.1e-97
WP_024224113.1|67761_68136_-	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.0	7.0e-66
WP_000269004.1|68142_68436_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
WP_000516537.1|68614_68848_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_024224112.1|68933_69194_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	96.5	9.3e-41
WP_000935430.1|70723_70936_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	2.2e-32
WP_000403776.1|70981_71341_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	8.0e-59
WP_001018057.1|72007_72298_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_032349173.1|72294_72996_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	53.9	4.1e-51
WP_000476202.1|72992_73232_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	92.4	2.0e-34
WP_000158003.1|73224_73428_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
WP_024220560.1|74426_74933_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	98.8	4.1e-93
WP_032271979.1|75005_76268_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.5	1.7e-233
WP_000684846.1|76569_77271_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	99.6	5.4e-144
WP_094320255.1|77267_77945_-	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	99.1	1.4e-133
WP_000484116.1|77941_78568_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
WP_001561105.1|79069_79225_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	98.0	2.0e-19
WP_024224109.1|79291_79870_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	92.2	9.8e-99
WP_000840930.1|79872_80118_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_000235786.1|80264_80642_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141901.1|80651_81869_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	1.9e-224
WP_000896808.1|81872_82601_+	hypothetical protein	NA	Q71TJ9	Escherichia_phage	99.6	1.2e-138
WP_032346379.1|82587_83373_+	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000212023.1|83374_84391_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	5.9e-192
WP_000535208.1|84383_85016_+	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_001260617.1|85086_86121_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	77.7	1.5e-145
WP_000245706.1|86117_86339_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	82.2	2.1e-30
WP_001198659.1|86718_87717_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	98.2	4.5e-192
WP_001276599.1|87716_89081_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_000751806.1|89464_90292_-	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	99.6	2.8e-131
WP_000660980.1|92301_95343_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	87.2	0.0e+00
WP_162829202.1|96131_97344_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001177859.1|97550_97835_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_000890203.1|98297_99086_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
WP_171878311.1|99462_99714_+	hypothetical protein	NA	Q71TL6	Escherichia_phage	98.8	2.0e-40
