The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	1229507	1244877	5512933	transposase,holin,tail	Stx2-converting_phage(33.33%)	19	NA	NA
WP_000612591.1|1229507_1229855_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1229851_1230232_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|1230588_1230933_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|1230937_1231153_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|1231302_1233156_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|1233563_1233731_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1233816_1234560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|1234812_1235436_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|1235432_1236098_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|1236094_1236706_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|1236680_1237247_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_162829202.1|1237825_1239039_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1239256_1239526_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1239686_1240109_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1240238_1241297_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1241375_1242026_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1242208_1242799_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1243300_1243549_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1244394_1244877_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	1470604	1530067	5512933	transposase,tail,head,tRNA,protease,plate	Shigella_phage(55.0%)	74	NA	NA
WP_000695640.1|1470604_1472020_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000604897.1|1472020_1472563_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	57.7	5.1e-41
WP_000826499.1|1473818_1474211_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001296278.1|1474212_1474557_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001301445.1|1475190_1477380_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_001301799.1|1477429_1478632_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_137536838.1|1478967_1480206_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_000490072.1|1480345_1480672_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000903148.1|1480786_1482043_-	ion channel protein	NA	NA	NA	NA	NA
WP_000170346.1|1482246_1483212_+	glucokinase	NA	NA	NA	NA	NA
WP_000038456.1|1483430_1483757_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000985336.1|1483778_1485026_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000173224.1|1485040_1486126_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000366040.1|1486125_1487163_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000955897.1|1487187_1489683_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000646830.1|1489685_1490543_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001295458.1|1490555_1491290_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000528254.1|1491951_1492689_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_001444515.1|1492642_1492843_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|1492957_1493422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|1493460_1493706_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|1493741_1493924_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|1494070_1496110_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|1496209_1496770_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|1496991_1497195_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|1497274_1497796_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|1497830_1498742_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|1498741_1499302_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|1499292_1500375_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|1500374_1500812_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|1500804_1501419_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|1501408_1502533_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|1502516_1503866_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113523.1|1503852_1505928_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|1506054_1506531_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|1506545_1506911_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|1506919_1508422_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|1508418_1508664_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|1508664_1509225_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|1509221_1509641_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002056.1|1509637_1510036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|1510079_1511027_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850822.1|1511026_1512151_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_000094808.1|1512327_1512801_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000046901.1|1512922_1514254_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000532592.1|1514237_1515827_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_001057665.1|1515826_1517491_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360581.1|1517490_1518072_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279082.1|1518074_1518365_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|1518361_1518670_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342747.1|1518650_1518878_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|1518887_1519106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|1519089_1519518_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|1519552_1520053_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|1520124_1520550_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214366.1|1520619_1521129_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000378480.1|1521125_1521422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|1521411_1521609_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_001310453.1|1521601_1521934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|1521949_1522300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633440.1|1522314_1522626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973023.1|1522622_1523174_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|1523177_1523693_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_171877984.1|1523692_1524226_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	5.3e-67
WP_000323215.1|1524229_1524772_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	1.0e-28
WP_001129553.1|1524869_1525400_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049309.1|1525411_1525705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049426.1|1525709_1525982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000827937.1|1525978_1526260_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	3.7e-11
WP_001057197.1|1526261_1526516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268104.1|1526528_1526750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|1526752_1527685_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000269989.1|1527756_1529841_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	43.7	3.5e-154
WP_001448748.1|1529821_1530067_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	58.7	1.3e-12
>prophage 3
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	1563087	1568513	5512933	integrase	Enterobacteria_phage(50.0%)	6	1550762:1550778	1570709:1570725
1550762:1550778	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1563087_1563657_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1563656_1564124_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1564110_1564791_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_171877985.1|1564800_1565937_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1566111_1567269_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1567580_1568513_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1570709:1570725	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	1814223	1897829	5512933	capsid,transposase,terminase,tail,head,tRNA,holin,protease	Stx2-converting_phage(44.83%)	95	NA	NA
WP_000569336.1|1814223_1815150_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1815154_1815886_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1815866_1815974_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1816033_1816735_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063643.1|1816755_1818042_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1818075_1818330_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1818348_1818483_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1818486_1818729_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1818816_1819179_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1819175_1819532_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1819865_1820042_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1820043_1820991_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1820987_1821209_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1821307_1821589_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1821599_1821791_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1821763_1821946_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186785.1|1821945_1822623_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	99.1	2.3e-131
WP_000100847.1|1822619_1823405_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1823410_1823707_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|1823782_1823926_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198863.1|1823894_1824059_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000065377.1|1824131_1824500_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_000167595.1|1824650_1825121_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_024212238.1|1825179_1825563_-	hypothetical protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000687675.1|1826034_1826439_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_001082382.1|1826435_1827092_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000866443.1|1827088_1827376_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|1827512_1828217_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|1828330_1828564_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438541.1|1828702_1828999_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000185454.1|1829031_1829970_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000788928.1|1829966_1830668_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000145931.1|1830664_1830955_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000130.1|1831025_1831304_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1831436_1831652_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1831662_1831899_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_096850372.1|1831855_1832302_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	98.6	2.1e-80
WP_000153268.1|1832298_1832826_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1832822_1833005_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000290551.1|1833280_1833958_+	phage antirepressor Ant	NA	Q4A1A4	Enterobacteria_phage	97.8	2.2e-126
WP_001004018.1|1834032_1834755_+	phage antirepressor KilAC domain-containing protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_001107998.1|1834754_1835360_+	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_000144759.1|1835356_1835551_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|1835543_1835978_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|1836484_1837432_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1837441_1837711_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000998048.1|1839758_1841297_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1841346_1841694_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1841690_1842071_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_024164617.1|1842949_1843165_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731236.1|1843169_1843514_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992166.1|1843564_1844098_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	5.6e-101
WP_001056806.1|1844368_1844938_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539794.1|1844937_1845084_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	95.8	1.7e-15
WP_012816791.1|1845311_1845497_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|1845921_1846149_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1846190_1846556_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958400.1|1846847_1847411_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	93.6	4.7e-82
WP_001358824.1|1847407_1849069_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_113576400.1|1849132_1851070_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|1851114_1851336_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1853861_1854188_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|1854198_1854549_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1854545_1854992_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1854988_1855333_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275464.1|1855398_1856115_+	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000710952.1|1856129_1856504_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_122993099.1|1856599_1856809_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_000212827.1|1856856_1860099_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|1860091_1860433_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|1860432_1861131_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|1861147_1861468_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1861575_1861749_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|1861819_1862743_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|1862796_1863534_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_134791867.1|1863479_1864112_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_001230514.1|1867893_1868493_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268879.1|1868557_1869727_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	100.0	4.3e-85
WP_001023396.1|1869728_1869998_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1870158_1870575_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1870656_1871298_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1871459_1871708_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1872222_1873908_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1873904_1874624_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1874670_1875141_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_171878073.1|1875182_1875644_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	9.2e-76
WP_001087225.1|1875768_1877772_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1877768_1878905_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1878897_1879629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1879647_1881177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1881187_1882276_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1883516_1883834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1883895_1887525_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|1892782_1893996_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001301615.1|1895795_1897829_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 5
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	1923454	1961521	5512933	capsid,terminase,tail,head,integrase,tRNA,holin,lysis,portal,plate	Escherichia_phage(60.0%)	50	1925235:1925262	1957195:1957222
WP_000807362.1|1923454_1924354_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1924759_1925077_+	hypothetical protein	NA	NA	NA	NA	NA
1925235:1925262	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1925341_1926355_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1926470_1926770_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1926891_1927167_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1927177_1927348_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|1927344_1927845_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1927908_1928133_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1928132_1928432_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1928434_1928659_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1928655_1928931_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1928920_1931203_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063136.1|1931292_1932516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1932562_1933015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844437.1|1933014_1934982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038161.1|1935299_1936334_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1936333_1938106_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085953.1|1938279_1939134_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_001248539.1|1939192_1940266_+|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	99.2	4.3e-201
WP_000203461.1|1940269_1941013_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.4	8.6e-124
WP_000988633.1|1941112_1941622_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1941621_1941825_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1941828_1942110_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1942109_1942607_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1942621_1943047_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1943034_1943460_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1943431_1943605_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1943567_1944035_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001810.1|1944027_1944480_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_001093728.1|1944546_1945182_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1945178_1945526_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1945530_1946439_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1946431_1947043_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217052.1|1947039_1948359_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001057694.1|1948358_1948961_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|1948932_1949376_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001145592.1|1949396_1949807_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_000905094.1|1949837_1950431_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286706.1|1950490_1951681_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_001251408.1|1951693_1952212_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1952268_1952544_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1952576_1952696_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_171877991.1|1952688_1955136_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.9	0.0e+00
WP_000978913.1|1955150_1955630_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1955629_1956793_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1956874_1957093_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1957366_1958728_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1957195:1957222	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1958875_1959208_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1959398_1960121_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1960117_1961521_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 6
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	2044745	2181551	5512933	capsid,transposase,terminase,tail,head,integrase,holin,protease,lysis,portal	Stx2-converting_phage(36.51%)	163	2041363:2041377	2143764:2143778
2041363:2041377	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|2044745_2045924_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|2045904_2046096_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2046173_2046518_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2046705_2047056_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|2047052_2047409_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|2047742_2047919_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289930.1|2047920_2048868_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2048864_2049086_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2049184_2049466_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2049476_2049668_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2049640_2049823_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|2049819_2050500_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|2050496_2051282_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|2051287_2051584_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2051658_2051802_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2051770_2051935_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2052007_2052376_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2052558_2052810_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2052868_2053141_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2053118_2053301_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2053869_2054391_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2054892_2055588_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2055663_2055879_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2056020_2056317_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2056349_2056511_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2056497_2057319_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2057315_2058692_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|2058762_2059041_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2059173_2059389_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2059399_2059636_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2059592_2060039_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2060035_2060563_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2060559_2060742_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000290551.1|2061017_2061695_+	phage antirepressor Ant	NA	Q4A1A4	Enterobacteria_phage	97.8	2.2e-126
WP_001004018.1|2061769_2062492_+	phage antirepressor KilAC domain-containing protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_001108004.1|2062491_2063097_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2063093_2063765_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2063755_2064244_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2064893_2065853_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2065864_2066134_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2066430_2066754_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143087.1|2066997_2068935_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	98.9	0.0e+00
WP_000143458.1|2069071_2069251_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2069291_2069564_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2069640_2069856_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2069855_2070353_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092313.1|2070349_2070787_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|2070989_2071487_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2071483_2071741_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|2072203_2072431_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2072472_2072838_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958400.1|2073132_2073696_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	93.6	4.7e-82
WP_001358824.1|2073692_2075354_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_113576400.1|2075417_2077355_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|2077399_2077621_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|2080147_2080474_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2080484_2080835_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2080831_2081278_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2081274_2081619_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275464.1|2081684_2082401_+	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000710952.1|2082415_2082790_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_122993099.1|2082885_2083095_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_000212827.1|2083142_2086385_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2086377_2086719_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|2086718_2087417_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|2087433_2087754_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2087861_2088035_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2088105_2089029_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2089082_2089820_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_134791867.1|2089765_2090398_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_001304130.1|2090636_2091812_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.5	3.0e-232
WP_171878074.1|2091763_2094112_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.2	0.0e+00
WP_001230514.1|2094179_2094779_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_171877993.1|2094843_2096157_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	88.8	2.8e-77
WP_001023407.1|2096158_2096428_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000491542.1|2096569_2097445_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001303036.1|2099643_2100810_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2100928_2101402_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2101600_2102659_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2102830_2103160_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2104252_2104435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2104923_2105037_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2105049_2105244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2105702_2106071_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2106144_2106366_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2106428_2106905_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2106919_2107399_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2107480_2108302_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2108522_2108933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2108948_2109632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2109767_2110838_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2110834_2111740_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_171878075.1|2111736_2112594_-	vimentin yjdA	NA	NA	NA	NA	NA
WP_000966626.1|2112875_2115023_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2116470_2118009_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2118058_2118406_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2118402_2118783_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2119144_2119690_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2119686_2120430_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2120441_2121521_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2121582_2122518_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2122974_2123892_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2123993_2124944_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2125061_2126705_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2127330_2128047_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2128389_2129844_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2129945_2131262_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2131575_2132628_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2132889_2140872_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2141361_2142159_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2142394_2143417_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2143416_2143620_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2143678_2146150_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2143764:2143778	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2146245_2146434_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2146430_2146619_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2147099_2147252_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2147526_2148171_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2148268_2148496_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2148492_2148918_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_171877994.1|2148986_2150030_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	65.1	2.3e-82
WP_021499894.1|2150022_2150484_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.1	2.7e-83
WP_000450610.1|2150518_2151217_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2151238_2151463_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2151459_2151816_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2151848_2152001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2151997_2152309_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2152435_2152999_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2153108_2153213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2153399_2153612_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2153779_2154058_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2154059_2155109_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2155121_2155481_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2155477_2156167_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2156800_2157229_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_024165672.1|2159023_2159239_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2159243_2159588_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2159638_2160172_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2160327_2160510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2160522_2160654_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2160881_2161067_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2161593_2161908_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2161989_2162214_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2162608_2163118_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2163089_2165018_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2165001_2165208_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_171877995.1|2165204_2166797_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	2.5e-181
WP_001254002.1|2166786_2168292_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2168328_2168676_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2168733_2169000_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2168981_2169722_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2169735_2170167_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2170193_2170607_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_148724009.1|2170587_2172450_+|tail	phage tail length tape measure family protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_001304129.1|2172401_2173166_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	98.0	3.3e-134
WP_000847298.1|2173162_2173492_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032256908.1|2173491_2174190_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_054191786.1|2174200_2174944_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_064562156.1|2174889_2175519_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_001304130.1|2175759_2176935_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.5	3.0e-232
WP_171878074.1|2176886_2179235_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.2	0.0e+00
WP_001230514.1|2179302_2179902_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_171877993.1|2179966_2181280_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	88.8	2.8e-77
WP_001023407.1|2181281_2181551_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 7
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	2240157	2259054	5512933	integrase,tail	Enterobacteria_phage(78.26%)	27	2252190:2252203	2262196:2262209
WP_000132765.1|2240157_2240481_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2240638_2241823_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2241822_2242335_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2242389_2242755_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2242763_2242919_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2245719_2246208_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2246364_2246937_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2246980_2247511_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2248602_2248917_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2248921_2249881_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_171877998.1|2249957_2252780_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2252190:2252203	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2252786_2253152_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2253148_2253766_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2253777_2254077_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2254073_2254340_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2254336_2254540_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2254563_2254980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2255072_2255186_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2255182_2255425_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2255436_2255715_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2255725_2256076_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2256097_2256301_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2256372_2256510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2256599_2257004_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2257019_2257670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2257699_2258047_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2258052_2259054_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2262196:2262209	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 8
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	2579599	2670793	5512933	capsid,transposase,terminase,tail,head,holin,protease,portal	Stx2-converting_phage(36.07%)	100	NA	NA
WP_001260835.1|2579599_2580421_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2580520_2580604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2580696_2581032_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2581428_2582682_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2582788_2583682_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2583816_2585037_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2585161_2585857_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2585809_2587102_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2587259_2587874_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2587916_2588771_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2588772_2589390_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2589400_2591824_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_171878003.1|2591884_2594311_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	1.5e-212
WP_000778147.1|2594509_2594815_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2594922_2595633_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2595635_2596196_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2596230_2596572_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2596706_2597033_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2598021_2598273_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2598345_2600817_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2600909_2601101_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2601097_2601286_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2601686_2601851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171878004.1|2601854_2602073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2602144_2602444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2602796_2603075_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2603076_2603268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2603288_2603660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2603757_2604060_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2604056_2604482_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2604504_2605467_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2605473_2606214_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2607024_2607420_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2607476_2608061_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2608176_2608281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2608469_2608682_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2608849_2609128_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2609129_2610179_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2610191_2610551_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2610547_2611237_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2611874_2612303_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2612781_2614632_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2615071_2615287_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2615291_2615636_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2615686_2616220_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2616490_2617060_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2617059_2617206_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2617433_2617619_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2618043_2618271_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2618312_2618678_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2618967_2619531_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2619527_2621189_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2621252_2623190_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2623234_2623456_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_106378527.1|2623401_2625741_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	92.6	0.0e+00
WP_000126019.1|2625820_2626147_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2626156_2626507_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2626503_2626950_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2626946_2627291_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2627349_2628066_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2628071_2628446_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2628541_2628751_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212915.1|2628803_2632046_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2632038_2632380_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080222.1|2632379_2633078_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_171878005.1|2633088_2633832_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	4.3e-147
WP_050439450.1|2633777_2634410_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2634752_2635928_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|2635879_2638225_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|2638292_2638892_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|2639043_2640357_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001303941.1|2640375_2640906_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	66.5	8.7e-62
WP_001025672.1|2641245_2642571_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|2644168_2644291_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2644397_2645309_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2645374_2645944_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2646909_2648448_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2648497_2648845_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2648841_2649222_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2649561_2649840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2650267_2650414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2650550_2651198_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2651381_2651972_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2653478_2654129_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001079499.1|2655442_2655949_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2655994_2656495_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2656580_2656760_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2657140_2657947_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2657946_2659140_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|2659151_2660513_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|2660513_2662109_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|2662108_2663671_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2663762_2663807_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2663944_2664826_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2664822_2665443_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2665470_2667054_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2667266_2668139_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2668178_2668769_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2668765_2669524_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2669743_2670793_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 9
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	2942437	3040694	5512933	capsid,transposase,terminase,tail,head,integrase,holin,portal	Escherichia_phage(30.84%)	126	2985707:2985720	3041573:3041586
WP_000214712.1|2942437_2942641_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2942676_2944137_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2944225_2945509_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2945640_2945883_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2946044_2946686_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2946767_2947397_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2947469_2948045_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2948158_2948428_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_171878015.1|2948429_2949743_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	99.3	1.3e-77
WP_001230514.1|2949807_2950407_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_171878016.1|2950474_2953951_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.9	0.0e+00
WP_071601640.1|2954191_2954821_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_000194801.1|2954766_2955510_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|2955520_2956219_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2956218_2956548_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_171878017.1|2956544_2959157_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.8	0.0e+00
WP_000533440.1|2959137_2959551_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2959577_2960000_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2960013_2960766_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2960773_2961169_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2961165_2961699_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2961713_2962067_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2962078_2962477_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2962518_2963544_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2963599_2963932_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2963941_2965261_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2965241_2966843_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2966839_2967046_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2967042_2968968_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2968942_2969488_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2969874_2970099_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2970180_2970495_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2971020_2971206_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2971428_2971575_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2971574_2972144_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_171878018.1|2972414_2972948_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.9	8.7e-102
WP_000731241.1|2972998_2973343_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024165672.1|2973347_2973563_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000023184.1|2974001_2975852_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2976329_2976761_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2977211_2977925_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2978060_2978258_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2978482_2979037_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2979099_2979405_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2979417_2980467_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2980468_2980741_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2980862_2981207_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2981326_2981539_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2981772_2982330_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2982331_2982550_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2982677_2982989_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2982981_2983209_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2983205_2983487_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2983519_2984236_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2984269_2984731_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2984723_2985767_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
2985707:2985720	attL	TCGTTCGCCACTTG	NA	NA	NA	NA
WP_000693878.1|2985835_2986261_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2986244_2986487_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2986878_2987217_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2987509_2987662_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2987673_2988312_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2988312_2988522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2989086_2989275_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2989271_2989460_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2989552_2990797_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2991507_2991750_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2992712_2993093_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2993089_2993437_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2993486_2995025_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2995607_2996258_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2996968_2997544_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2997657_2997927_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_171878019.1|2997928_2999152_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	91.5	3.9e-81
WP_001230508.1|2999216_2999816_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|2999883_3000099_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_105626756.1|3000101_3003362_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001179509.1|3003549_3003987_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807950.1|3003986_3004328_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212915.1|3004320_3007563_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|3007615_3007825_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3007920_3008295_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3008300_3009017_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3009075_3009420_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3009416_3009863_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3009859_3010210_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126026.1|3010219_3010546_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	4.5e-53
WP_000267292.1|3010625_3013127_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3013072_3013294_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3013338_3015276_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3015339_3017001_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3016997_3017561_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3017850_3018216_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3018257_3018485_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3018909_3019095_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3019322_3019469_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3019468_3020038_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3020308_3020842_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3020892_3021237_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3021241_3021457_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3021606_3023460_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|3024256_3025315_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3025465_3025663_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3025904_3026435_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3026443_3026803_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3026815_3027862_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3027863_3028142_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3028211_3028469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3028689_3028902_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3029180_3029939_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3030637_3030802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3030798_3031380_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3031566_3032109_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3032020_3033061_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3033032_3033584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3033567_3033795_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3033871_3034279_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3034542_3034842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3034914_3035133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3035155_3035563_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3035540_3035774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3035767_3035935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3036332_3036521_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3036517_3036709_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3036801_3039273_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_171878020.1|3039337_3039586_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3039563_3040694_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3041573:3041586	attR	TCGTTCGCCACTTG	NA	NA	NA	NA
>prophage 10
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	3087390	3193759	5512933	capsid,transposase,terminase,tail,head,integrase,tRNA,holin,protease,lysis,portal	Enterobacteria_phage(47.17%)	109	3121942:3121957	3187662:3187677
WP_001299679.1|3087390_3088647_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3088860_3089484_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3089483_3090335_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3090485_3091433_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3091557_3093237_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3093291_3093570_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3093847_3094432_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3094548_3095640_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3096483_3099369_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3099468_3101388_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3101615_3102686_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3102696_3103329_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3103339_3104758_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3106789_3106990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3107097_3108120_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3108119_3109100_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3109096_3109855_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3110673_3111528_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3111553_3113524_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3113573_3113828_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001295616.1|3114760_3115372_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_171878022.1|3115471_3116386_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3116481_3118218_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3118614_3119685_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3119694_3120993_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3121355_3122888_+	SpoVR family protein	NA	NA	NA	NA	NA
3121942:3121957	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3122939_3123659_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3123880_3125422_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3125567_3126098_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3126143_3127412_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3127411_3127831_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3128203_3129115_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3129321_3129783_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3129859_3130519_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3130590_3130884_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3130895_3131054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3131124_3131526_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3131628_3131997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3132516_3133212_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3133235_3134048_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3134051_3134318_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3135557_3136142_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3136640_3137594_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3137780_3139265_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3139567_3141106_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3141155_3141503_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3141499_3141880_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3141955_3142204_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3142260_3142929_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_162829202.1|3143387_3144600_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000134810.1|3144739_3144922_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3145000_3145501_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3145537_3146044_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3146062_3146953_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3147072_3147654_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3147653_3150569_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3150633_3151233_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3151299_3154698_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3154758_3155391_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3155327_3156071_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3156076_3156775_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3156774_3157104_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000459457.1|3159643_3160078_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3160059_3160482_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3160497_3161238_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3161245_3161641_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3161637_3162216_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3162227_3162581_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3162592_3162991_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3163032_3164058_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3164113_3164446_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3164455_3165775_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3165755_3167357_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3167353_3167560_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3167556_3169482_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3169456_3170002_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3170390_3170585_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3170749_3170956_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3171241_3171652_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3171943_3172237_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3172327_3172510_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3172726_3173203_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3173189_3173495_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3173816_3174506_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971054.1|3174502_3174643_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099699.1|3174639_3175002_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	2.5e-60
WP_000774495.1|3174998_3175289_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_000224907.1|3175281_3175452_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053042.1|3175451_3175907_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
WP_070080197.1|3176408_3177935_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.9	7.9e-31
WP_001302833.1|3177992_3178115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3178179_3178512_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3178579_3178882_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3178878_3179580_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3180504_3180741_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3180730_3181873_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3181986_3183237_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3183408_3184062_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3184071_3184533_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3184586_3185693_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3185728_3186370_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3186373_3187744_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3187662:3187677	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3187912_3188584_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3188583_3190044_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3190644_3190926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3191181_3191724_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3191929_3192343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3192355_3192691_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3192703_3193759_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 11
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	3199861	3257208	5512933	capsid,terminase,tail,head,integrase,holin,portal	Stx2-converting_phage(26.79%)	71	3242775:3242795	3263865:3263885
WP_000085256.1|3199861_3201091_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3201339_3202461_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3202509_3203736_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3203985_3205122_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3205105_3205969_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3206332_3207694_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3207754_3208030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3210338_3213740_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3214330_3216679_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3216698_3216788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3216800_3217037_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3216982_3217720_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3217773_3218652_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3218954_3219065_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3219174_3219429_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3219445_3220144_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807950.1|3220143_3220485_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212827.1|3220477_3223720_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3223767_3223977_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3224072_3224447_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3224461_3225178_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3225243_3225588_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3225584_3226031_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3226027_3226378_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3226387_3226714_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_000267295.1|3226716_3229296_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3229241_3229463_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3229507_3231445_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3231508_3233170_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3233166_3233730_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3234019_3234385_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3234426_3234612_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3234741_3234882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3235238_3235463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3235527_3235734_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3235961_3236108_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3236107_3236677_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3236947_3237481_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3237531_3237876_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3237880_3238096_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3238171_3238441_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3238478_3238661_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3238808_3240746_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3241060_3241228_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3241824_3242646_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3242642_3243017_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3242775:3242795	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3243029_3244079_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3244080_3244359_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3244526_3244739_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3244927_3245032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3245147_3245735_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3245737_3245929_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3245930_3246368_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3246354_3246672_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_171878023.1|3246625_3246943_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	91.3	4.6e-42
WP_001310212.1|3246932_3247235_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3247231_3247513_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3247545_3248262_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3248295_3248838_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3248749_3249787_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_171878024.1|3249855_3250281_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3250264_3250588_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3250712_3251189_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3251504_3251657_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3251771_3252287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3252419_3252809_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3252870_3253140_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3253108_3254227_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3254393_3255188_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3255184_3256231_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3256386_3257208_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3263865:3263885	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	3508782	3564266	5512933	capsid,transposase,terminase,tail,head,integrase,holin,protease,portal	Stx2-converting_phage(24.44%)	64	3510717:3510732	3566031:3566046
WP_000003653.1|3508782_3509370_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3509366_3510074_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3510092_3511886_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3510717:3510732	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3511882_3513001_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3515133_3515403_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_171878033.1|3515404_3516718_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.7	6.7e-79
WP_001230508.1|3516782_3517382_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171878034.1|3517449_3520923_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.3	0.0e+00
WP_000649829.1|3521056_3521584_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3521774_3522407_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_171878035.1|3522352_3523096_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.8	2.8e-146
WP_001151105.1|3523106_3523805_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3523804_3524134_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_171878036.1|3524130_3524895_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.1	2.0e-128
WP_171878037.1|3524846_3526709_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.8	7.4e-265
WP_000533402.1|3526689_3527103_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3527129_3527561_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3527574_3528315_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3528296_3528563_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3528620_3528968_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3529004_3530510_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_171877995.1|3530499_3532092_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	2.5e-181
WP_000259002.1|3532088_3532295_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3532278_3534207_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|3534470_3536009_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3536058_3536406_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3536402_3536783_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_070081091.1|3536858_3537134_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3537884_3538091_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3538346_3538619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3538778_3539312_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3539532_3539646_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3539867_3540053_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3540580_3540895_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3541099_3542313_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3542488_3544339_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3545106_3545820_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3546440_3547259_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3547410_3547782_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3547771_3548143_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3548155_3549205_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3549206_3549485_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3549652_3549808_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3549909_3550047_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3550412_3551186_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3551537_3551951_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3551966_3552737_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3552758_3553505_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3553511_3554603_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3554681_3555137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3555343_3555769_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3555752_3556025_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3556133_3556535_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3556562_3556754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3556753_3557041_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3557318_3557474_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3557615_3558005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3558191_3558377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3558950_3559139_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3559135_3559327_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3559420_3561892_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3561959_3562202_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3562179_3563199_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3563606_3564266_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3566031:3566046	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	3795194	3834607	5512933	transposase,terminase,tail,integrase,holin,protease,lysis,portal	Enterobacteria_phage(52.38%)	49	3794779:3794793	3834681:3834695
3794779:3794793	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3795194_3795893_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3796123_3797005_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3797174_3797336_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3797832_3798852_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3798885_3799866_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3800042_3800312_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3800313_3801630_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_171878042.1|3801689_3802289_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	4.7e-104
WP_171878043.1|3802359_3805773_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
WP_000090841.1|3805833_3806442_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3806378_3807122_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3807127_3807826_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3807835_3808165_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3808164_3811230_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3811201_3811531_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3811539_3811926_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3811986_3812730_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3812740_3813142_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3813138_3813717_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3813728_3814004_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3813996_3814320_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3814406_3816434_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3816378_3816714_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3816835_3817960_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3817887_3818100_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3818096_3820199_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_162829202.1|3820547_3821760_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001139679.1|3822677_3822830_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3822817_3823285_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3823281_3823779_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3823778_3823994_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3824136_3824535_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3824615_3824774_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3824859_3825603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3825786_3826476_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3826490_3826613_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3826950_3827910_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3828121_3828787_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3828783_3829404_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3829396_3829567_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3829563_3829746_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3830443_3831124_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3831120_3831303_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3831275_3831467_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3831477_3831759_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3831857_3832079_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3832289_3832892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3833134_3833302_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_171878044.1|3833341_3834607_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.2	2.5e-200
3834681:3834695	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	4377758	4431599	5512933	transposase,tail	Enterobacteria_phage(28.57%)	54	NA	NA
WP_000998048.1|4377758_4379297_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4379346_4379694_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4379690_4380071_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4380334_4380598_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4380597_4380738_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4380807_4380999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4381823_4382366_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4382440_4383028_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4383085_4383754_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4383779_4386305_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4386294_4387938_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4387906_4388617_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4388929_4389259_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4389506_4390121_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4390538_4391228_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4391224_4392181_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4392177_4394376_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4394385_4395342_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4395520_4396648_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4396789_4397848_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4398093_4398996_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4399698_4399977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4400143_4400866_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4400964_4401864_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4402539_4403496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4403628_4405962_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4405975_4406299_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4406298_4406520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4406516_4407074_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4407070_4407331_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4408264_4409017_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4409013_4409565_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4409570_4409843_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4410252_4410819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4410818_4411409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4411439_4412072_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4412064_4412523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4412522_4413140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053905173.1|4413112_4413508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|4413577_4414790_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000246059.1|4416219_4416963_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4417786_4418560_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4418617_4419172_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4419201_4419612_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_136760493.1|4421196_4421787_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.2e-54
WP_001096963.1|4421786_4422581_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4422580_4422892_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4423843_4424137_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4424255_4424456_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4424556_4425270_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_162829202.1|4426375_4427588_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303805.1|4427915_4428161_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4429230_4430484_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4430495_4431599_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
>prophage 15
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	4451728	4477039	5512933	transposase,plate	uncultured_Caudovirales_phage(75.0%)	20	NA	NA
WP_000027427.1|4451728_4452901_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4452981_4453167_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4453081_4453345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4453546_4455307_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4455309_4456446_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001476815.1|4457191_4457785_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339420.1|4457853_4459362_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_171878080.1|4459543_4460260_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000509129.1|4460399_4464632_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103125.1|4464707_4466849_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4467058_4467577_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4468273_4468774_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4468808_4469033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4469083_4470475_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4470565_4470979_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4470982_4472833_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4472796_4473879_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4473903_4475184_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4475180_4475705_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4475707_4477039_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 16
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	4915091	4974119	5512933	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4915091_4916444_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4916537_4917089_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4917244_4918618_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4918793_4919792_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4919824_4920820_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4920806_4921829_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4921842_4923345_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4923484_4924441_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4924750_4925281_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4925360_4925711_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4925704_4925956_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4926167_4926509_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4926511_4930291_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4930287_4932021_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4932226_4932865_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4933187_4934531_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4934626_4934833_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4935157_4935712_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4935774_4936713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4936924_4937665_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4937854_4939798_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4939915_4940296_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4940384_4941245_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4941352_4942318_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4942425_4943088_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4943132_4944545_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4944853_4945474_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4945691_4946330_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4946464_4947673_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4947680_4948112_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4948734_4949529_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4949599_4950049_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4950090_4950318_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4950322_4950637_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4950643_4951039_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4951365_4951641_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4951769_4952456_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4952455_4953310_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4953319_4953970_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4953983_4954448_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4954457_4954763_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001295191.1|4956530_4957595_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4957702_4958458_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4958454_4959204_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4959385_4959715_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4959863_4960139_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4960255_4961881_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4961964_4963128_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4963130_4963769_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4963778_4964177_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4964194_4964854_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4964904_4965603_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4965621_4966023_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4966149_4966881_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4967061_4969503_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4969541_4969967_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4970171_4971470_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4971573_4971771_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4971852_4972857_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4972859_4974119_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 17
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	5111005	5125670	5512933	integrase,tRNA,tail	Enterobacteria_phage(43.75%)	19	5106846:5106861	5124375:5124390
5106846:5106861	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5111005_5112421_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5112503_5113487_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5113652_5113895_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5114028_5115066_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5115154_5116252_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5116313_5116562_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5116722_5117364_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5117445_5118075_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5118147_5118720_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5118831_5119101_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5119102_5120416_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5120480_5121080_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5122401_5122938_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5122928_5123279_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5123275_5123560_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5123895_5124093_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5124437_5124719_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5124375:5124390	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5124766_5124940_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5125136_5125670_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 18
NZ_CP038282	Escherichia coli O157:H7 strain F8492 chromosome, complete genome	5512933	5278203	5328820	5512933	capsid,terminase,tail,head,integrase,holin,protease,lysis,portal,plate	Escherichia_phage(50.0%)	64	5295633:5295679	5326032:5326078
WP_000208242.1|5278203_5278734_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|5278743_5280075_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001308187.1|5280141_5281068_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|5281160_5281646_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001301616.1|5281705_5282380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000232687.1|5282502_5283129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296623.1|5283167_5283413_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|5283838_5284684_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|5284706_5286215_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250658.1|5286444_5287455_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796310.1|5287551_5288298_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|5288302_5288731_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|5288757_5289057_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|5289268_5289709_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|5289809_5290409_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|5290516_5291284_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_112979055.1|5291338_5292094_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045681.1|5292200_5293190_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|5293508_5294471_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|5294651_5295554_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
5295633:5295679	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|5295790_5296009_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882927.1|5296090_5297254_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	96.9	5.0e-203
WP_000978907.1|5297253_5297733_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069918.1|5297747_5300195_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	91.7	0.0e+00
WP_000785970.1|5300187_5300307_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|5300339_5300615_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|5300671_5301190_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_171878069.1|5301202_5302393_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	1.2e-223
WP_000905105.1|5302452_5303046_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	3.3e-102
WP_001127577.1|5303076_5303481_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	43.1	5.5e-16
WP_000639074.1|5303489_5303885_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_001008235.1|5303856_5304300_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	1.2e-80
WP_115915210.1|5304320_5305520_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	96.5	7.7e-215
WP_001285307.1|5305516_5306128_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
WP_001121488.1|5306120_5307029_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	3.7e-161
WP_000127163.1|5307033_5307381_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093730.1|5307377_5308013_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	9.3e-111
WP_001001810.1|5308079_5308532_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_000917144.1|5308524_5308992_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|5308954_5309128_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|5309099_5309525_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|5309512_5309938_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|5309952_5310450_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|5310449_5310731_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846406.1|5310734_5310938_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|5310937_5311447_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203461.1|5311546_5312290_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.4	8.6e-124
WP_001248539.1|5312293_5313367_-|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	99.2	4.3e-201
WP_001085953.1|5313425_5314280_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_000156861.1|5314453_5316226_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038188.1|5316225_5317260_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_000423599.1|5317690_5319898_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_171878070.1|5320128_5322417_-	replication endonuclease	NA	Q858T4	Yersinia_virus	95.8	0.0e+00
WP_000027664.1|5322406_5322682_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|5322678_5322903_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|5322905_5323205_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|5323204_5323429_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|5323492_5323993_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|5324162_5324435_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|5324571_5324865_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|5324934_5325915_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|5326101_5326602_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
5326032:5326078	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|5326751_5327450_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|5327446_5328820_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP038283	Escherichia coli O157:H7 strain F8492 plasmid pF8492-1, complete sequence	93247	19657	32464	93247	integrase,transposase	Stx2-converting_phage(42.86%)	14	16525:16539	40347:40361
16525:16539	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000987091.1|19657_21778_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|21781_23221_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|23964_24195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|24328_25867_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|25916_26264_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|26260_26641_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001066920.1|26765_27506_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|27790_28768_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|29175_29376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|29372_29993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|29989_30673_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|31131_31350_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|31351_31657_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|31657_32464_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
40347:40361	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
