The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053607	Escherichia coli strain NEB5-alpha_F chromosome, complete genome	4585413	248974	288575	4585413	transposase	Streptococcus_phage(16.67%)	41	NA	NA
WP_000006255.1|248974_249472_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|249695_251435_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|251379_252165_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|252235_253291_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|253342_253636_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|253638_254037_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|254046_254499_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|254804_255071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352051.1|254982_255540_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|255596_257054_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|257314_257773_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|257864_259109_+	esterase FrsA	NA	NA	NA	NA	NA
WP_001339197.1|259481_260690_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001352368.1|261663_262872_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001285288.1|263625_264729_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|264740_265994_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000854672.1|266565_266907_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|266927_267245_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|267263_267485_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|267493_267970_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|267985_268444_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|268541_268781_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|268857_269325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|269347_269791_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|269790_270018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|270421_271243_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|271334_272198_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|272526_273420_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|273840_274992_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|277338_278355_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_171814952.1|278622_278922_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000044314.1|278918_279869_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|279865_280879_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000107627.1|281456_282668_+	3-(3-hydroxy-phenyl)propionate transporter	NA	NA	NA	NA	NA
WP_001096705.1|282769_283309_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000419081.1|283532_284366_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842106.1|284459_285569_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
WP_001141271.1|285603_285879_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000596084.1|286065_286839_-	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000012218.1|286840_287284_-	transferase	NA	NA	NA	NA	NA
WP_088895425.1|287347_288575_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 2
NZ_CP053607	Escherichia coli strain NEB5-alpha_F chromosome, complete genome	4585413	424412	480743	4585413	tRNA,terminase,transposase,protease,lysis	Enterobacteria_phage(43.75%)	52	NA	NA
WP_001295836.1|424412_425036_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|425006_425693_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|425689_428104_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|428534_432815_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|432854_433223_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|433913_434174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297301.1|434230_434404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|435405_436500_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|436568_437495_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|437724_438207_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|438284_439100_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|439189_440971_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|440983_441760_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|441859_442738_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|442906_444361_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|444420_445782_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|445838_447140_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|447161_448307_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|448534_449320_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|449330_450566_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|450587_451637_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|451953_453621_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|453630_454890_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|454900_455716_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|455712_456606_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|456800_457868_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|457864_458374_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|458491_459214_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|459216_459711_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|459884_461270_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|461305_461827_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|461934_462147_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|462148_463015_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|463485_464028_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|464247_464940_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|464970_467574_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|467552_468593_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|468603_469119_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|469121_469754_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_010723085.1|471248_472265_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000839596.1|472507_472723_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|472722_473220_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|473436_473619_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|473709_474003_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|474293_474704_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|474989_475196_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|475360_475555_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|475943_476489_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|476463_477207_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_026089880.1|477261_477888_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|478790_479540_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201845.1|479789_480743_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 3
NZ_CP053607	Escherichia coli strain NEB5-alpha_F chromosome, complete genome	4585413	1096425	1109746	4585413	plate,transposase,tail,portal	Shigella_phage(37.5%)	20	NA	NA
WP_085947771.1|1096425_1097587_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000939945.1|1098536_1098782_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1098818_1099130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1099246_1099588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1099525_1099834_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1100008_1100683_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1100773_1100974_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1101017_1101575_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1101750_1101930_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1101919_1103287_+	helix-turn-helix domain-containing protein	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1103298_1103481_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1103480_1103954_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1103880_1104672_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1104662_1105247_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_149025301.1|1105250_1105877_+	hypothetical protein	NA	U5P0I1	Shigella_phage	95.4	1.1e-52
WP_024184299.1|1106861_1107356_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1107427_1107982_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1108088_1108922_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|1109155_1109320_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1109422_1109746_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
>prophage 4
NZ_CP053607	Escherichia coli strain NEB5-alpha_F chromosome, complete genome	4585413	1208094	1236998	4585413	terminase,head,portal,integrase,lysis,holin	Enterobacteria_phage(97.3%)	40	1203839:1203854	1246143:1246158
1203839:1203854	attL	TCTACCACAATCCACT	NA	NA	NA	NA
WP_000627155.1|1208094_1209288_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
WP_024168593.1|1209523_1209763_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	100.0	1.1e-37
WP_000148438.1|1210647_1210800_-	DUF1317 family protein	NA	NA	NA	NA	NA
WP_000831730.1|1210796_1211225_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	100.0	9.5e-75
WP_000187057.1|1211221_1211902_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	100.0	1.3e-131
WP_000059964.1|1211898_1212816_-	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	100.0	1.1e-171
WP_000995354.1|1212825_1213107_-	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	100.0	1.3e-48
WP_000005775.1|1213114_1214083_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	100.0	1.8e-97
WP_000448252.1|1214187_1215024_-	zf-TFIIB domain-containing protein	NA	M9NYX5	Enterobacteria_phage	100.0	6.2e-155
WP_000607102.1|1215034_1215244_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	100.0	4.7e-35
WP_000218995.1|1215240_1215399_-	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	100.0	6.9e-23
WP_001281305.1|1215400_1215610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564503.1|1215765_1216062_-	hypothetical protein	NA	M9P0E2	Enterobacteria_phage	100.0	3.1e-48
WP_000362427.1|1216619_1216829_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	87.5	7.0e-23
WP_000432054.1|1216859_1217726_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	100.0	3.5e-153
WP_012305467.1|1217862_1218573_-	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	100.0	1.8e-134
WP_000608751.1|1218690_1218912_+	helix-turn-helix domain-containing protein	NA	M9NZA8	Enterobacteria_phage	100.0	3.5e-33
WP_000555791.1|1218942_1219485_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	100.0	1.6e-95
WP_000072106.1|1219570_1220479_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	100.0	1.2e-159
WP_000838083.1|1220475_1221165_+	hypothetical protein	NA	M9NYX7	Enterobacteria_phage	100.0	8.8e-131
WP_000586532.1|1222168_1222624_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	100.0	5.7e-86
WP_000106777.1|1222623_1222794_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	100.0	1.1e-23
WP_000063208.1|1222790_1223459_+	serine/threonine protein phosphatase	NA	M9P0E4	Enterobacteria_phage	100.0	2.3e-131
WP_001231139.1|1223451_1224093_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	100.0	2.4e-114
WP_048813386.1|1224089_1224296_+	Lar family restriction alleviation protein	NA	M9NZE6	Enterobacteria_phage	100.0	2.4e-36
WP_085903671.1|1224292_1224409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047620.1|1224408_1225218_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	100.0	2.3e-154
WP_000286101.1|1225696_1225921_+|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	100.0	1.9e-34
WP_001070143.1|1225898_1226393_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	100.0	1.3e-91
WP_012305470.1|1226389_1226848_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	100.0	2.2e-77
WP_001064347.1|1227046_1227565_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	100.0	2.9e-94
WP_001446081.1|1227636_1228233_-	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	100.0	9.7e-110
WP_000509882.1|1228623_1229352_+	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	100.0	8.7e-121
WP_000453624.1|1229599_1230145_+|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
WP_001027236.1|1230119_1232042_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	100.0	0.0e+00
WP_000235412.1|1232041_1232248_+	gpW family protein	NA	E4WL20	Enterobacteria_phage	100.0	5.8e-30
WP_000701345.1|1232244_1233837_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	100.0	1.3e-310
WP_000929806.1|1233817_1235161_+	S49 family peptidase	NA	E4WL22	Enterobacteria_phage	100.0	1.3e-215
WP_001018610.1|1235170_1235503_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	100.0	9.0e-57
WP_000118199.1|1235570_1236998_+	cyanase	NA	K7PGW9	Enterobacteria_phage	99.7	2.3e-181
1246143:1246158	attR	AGTGGATTGTGGTAGA	NA	NA	NA	NA
>prophage 5
NZ_CP053607	Escherichia coli strain NEB5-alpha_F chromosome, complete genome	4585413	1341774	1383791	4585413	tRNA,transposase,lysis,tail	Escherichia_phage(46.88%)	43	NA	NA
WP_010723085.1|1341774_1342791_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000605090.1|1343063_1343321_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1343370_1344321_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_046613418.1|1344472_1345225_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_010723085.1|1345324_1346341_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000945011.1|1346618_1347134_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1347144_1348671_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_000444929.1|1350152_1351463_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_046613434.1|1351638_1352547_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1352876_1353440_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1353460_1354693_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1354947_1355931_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1356408_1357782_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1357910_1358846_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1358897_1360133_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1360134_1360350_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1360428_1360638_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1360630_1360825_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1360881_1361691_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1361683_1364284_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1364385_1364661_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1364735_1364906_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1364905_1365127_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_046613436.1|1365568_1366057_+	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1366053_1366209_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1366662_1367139_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1367262_1367559_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1367581_1368004_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1368016_1368874_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1368880_1369627_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1369649_1370210_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1370297_1370483_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1370679_1372137_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1372274_1372538_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1372518_1372878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046613426.1|1374643_1375624_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
WP_071885698.1|1375946_1379309_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1379308_1379884_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1379981_1380572_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1380888_1381122_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1381190_1381304_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1382082_1382517_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1382657_1383791_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 6
NZ_CP053607	Escherichia coli strain NEB5-alpha_F chromosome, complete genome	4585413	1576349	1595559	4585413	lysis,tail	Enterobacteria_phage(40.91%)	36	NA	NA
WP_000527743.1|1576349_1577810_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1577898_1579182_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1579786_1579900_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1579968_1580202_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1580518_1581109_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1581206_1581782_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1581781_1582744_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1582694_1583264_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1583652_1583886_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1583943_1584354_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1584505_1584679_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1584850_1585006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1585084_1585150_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1585152_1585341_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1585351_1585564_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1585926_1586424_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1586420_1586954_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1586950_1587262_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1587266_1587482_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1588235_1588451_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1588751_1588964_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1589018_1589108_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_151275831.1|1589198_1589384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|1589384_1590137_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1590150_1591200_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1591201_1591480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1591546_1591798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1592014_1592170_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1592241_1592529_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1592528_1592768_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1592792_1593098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1593300_1593633_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1594069_1594219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1594515_1594746_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1594829_1595237_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1595403_1595559_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 7
NZ_CP053607	Escherichia coli strain NEB5-alpha_F chromosome, complete genome	4585413	2413700	2424910	4585413	integrase,tail	Enterobacteria_phage(53.33%)	16	2411675:2411691	2428585:2428601
2411675:2411691	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2413700_2414633_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2414944_2416102_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2416254_2416617_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2416613_2417534_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2417530_2418862_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2418896_2419178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2419476_2419917_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2419943_2420462_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2420511_2420787_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2420786_2421281_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2422003_2422366_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2422431_2423256_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2423383_2423920_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2423910_2424273_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2424272_2424578_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2424709_2424910_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2428585:2428601	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP053607	Escherichia coli strain NEB5-alpha_F chromosome, complete genome	4585413	2798701	2805840	4585413		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2798701_2801263_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2801368_2802025_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2802075_2802843_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2803038_2803947_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2803943_2805110_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2805201_2805840_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP053608	Escherichia coli strain NEB5-alpha_F plasmid F'Iq, complete sequence	242042	3507	57949	242042	transposase,integrase	Streptococcus_phage(15.38%)	53	17993:18052	52301:52360
WP_000006255.1|3507_4005_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|4228_5968_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|5912_6698_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|6768_7824_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	27.3	4.4e-12
WP_000554758.1|7875_8169_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|8171_8570_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|8579_9032_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|9337_9604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352051.1|9515_10073_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|10129_11587_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|11847_12306_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|12397_13642_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|13699_14101_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|14139_15195_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|15482_16586_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|16597_17851_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
17993:18052	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|18422_18764_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|18784_19102_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|19120_19342_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	41.7	3.7e-06
WP_000811693.1|19350_19827_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|19842_20301_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000194654.1|20398_20638_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|20714_21182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|21204_21648_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|21647_21875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|22278_23100_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|23191_24055_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|24383_25277_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|25697_26849_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|29195_30212_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|30419_31823_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|31809_32742_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|32850_33897_-	ferric ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.9	8.4e-08
WP_000015532.1|35118_35457_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|35479_35830_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|35923_37078_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|37372_38281_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|38295_40263_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|40489_41872_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|41883_43494_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|43498_44257_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|44395_45400_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|46594_47326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|47416_48043_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|48314_49013_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|49039_49894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|50012_50237_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|50233_50674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|50790_52191_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|52475_52886_-	hypothetical protein	NA	NA	NA	NA	NA
52301:52360	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000121359.1|52864_53821_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|53830_56029_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_001339197.1|56740_57949_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 2
NZ_CP053608	Escherichia coli strain NEB5-alpha_F plasmid F'Iq, complete sequence	242042	64464	127148	242042	protease,transposase,integrase	Acinetobacter_phage(27.27%)	45	71575:71588	131172:131185
WP_006250222.1|64464_65673_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	3.0e-235
WP_171831301.1|66134_66824_-	aldehyde dehydrogenase iron-sulfur subunit	NA	A0A0P0IVM8	Acinetobacter_phage	34.3	9.4e-16
WP_001019920.1|67241_67856_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|68103_68433_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|68745_69456_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|69424_71068_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|71057_73583_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
71575:71588	attL	AATATCACCCCAGC	NA	NA	NA	NA
WP_000716398.1|73608_74277_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|74334_74922_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|74996_75539_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|76362_76590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|76624_76765_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|76764_77028_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|77391_77493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|79541_80703_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001345829.1|81036_81225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000802277.1|81689_82001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001362723.1|82344_82551_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083834.1|82834_83092_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001442103.1|83325_83400_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000422420.1|83778_85875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235704.1|85890_86442_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	81.8	1.7e-76
WP_171831302.1|86605_89614_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.4	0.0e+00
WP_001092154.1|90204_91266_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001351580.1|91375_91789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351581.1|91952_92417_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_000483319.1|92522_92936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131420.1|93538_93727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085955200.1|94633_95795_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	4.4e-50
WP_088895425.1|97148_98377_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000286435.1|99571_100264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064753882.1|101016_103923_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000995793.1|106961_111077_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.1	1.6e-126
WP_001193612.1|111797_112745_+|protease	omptin family outer membrane protease OmpP	protease	NA	NA	NA	NA
WP_072145210.1|112849_114337_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001066941.1|115093_115834_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361610.1|116118_117096_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_000990665.1|117935_118577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538310.1|120691_120982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963206.1|120971_121871_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000698737.1|121920_124146_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
WP_000952217.1|124147_125236_-	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000813634.1|125815_126034_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|126035_126341_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|126341_127148_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
131172:131185	attR	GCTGGGGTGATATT	NA	NA	NA	NA
