The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053604	Escherichia coli strain NEB10-beta chromosome, complete genome	4667764	223076	264777	4667764	transposase	Streptococcus_phage(20.0%)	41	NA	NA
WP_000006255.1|223076_223574_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|223797_225537_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|225481_226267_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|226337_227393_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|227444_227738_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|227740_228139_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|228148_228601_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|228906_229173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352051.1|229084_229642_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|229698_231156_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|231416_231875_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|231966_233211_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|233268_233670_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|233708_234764_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|235051_236155_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|236166_237420_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000854672.1|237991_238333_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|238353_238671_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|238689_238911_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|238919_239396_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|239411_239870_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|239967_240207_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|240283_240751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|240773_241217_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|241216_241444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|241847_242669_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|242760_243624_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|243952_244846_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|245266_246418_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|248764_249781_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|249988_251392_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|251378_252311_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|252419_253466_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|254687_255026_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|255048_255399_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|255492_256647_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|256941_257850_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|257864_259832_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|260058_261441_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|261452_263063_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_085947770.1|263408_264777_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 2
NZ_CP053604	Escherichia coli strain NEB10-beta chromosome, complete genome	4667764	271805	332791	4667764	holin,transposase,integrase	Acinetobacter_phage(30.0%)	54	271085:271098	290587:290600
271085:271098	attL	CCAGTAATGGCGGC	NA	NA	NA	NA
WP_001407714.1|271805_273206_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|273490_273901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|273879_274836_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|274845_277044_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|277040_277997_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070700.1|277993_278683_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|279100_279715_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|279962_280292_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|280604_281315_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|281283_282927_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|282916_285442_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716398.1|285467_286136_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|286193_286781_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|286855_287398_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|288221_288449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|288483_288624_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|288623_288887_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|289250_289352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|291400_292562_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
290587:290600	attR	CCAGTAATGGCGGC	NA	NA	NA	NA
WP_001299021.1|293835_294429_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|294440_294677_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|294785_296111_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339594.1|296336_297191_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102108.1|297717_298437_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|298447_299875_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370307.1|299867_300563_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|300805_301474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|301686_303357_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|303370_304843_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|304856_305444_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|305572_307606_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_120795374.1|307911_307986_+	protein YahV	NA	NA	NA	NA	NA
WP_001301264.1|308480_309569_+	DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL	NA	NA	NA	NA	NA
WP_001084394.1|309610_310543_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001013892.1|310634_311132_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_000023635.1|311389_311995_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001310582.1|312034_312898_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000111836.1|312887_314435_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000083430.1|314434_316561_+	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_001096705.1|316662_317202_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000419081.1|317425_318259_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842106.1|318352_319462_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
WP_001141271.1|319496_319772_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000596084.1|319958_320732_-	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000012218.1|320733_321177_-	transferase	NA	NA	NA	NA	NA
WP_088895425.1|321240_322468_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000860444.1|322628_323825_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001018417.1|325121_326084_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000939375.1|326096_326864_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
WP_000114620.1|326860_327688_+	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000004027.1|327684_328536_+	taurine dioxygenase	NA	NA	NA	NA	NA
WP_001295337.1|328642_329617_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000556438.1|330140_331601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|331628_332791_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 3
NZ_CP053604	Escherichia coli strain NEB10-beta chromosome, complete genome	4667764	460227	523186	4667764	lysis,terminase,tRNA,transposase,protease,integrase	Enterobacteria_phage(50.0%)	66	505844:505890	527123:527169
WP_001295836.1|460227_460851_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|460821_461508_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|461504_463919_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|464349_468630_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|468669_469038_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|469728_469989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297301.1|470045_470219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|471220_472315_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|472383_473310_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|473539_474022_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|474099_474915_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|475004_476786_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|476798_477575_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|477674_478553_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|478721_480176_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|480235_481597_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|481653_482955_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|482976_484122_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|484349_485135_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|485145_486381_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|486402_487452_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|487768_489436_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|489445_490705_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|490715_491531_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|491527_492421_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|492615_493683_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|493679_494189_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|494306_495029_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|495031_495526_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|495699_497085_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|497120_497642_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|497749_497962_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|497963_498830_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|499300_499843_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|500062_500755_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|500785_503389_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|503367_504408_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|504418_504934_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|504936_505569_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
505844:505890	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|505903_507067_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|507186_507450_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|507772_507868_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|507930_509092_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|509403_509736_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|509783_509933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|509990_511517_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|511981_512533_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|512542_513340_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|513456_513558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|513554_514010_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|514009_514180_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|514172_514463_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|514459_514822_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|514818_514959_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|515044_515428_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|515825_516842_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|516846_517914_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|518486_518702_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|518701_519199_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|519415_519598_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|519688_519982_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|520272_520683_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|520968_521175_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|521339_521534_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|521922_522468_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|522442_523186_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
527123:527169	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 4
NZ_CP053604	Escherichia coli strain NEB10-beta chromosome, complete genome	4667764	625595	636556	4667764	terminase,lysis,transposase	Enterobacteria_phage(66.67%)	15	NA	NA
WP_000631384.1|625595_626321_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_000272824.1|626320_626995_-	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_000020941.1|626994_627735_-	glutamate/aspartate ABC transporter permease GltJ	NA	NA	NA	NA	NA
WP_001177086.1|627904_628813_-	glutamate/aspartate ABC transporter substrate-binding protein GltI	NA	NA	NA	NA	NA
WP_010723085.1|629195_630212_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|630216_631284_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|631856_632072_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|632071_632569_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|632785_632968_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|633058_633352_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|633642_634053_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|634338_634545_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|634709_634904_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|635292_635838_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|635812_636556_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
>prophage 5
NZ_CP053604	Escherichia coli strain NEB10-beta chromosome, complete genome	4667764	1352434	1381338	4667764	head,portal,lysis,terminase,holin,integrase	Enterobacteria_phage(97.3%)	40	1348179:1348194	1390483:1390498
1348179:1348194	attL	TCTACCACAATCCACT	NA	NA	NA	NA
WP_000627155.1|1352434_1353628_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
WP_024168593.1|1353863_1354103_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	100.0	1.1e-37
WP_000148438.1|1354987_1355140_-	DUF1317 family protein	NA	NA	NA	NA	NA
WP_000831730.1|1355136_1355565_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	100.0	9.5e-75
WP_000187057.1|1355561_1356242_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	100.0	1.3e-131
WP_000059964.1|1356238_1357156_-	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	100.0	1.1e-171
WP_000995354.1|1357165_1357447_-	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	100.0	1.3e-48
WP_000005775.1|1357454_1358423_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	100.0	1.8e-97
WP_000448252.1|1358527_1359364_-	zf-TFIIB domain-containing protein	NA	M9NYX5	Enterobacteria_phage	100.0	6.2e-155
WP_000607102.1|1359374_1359584_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	100.0	4.7e-35
WP_000218995.1|1359580_1359739_-	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	100.0	6.9e-23
WP_001281305.1|1359740_1359950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564503.1|1360105_1360402_-	hypothetical protein	NA	M9P0E2	Enterobacteria_phage	100.0	3.1e-48
WP_000362427.1|1360959_1361169_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	87.5	7.0e-23
WP_000432054.1|1361199_1362066_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	100.0	3.5e-153
WP_012305467.1|1362202_1362913_-	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	100.0	1.8e-134
WP_000608751.1|1363030_1363252_+	helix-turn-helix domain-containing protein	NA	M9NZA8	Enterobacteria_phage	100.0	3.5e-33
WP_000555791.1|1363282_1363825_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	100.0	1.6e-95
WP_000072106.1|1363910_1364819_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	100.0	1.2e-159
WP_000838083.1|1364815_1365505_+	hypothetical protein	NA	M9NYX7	Enterobacteria_phage	100.0	8.8e-131
WP_000586532.1|1366508_1366964_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	100.0	5.7e-86
WP_000106777.1|1366963_1367134_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	100.0	1.1e-23
WP_000063208.1|1367130_1367799_+	serine/threonine protein phosphatase	NA	M9P0E4	Enterobacteria_phage	100.0	2.3e-131
WP_001231139.1|1367791_1368433_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	100.0	2.4e-114
WP_048813386.1|1368429_1368636_+	Lar family restriction alleviation protein	NA	M9NZE6	Enterobacteria_phage	100.0	2.4e-36
WP_085903671.1|1368632_1368749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047620.1|1368748_1369558_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	100.0	2.3e-154
WP_000286101.1|1370036_1370261_+|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	100.0	1.9e-34
WP_001070143.1|1370238_1370733_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	100.0	1.3e-91
WP_012305470.1|1370729_1371188_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	100.0	2.2e-77
WP_001064347.1|1371386_1371905_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	100.0	2.9e-94
WP_001446081.1|1371976_1372573_-	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	100.0	9.7e-110
WP_000509882.1|1372963_1373692_+	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	100.0	8.7e-121
WP_000453624.1|1373939_1374485_+|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
WP_001027236.1|1374459_1376382_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	100.0	0.0e+00
WP_000235412.1|1376381_1376588_+	gpW family protein	NA	E4WL20	Enterobacteria_phage	100.0	5.8e-30
WP_000701345.1|1376584_1378177_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	100.0	1.3e-310
WP_000929806.1|1378157_1379501_+	S49 family peptidase	NA	E4WL22	Enterobacteria_phage	100.0	1.3e-215
WP_001018610.1|1379510_1379843_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	100.0	9.0e-57
WP_000118199.1|1379910_1381338_+	cyanase	NA	K7PGW9	Enterobacteria_phage	99.7	2.3e-181
1390483:1390498	attR	AGTGGATTGTGGTAGA	NA	NA	NA	NA
>prophage 6
NZ_CP053604	Escherichia coli strain NEB10-beta chromosome, complete genome	4667764	1486114	1528130	4667764	tRNA,lysis,transposase,tail	Escherichia_phage(46.67%)	42	NA	NA
WP_010723085.1|1486114_1487131_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000605090.1|1487403_1487661_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1487710_1488661_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1488812_1489565_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1489759_1490275_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1490285_1491812_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1491848_1493294_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1493293_1494604_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1494779_1495688_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1496017_1496581_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1496601_1497834_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1498088_1499072_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1499549_1500923_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1501051_1501987_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1502038_1503274_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1503275_1503491_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1503569_1503779_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1503771_1503966_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1504022_1504832_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1504824_1507425_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1507526_1507802_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1507876_1508047_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1508046_1508268_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1508709_1509198_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1509194_1509350_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1509803_1510280_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1510403_1510700_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1510722_1511145_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000788970.1|1512020_1512767_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1512789_1513350_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1513437_1513623_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1513819_1515277_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1515414_1515678_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1515658_1516018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019451.1|1517783_1518764_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
WP_000279097.1|1519086_1522449_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1522448_1523024_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1523121_1523712_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1524028_1524262_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_010723085.1|1524416_1525433_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001300461.1|1526421_1526856_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1526996_1528130_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 7
NZ_CP053604	Escherichia coli strain NEB10-beta chromosome, complete genome	4667764	1719719	1764384	4667764	protease,lysis,transposase,tail	Enterobacteria_phage(30.0%)	61	NA	NA
WP_000527743.1|1719719_1721180_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1721268_1722552_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1723156_1723270_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1723338_1723572_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1723888_1724479_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1724576_1725152_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1725151_1726114_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1726064_1726634_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1727022_1727256_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1727313_1727724_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1727875_1728049_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1728220_1728376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1728454_1728520_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1728522_1728711_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1728721_1728934_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1729296_1729794_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1729790_1730324_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1730320_1730632_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1730636_1730852_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1731605_1731821_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1732121_1732334_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1732388_1732478_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1732755_1733508_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1733521_1734571_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1734572_1734851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1734917_1735169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1735385_1735541_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1735612_1735900_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1735899_1736139_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1736163_1736469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1736671_1737004_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1737440_1737590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1737886_1738117_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1738200_1738608_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1738774_1738930_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1739089_1739308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639039.1|1739311_1739476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1739875_1740064_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1740060_1740252_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_088895425.1|1742133_1743362_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001360138.1|1744330_1744441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1744498_1745518_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1745529_1746744_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1746949_1747276_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1747410_1747752_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1747786_1748347_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1748349_1749060_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1749167_1749473_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|1749671_1752098_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|1752158_1754582_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1754592_1755210_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1755211_1756066_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1756108_1756723_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071592181.1|1756881_1758174_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|1758126_1758822_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|1758946_1760167_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019525.1|1760301_1761195_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1761301_1762555_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743957.1|1762951_1763287_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233093.1|1763379_1763463_+	stationary phase-induced protein	NA	NA	NA	NA	NA
WP_001260865.1|1763562_1764384_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP053604	Escherichia coli strain NEB10-beta chromosome, complete genome	4667764	2198875	2207546	4667764		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2198875_2199979_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2199986_2201234_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2201230_2201788_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2201787_2202669_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2202726_2203626_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2203625_2204711_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2205083_2205977_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2206151_2207546_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 9
NZ_CP053604	Escherichia coli strain NEB10-beta chromosome, complete genome	4667764	2541194	2552404	4667764	tail,integrase	Enterobacteria_phage(53.33%)	16	2539169:2539185	2556079:2556095
2539169:2539185	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2541194_2542127_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2542438_2543596_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2543748_2544111_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2544107_2545028_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2545024_2546356_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2546390_2546672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2546970_2547411_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2547437_2547956_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2548005_2548281_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2548280_2548775_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2549497_2549860_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2549925_2550750_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2550877_2551414_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2551404_2551767_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2551766_2552072_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2552203_2552404_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2556079:2556095	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 10
NZ_CP053604	Escherichia coli strain NEB10-beta chromosome, complete genome	4667764	2933761	2940900	4667764		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2933761_2936323_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2936428_2937085_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2937135_2937903_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2938098_2939007_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2939003_2940170_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278991.1|2940261_2940900_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
>prophage 11
NZ_CP053604	Escherichia coli strain NEB10-beta chromosome, complete genome	4667764	3158091	3205897	4667764	tRNA,transposase,protease	Bluetongue_virus(33.33%)	41	NA	NA
WP_010723085.1|3158091_3159108_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000428766.1|3159145_3159391_-	hypothetical protein	NA	Q6QLL3	Human_immunodeficiency_virus	94.7	1.4e-14
WP_001239650.1|3159418_3159862_-	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000098614.1|3160175_3162167_-	transketolase	NA	NA	NA	NA	NA
WP_001326497.1|3162444_3163203_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|3163408_3164329_-	agmatinase	NA	NA	NA	NA	NA
WP_001300904.1|3164466_3166443_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3166451_3166583_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3166718_3166934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3167237_3168392_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_012775975.1|3168815_3170210_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001300769.1|3170286_3170784_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286501.1|3170878_3171586_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3171665_3172397_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3172409_3173360_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3173468_3174032_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3174031_3174448_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001326494.1|3174631_3175612_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3175629_3176334_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3176351_3176918_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000994920.1|3176914_3177205_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174777.1|3177212_3177806_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_000239943.1|3177798_3178935_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745210.1|3179089_3180097_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394140.1|3180213_3181260_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3181435_3182155_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3182338_3182665_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3182664_3183384_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|3183544_3184597_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3184624_3184900_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3184964_3186044_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001339197.1|3187016_3188225_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001333829.1|3191385_3192195_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001324279.1|3192260_3192671_+	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_000135077.1|3192688_3193684_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000942785.1|3194611_3195148_+	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
WP_000234514.1|3195477_3196185_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001326492.1|3196582_3198718_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001352368.1|3199476_3200685_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000259302.1|3202804_3204487_-	glycolate permease GlcA	NA	NA	NA	NA	NA
WP_006250222.1|3204688_3205897_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	3.0e-235
