The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053603	Escherichia coli strain Dam_Dcm chromosome, complete genome	4628041	248413	297097	4628041	integrase,transposase	Streptococcus_phage(20.0%)	49	262899:262958	297207:297266
WP_000006255.1|248413_248911_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|249134_250874_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|250818_251604_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|251674_252730_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|252781_253075_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|253077_253476_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|253485_253938_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|254243_254510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352051.1|254421_254979_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|255035_256493_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|256753_257212_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|257303_258548_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|258605_259007_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|259045_260101_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|260388_261492_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|261503_262757_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262899:262958	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|263328_263670_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|263690_264008_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|264026_264248_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|264256_264733_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|264748_265207_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|265304_265544_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|265620_266088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|266110_266554_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|266553_266781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|267184_268006_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|268097_268961_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|269289_270183_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|270603_271755_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|274101_275118_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|275325_276729_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|276715_277648_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|277756_278803_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|280024_280363_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|280385_280736_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|280829_281984_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|282278_283187_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|283201_285169_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|285395_286778_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|286789_288400_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|288404_289163_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|289301_290306_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|291500_292232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|292322_292949_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|293220_293919_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293945_294800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|294918_295143_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|295139_295580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|295696_297097_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
297207:297266	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP053603	Escherichia coli strain Dam_Dcm chromosome, complete genome	4628041	557502	608671	4628041	protease,tRNA,terminase,transposase,integrase	Enterobacteria_phage(45.45%)	53	567647:567693	585551:585597
WP_000912385.1|557502_558888_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|558923_559445_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|559552_559765_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|559766_560633_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|561103_561646_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|561865_562558_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|562588_565192_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|565170_566211_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|566221_566737_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|566739_567372_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
567647:567693	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|567706_568870_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|568989_569253_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|569575_569671_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|569733_570895_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|571206_571539_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|571586_571736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|571793_573320_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|573784_574336_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|574345_575143_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|575259_575361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|575357_575813_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|575812_575983_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|575975_576266_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|576262_576625_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|576621_576762_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|576847_577231_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|577628_578645_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000079503.1|578677_579088_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|579373_579580_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|579744_579939_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|580327_580873_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|580847_581591_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_071592175.1|581645_582272_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|583174_583924_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201845.1|584173_585127_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177471.1|585640_586402_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
585551:585597	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224604.1|586584_587475_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662357.1|587475_590448_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383932.1|590434_592672_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000253839.1|592821_594264_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000770953.1|594253_594937_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074234.1|595093_596467_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709870.1|596624_596957_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717157.1|596972_598196_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573945.1|598207_601351_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000786319.1|601452_602829_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153148.1|602909_604157_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351487.1|604264_604918_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|605011_605380_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682509.1|605444_605693_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130654.1|605758_606877_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956455.1|607329_607482_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|607558_608671_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP053603	Escherichia coli strain Dam_Dcm chromosome, complete genome	4628041	1390609	1454555	4628041	tRNA,tail,lysis,transposase	Escherichia_phage(38.71%)	59	NA	NA
WP_000628058.1|1390609_1391842_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1392096_1393080_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1393557_1394931_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1395059_1395995_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1396046_1397282_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1397283_1397499_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1397577_1397787_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1397779_1397974_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1398030_1398840_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1398832_1401433_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1401534_1401810_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1401884_1402055_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1402054_1402276_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1402717_1403206_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1403202_1403358_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1403811_1404288_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1404411_1404708_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1404730_1405153_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000788970.1|1406028_1406775_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1406797_1407358_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1407445_1407631_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1407827_1409285_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1409422_1409686_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1409666_1410026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1411791_1412772_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000279097.1|1413094_1416457_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1416456_1417032_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1417129_1417720_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1418036_1418270_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1418338_1418452_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1419230_1419665_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1419805_1420939_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|1421305_1424830_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1425103_1425370_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1425366_1425789_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|1425899_1426889_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_000900941.1|1427096_1429736_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1429732_1429918_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|1429925_1430252_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|1430423_1431329_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1431564_1433064_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|1433121_1435395_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|1435642_1437688_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|1437972_1438902_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1438913_1439201_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|1439209_1439956_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|1439970_1440468_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|1440475_1441546_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|1441542_1442310_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|1442309_1443098_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|1443099_1444527_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1444516_1444939_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|1444938_1446144_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|1446170_1447484_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|1447584_1448535_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|1448516_1449107_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|1449210_1449276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|1451966_1453195_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001254932.1|1453403_1454555_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 4
NZ_CP053603	Escherichia coli strain Dam_Dcm chromosome, complete genome	4628041	1613497	1632708	4628041	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1613497_1614958_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1615046_1616330_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1616934_1617048_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1617116_1617350_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1617666_1618257_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1618354_1618930_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1618929_1619892_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1619842_1620412_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1620800_1621034_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1621091_1621502_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1621653_1621827_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1621998_1622154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1622232_1622298_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1622300_1622489_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1622499_1622712_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1623074_1623572_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1623568_1624102_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1624098_1624410_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1624414_1624630_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1625383_1625599_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1625899_1626112_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1626166_1626256_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1626533_1627286_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1627299_1628349_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1628350_1628629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1628695_1628947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1629163_1629319_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1629390_1629678_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1629677_1629917_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1629941_1630247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1630449_1630782_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1631218_1631368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1631664_1631895_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1631978_1632386_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1632552_1632708_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 5
NZ_CP053603	Escherichia coli strain Dam_Dcm chromosome, complete genome	4628041	2148269	2156204	4628041	tRNA,transposase	Bacillus_phage(33.33%)	8	NA	NA
WP_000675150.1|2148269_2149673_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|2149669_2150392_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_001350529.1|2150582_2150915_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476011.1|2151061_2152423_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000468310.1|2152695_2152914_-	prophage transcriptional regulator OgrK	NA	Q6DW12	Phage_TP	100.0	4.7e-38
WP_001318299.1|2153382_2153700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723085.1|2153884_2154901_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000807348.1|2155304_2156204_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	2.8e-12
>prophage 6
NZ_CP053603	Escherichia coli strain Dam_Dcm chromosome, complete genome	4628041	2448610	2459820	4628041	tail,integrase	Enterobacteria_phage(53.33%)	16	2446585:2446601	2463495:2463511
2446585:2446601	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2448610_2449543_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2449854_2451012_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2451164_2451527_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2451523_2452444_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2452440_2453772_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2453806_2454088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2454386_2454827_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2454853_2455372_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2455421_2455697_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2455696_2456191_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2456913_2457276_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2457341_2458166_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2458293_2458830_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2458820_2459183_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2459182_2459488_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2459619_2459820_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2463495:2463511	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_CP053603	Escherichia coli strain Dam_Dcm chromosome, complete genome	4628041	2631175	2639389	4628041	transposase	Bluetongue_virus(16.67%)	9	NA	NA
WP_006250222.1|2631175_2632384_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	3.0e-235
WP_000133592.1|2632932_2634216_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|2634393_2634594_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|2634605_2634941_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|2634942_2636793_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|2636809_2637325_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2637420_2637744_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2637760_2638147_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2638174_2639389_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 8
NZ_CP053603	Escherichia coli strain Dam_Dcm chromosome, complete genome	4628041	2834950	2842089	4628041		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2834950_2837512_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2837617_2838274_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2838324_2839092_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2839287_2840196_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2840192_2841359_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2841450_2842089_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
