The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053336	Salmonella bongori serovar 48:z81:- strain 08-0158 chromosome, complete genome	4495420	882844	942023	4495420	integrase,holin,head,portal,protease,tail,transposase,capsid,terminase	Salmonella_phage(31.11%)	67	926672:926686	945451:945465
WP_042916819.1|882844_883975_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	97.3	2.6e-212
WP_024143218.1|887011_887584_-	T3SS effector NleG family protein	NA	NA	NA	NA	NA
WP_042916818.1|887955_889068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143216.1|889069_889327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079779069.1|889514_890495_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_171503591.1|890496_890679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171503592.1|890686_891811_+	replication initiation factor domain-containing protein	NA	Q64EV8	Vibrio_phage	35.3	1.7e-46
WP_038390658.1|891813_892134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141023718.1|892158_892383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038390657.1|892418_892643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141023719.1|892729_894412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141023720.1|894413_896114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079779073.1|896124_896415_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_079779074.1|896425_897526_+	hypothetical protein	NA	C3W4P0	Vibrio_phage	27.1	9.8e-07
WP_079779075.1|897522_898761_+	secretin	NA	NA	NA	NA	NA
WP_171503594.1|899171_899717_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_171503595.1|900239_901238_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	44.2	6.8e-15
WP_020843862.1|901343_904706_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.3	0.0e+00
WP_042916816.1|904768_905416_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	74.9	7.3e-87
WP_042916815.1|905313_906051_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.2	3.4e-128
WP_141023721.1|906109_906634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020843858.1|906718_907414_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	77.5	3.2e-104
WP_020843857.1|907423_907756_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.1	1.4e-38
WP_020843856.1|907759_911062_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	68.1	0.0e+00
WP_020843855.1|911312_911675_-	hypothetical protein	NA	Q6UAW8	Klebsiella_phage	56.8	7.4e-28
WP_020843854.1|911744_912218_-|tail	phage tail fiber	tail	Q6UAX0	Klebsiella_phage	78.7	3.2e-63
WP_020843853.1|912250_912652_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	87.2	1.3e-57
WP_020843852.1|912648_913038_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	73.8	8.1e-49
WP_020843851.1|913018_913363_-	hypothetical protein	NA	Q6UAX3	Klebsiella_phage	64.5	1.4e-36
WP_020843850.1|913359_913683_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q7Y407	Yersinia_phage	66.0	4.0e-33
WP_020843849.1|913663_913954_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	57.8	2.2e-19
WP_020843848.1|914009_915296_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.6	4.4e-208
WP_024143213.1|915370_916288_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	76.6	2.5e-128
WP_020843846.1|916326_917586_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	88.8	5.4e-219
WP_020843845.1|917758_919483_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	59.6	2.5e-198
WP_020843844.1|919482_919920_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	62.8	2.7e-32
WP_024143211.1|920261_920612_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	75.7	3.6e-48
WP_000819054.1|920714_921020_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	53.1	6.2e-20
WP_001222152.1|921108_921519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109263.1|921918_922449_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	9.9e-90
WP_020843840.1|922698_923241_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_079779077.1|923237_923852_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.7e-109
WP_079779078.1|923851_924133_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	79.6	2.6e-36
WP_079779079.1|924119_924509_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	71.8	1.8e-40
WP_171503638.1|924626_925328_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	67.2	2.2e-81
WP_079779100.1|925398_925824_-	pertussis toxin	NA	NA	NA	NA	NA
WP_079779080.1|926189_926378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079779081.1|926545_927109_-	ORF6N domain-containing protein	NA	A0A0P0ZDQ5	Stx2-converting_phage	92.2	1.2e-53
926672:926686	attL	AGCAGTTCCGTCAGG	NA	NA	NA	NA
WP_079779082.1|927376_928048_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.7	2.6e-63
WP_079779084.1|928437_929040_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_042916810.1|929074_929323_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	97.6	1.4e-41
WP_001217667.1|929439_929673_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	7.3e-37
WP_079779085.1|929968_930547_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	41.7	5.3e-20
WP_079779086.1|930853_931558_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	98.3	1.0e-126
WP_079779087.1|931554_932460_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	98.0	3.2e-173
WP_079779088.1|932551_932926_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	96.8	1.4e-61
WP_079779089.1|932891_933128_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	67.9	3.2e-24
WP_079779090.1|933200_933614_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	76.3	3.1e-46
WP_079779091.1|933763_934513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079779092.1|934509_935337_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000551857.1|935816_935987_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	49.0	9.7e-07
WP_079779093.1|936127_938572_+	hypothetical protein	NA	S4TNL0	Salmonella_phage	80.2	2.1e-219
WP_000205291.1|938568_939123_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	5.7e-48
WP_020843824.1|939125_939308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196400.1|939520_939745_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_079779094.1|939745_940765_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.2	3.1e-92
WP_000374045.1|941363_942023_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.4	1.7e-46
945451:945465	attR	AGCAGTTCCGTCAGG	NA	NA	NA	NA
>prophage 2
NZ_CP053336	Salmonella bongori serovar 48:z81:- strain 08-0158 chromosome, complete genome	4495420	3294851	3337913	4495420	integrase,holin,head,portal,protease,tail,capsid,terminase	uncultured_Caudovirales_phage(64.29%)	48	3320643:3320692	3335209:3335258
WP_000785625.1|3294851_3295250_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|3295252_3295558_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877295.1|3295599_3295968_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917519.1|3296111_3296495_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|3296498_3297161_-	DedA family protein	NA	NA	NA	NA	NA
WP_000406481.1|3297509_3298286_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_001226461.1|3298450_3299749_-	MFS transporter	NA	NA	NA	NA	NA
WP_020845313.1|3300219_3301632_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_020845312.1|3301646_3303134_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_000235302.1|3303223_3304468_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098831.1|3304721_3305690_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	7.2e-38
WP_020845311.1|3305959_3306958_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_024143419.1|3307045_3307738_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202735.1|3307889_3308387_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_079779218.1|3308472_3309609_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_020845308.1|3309702_3311721_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_020845306.1|3311889_3313269_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.8	1.4e-31
WP_000094659.1|3313697_3315218_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	39.1	8.4e-33
WP_000478452.1|3315562_3317128_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
WP_000983440.1|3317124_3317772_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079779217.1|3318001_3318769_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_038392767.1|3319079_3319583_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_141023729.1|3319582_3319951_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_079772977.1|3320160_3320526_+	hypothetical protein	NA	NA	NA	NA	NA
3320643:3320692	attL	TATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_079779215.1|3320871_3322305_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_079779214.1|3322294_3322885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171503631.1|3323057_3323204_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079779212.1|3323309_3323492_-	DUF3950 domain-containing protein	NA	NA	NA	NA	NA
WP_079779211.1|3323631_3323880_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_079779210.1|3323872_3324091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079779209.1|3324083_3324308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079779208.1|3324312_3324612_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_079779207.1|3324608_3326408_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.1	1.1e-129
WP_079779206.1|3326688_3326952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079779205.1|3326980_3327451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079779204.1|3327728_3328883_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	68.0	1.4e-149
WP_079779203.1|3328927_3329488_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.4	4.0e-89
WP_079779202.1|3329489_3330719_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	90.5	2.4e-219
WP_079779201.1|3330715_3331054_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	44.0	8.1e-21
WP_079779200.1|3331046_3331340_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	82.5	1.5e-42
WP_079779199.1|3331339_3331783_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.3	3.8e-50
WP_171503632.1|3332057_3332414_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.1	1.0e-50
WP_079779246.1|3332397_3334059_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	96.6	0.0e+00
WP_079779245.1|3334061_3334250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079779244.1|3334305_3334854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171503634.1|3334874_3335039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237774.1|3335413_3335920_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3335209:3335258	attR	TATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_001519776.1|3336065_3337913_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
