The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053421	Pediococcus acidilactici strain PMC65 chromosome, complete genome	2044083	627878	694165	2044083	protease,head,tail,holin,tRNA,portal,integrase,terminase,capsid	Lactobacillus_phage(75.68%)	75	626934:626950	684335:684351
626934:626950	attL	TAATGGACGTTTAGGTA	NA	NA	NA	NA
WP_002830673.1|627878_630296_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.1	0.0e+00
WP_002830674.1|630551_632234_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004165588.1|632244_632964_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_004165589.1|633070_633901_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_002830677.1|634026_634488_+	universal stress protein	NA	NA	NA	NA	NA
WP_002830678.1|634817_635102_+	DUF2089 family protein	NA	NA	NA	NA	NA
WP_002830680.1|635098_635392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166481367.1|635475_637185_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_098040485.1|637467_639114_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002830683.1|639117_639840_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_098040484.1|640056_642021_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002830685.1|642144_642804_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	45.0	1.4e-45
WP_166481368.1|643291_644110_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_008842219.1|644311_644530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008842220.1|644529_644808_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002830690.1|645756_647637_+	asparagine synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
WP_036685783.1|647655_649179_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002830692.1|649178_650435_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_002830693.1|650440_651148_+	amino acid racemase	NA	NA	NA	NA	NA
WP_002830694.1|651239_652049_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002830695.1|652131_652944_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008842223.1|653225_653915_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_166481369.1|654310_655390_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9ZXG6	Leuconostoc_phage	35.7	3.7e-43
WP_166481370.1|655525_656527_-	Abi family protein	NA	M1PS09	Streptococcus_phage	35.6	4.0e-47
WP_166481371.1|657056_657254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166481372.1|657487_657853_-	hypothetical protein	NA	D7RWL4	Brochothrix_phage	49.5	1.1e-18
WP_128212081.1|657898_658306_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	36.1	4.0e-14
WP_002831842.1|658314_658656_-	helix-turn-helix transcriptional regulator	NA	D2IZV9	Enterococcus_phage	38.1	2.3e-15
WP_159215549.1|658912_659119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166481373.1|659108_659417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036672974.1|659484_659694_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029258004.1|659878_660082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166481374.1|660139_660907_+	phage antirepressor KilAC domain-containing protein	NA	L0P8P6	Lactobacillus_phage	68.8	5.3e-100
WP_166481375.1|660919_661126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159209346.1|661392_662010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166481376.1|662235_662691_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_166481377.1|662691_663390_+	ERF family protein	NA	I6TJU2	Staphylococcus_virus	38.3	3.4e-21
WP_166481378.1|663382_663808_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	58.9	9.5e-43
WP_128472133.1|663819_664497_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	63.0	4.1e-80
WP_128472134.1|664486_664711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128472135.1|664714_664963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128472136.1|664996_665758_+	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	46.3	2.9e-50
WP_166481379.1|665738_666554_+	ATP-binding protein	NA	O03914	Lactobacillus_phage	45.3	3.4e-57
WP_166481380.1|666671_667304_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_166481381.1|667284_667686_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	46.3	4.0e-27
WP_166481382.1|667682_667847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166481383.1|667818_668187_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_166481384.1|668271_668706_+	RNA polymerase subunit sigma-70	NA	O03925	Lactobacillus_phage	34.8	1.0e-12
WP_166481385.1|669247_669400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171461287.1|669410_669881_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	87.8	4.1e-79
WP_166481387.1|669978_670236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166481388.1|670426_670885_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	93.4	6.4e-77
WP_166481389.1|670887_672786_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	96.0	0.0e+00
WP_024863127.1|672775_672970_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	90.6	4.5e-24
WP_166481390.1|672972_674166_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	95.7	5.7e-218
WP_159209379.1|674143_674893_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	E9LUQ2	Lactobacillus_phage	95.6	4.2e-126
WP_166481391.1|674892_676125_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	92.9	3.7e-212
WP_024863131.1|676197_676530_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	86.1	2.1e-45
WP_171461264.1|676519_676867_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	71.3	1.0e-42
WP_166481393.1|676869_677277_+	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	90.2	3.2e-64
WP_166481394.1|677276_677657_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	91.3	7.6e-60
WP_166481395.1|677670_678375_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	90.0	3.8e-105
WP_159209317.1|678451_678826_+	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	94.4	2.0e-57
WP_053905877.1|678870_679056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166481396.1|679085_683741_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2P0ZLG0	Lactobacillus_phage	65.6	0.0e+00
WP_166481397.1|683817_685587_+|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	63.1	9.3e-225
684335:684351	attR	TACCTAAACGTCCATTA	NA	NA	NA	NA
WP_166481398.1|685607_687968_+	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	80.4	0.0e+00
WP_166481399.1|687969_691263_+	hypothetical protein	NA	A0A1S5RCP2	Lactobacillus_phage	25.4	6.5e-46
WP_166481400.1|691255_691483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166481401.1|691475_691685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166481402.1|691727_691976_+	hypothetical protein	NA	Q9AZX0	Lactococcus_phage	45.2	4.9e-07
WP_166481403.1|691992_692352_+	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	79.0	1.7e-45
WP_166481404.1|692363_693527_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	57.9	2.2e-41
WP_138492841.1|693526_693790_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	85.1	3.6e-32
WP_159215953.1|693799_694165_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	78.2	2.2e-24
>prophage 2
NZ_CP053421	Pediococcus acidilactici strain PMC65 chromosome, complete genome	2044083	917786	924971	2044083		Lactobacillus_phage(50.0%)	18	NA	NA
WP_008840853.1|917786_918149_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	40.6	4.2e-15
WP_008840854.1|918291_918522_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008840855.1|918518_918656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036685008.1|918687_919056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166481435.1|919047_919245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036685013.1|919313_919529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036685090.1|919631_920078_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008840858.1|920078_920360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158002712.1|920361_920505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008840859.1|920597_920843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008840860.1|920835_921633_+	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	57.3	1.2e-62
WP_052017552.1|921541_922423_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	44.4	3.6e-60
WP_008840862.1|922434_922899_+	hypothetical protein	NA	A0A1L2JY26	Aeribacillus_phage	55.9	1.2e-17
WP_008840863.1|922925_923609_+	hypothetical protein	NA	A0A2D1GP81	Lactobacillus_phage	44.9	9.0e-35
WP_008840864.1|923601_924000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144235476.1|924014_924251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052017553.1|924265_924502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008840867.1|924494_924971_+	single-stranded DNA-binding protein	NA	A0A2H4J1H8	uncultured_Caudovirales_phage	58.1	1.5e-41
>prophage 3
NZ_CP053421	Pediococcus acidilactici strain PMC65 chromosome, complete genome	2044083	1092095	1100658	2044083		Synechococcus_phage(33.33%)	9	NA	NA
WP_008840996.1|1092095_1092677_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.2	8.8e-23
WP_008840997.1|1092676_1093723_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	38.7	2.7e-54
WP_166481451.1|1093725_1095195_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.5	2.8e-57
WP_171461270.1|1095179_1097384_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	2.8e-146
WP_036685062.1|1097401_1098076_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_008841001.1|1098072_1098333_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_008841002.1|1098319_1099054_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	42.5	1.3e-42
WP_008841003.1|1099031_1100192_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_008841004.1|1100175_1100658_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	39.7	1.6e-17
>prophage 4
NZ_CP053421	Pediococcus acidilactici strain PMC65 chromosome, complete genome	2044083	1138664	1145986	2044083	tRNA	Staphylococcus_phage(28.57%)	7	NA	NA
WP_008841054.1|1138664_1139510_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.6	2.1e-17
WP_008841056.1|1139906_1140389_-	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	39.1	3.6e-22
WP_005917050.1|1140406_1141357_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.6	1.0e-113
WP_008841057.1|1141361_1143257_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	1.9e-50
WP_008841058.1|1143259_1144468_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.9	1.0e-44
WP_008841059.1|1144583_1145453_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.8	1.2e-55
WP_002830304.1|1145515_1145986_-	nucleoside 2-deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	34.6	2.7e-14
>prophage 5
NZ_CP053421	Pediococcus acidilactici strain PMC65 chromosome, complete genome	2044083	1483109	1522202	2044083	protease,head,tail,holin,capsid,portal,integrase,terminase	Erysipelothrix_phage(73.91%)	41	1483369:1483397	1485238:1485266
WP_141783081.1|1483109_1483199_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_141783082.1|1483346_1483832_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
1483369:1483397	attL	TCGCTTGGGAACAGCGGAAGTTGGGGGAA	NA	NA	NA	NA
WP_171461275.1|1483828_1484758_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	47.7	3.6e-79
WP_166481572.1|1484775_1485222_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_166481476.1|1485302_1488398_-	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
1485238:1485266	attR	TTCCCCCAACTTCCGCTGTTCCCAAGCGA	NA	NA	NA	NA
WP_166481477.1|1488460_1489621_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_166481478.1|1489620_1492200_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	45.5	2.1e-108
WP_141783088.1|1492216_1492438_-	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	70.5	7.9e-17
WP_141783089.1|1492451_1495067_-	helicase	NA	NA	NA	NA	NA
WP_141783090.1|1495071_1496391_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_141783091.1|1496765_1497293_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044005185.1|1497397_1497595_+	hypothetical protein	NA	A0A2I4R673	Erysipelothrix_phage	40.4	1.7e-07
WP_141783093.1|1497581_1497914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141783094.1|1497897_1499040_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	54.6	1.8e-112
WP_166481479.1|1499041_1499593_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	71.6	8.2e-71
WP_166481480.1|1499643_1501578_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	58.5	7.8e-225
WP_081509838.1|1501672_1502071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166481481.1|1502073_1504320_+	primase C-terminal domain-containing protein	NA	E4ZFK6	Streptococcus_phage	48.4	7.4e-211
WP_141783098.1|1504513_1504816_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	54.4	4.3e-21
WP_141783099.1|1504775_1506158_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	66.7	1.7e-157
WP_081509815.1|1506126_1506597_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_141783100.1|1506731_1507109_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	53.0	3.3e-31
WP_087448601.1|1507231_1507774_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	59.6	2.7e-58
WP_166481482.1|1507773_1509003_+	ParB N-terminal domain-containing protein	NA	A0A2I4R670	Erysipelothrix_phage	61.9	6.4e-148
WP_141783102.1|1509076_1509709_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	39.0	3.1e-37
WP_003672638.1|1509701_1509908_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_166481483.1|1509973_1511575_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	78.5	4.4e-250
WP_003672640.1|1511602_1511764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141783104.1|1511904_1512066_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_171461276.1|1512122_1513379_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	62.8	2.6e-152
WP_141783105.1|1513375_1514038_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2K5B288	Erysipelothrix_phage	56.5	6.4e-54
WP_141783106.1|1514058_1515237_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	59.0	9.8e-130
WP_081509824.1|1515250_1515529_+|head,tail	phage gp6-like head-tail connector protein	head,tail	D0R0D7	Streptococcus_phage	41.1	4.5e-09
WP_003672649.1|1515529_1515910_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_141783107.1|1515899_1516322_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	64.2	3.7e-39
WP_003672653.1|1516432_1516621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141783108.1|1516682_1518236_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	35.1	7.9e-87
WP_141783109.1|1518222_1518627_+	recombinase	NA	NA	NA	NA	NA
WP_166481484.1|1518613_1520200_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	46.9	1.7e-124
WP_166481485.1|1520253_1520517_-	thiamine permease	NA	NA	NA	NA	NA
WP_166481486.1|1520831_1522202_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.8	2.5e-124
