The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053377	Bacillus velezensis strain EN01 chromosome, complete genome	4029600	662431	672322	4029600		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|662431_663724_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_003155762.1|663799_664519_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	5.2e-49
WP_003155758.1|664518_664773_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_015388591.1|664769_665453_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_024084976.1|665436_667665_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	1.1e-158
WP_003155754.1|667640_669071_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.6e-54
WP_003155753.1|669162_670203_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	2.4e-63
WP_003155752.1|670199_670787_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	1.0e-26
WP_003155751.1|670783_672322_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	8.7e-78
>prophage 2
NZ_CP053377	Bacillus velezensis strain EN01 chromosome, complete genome	4029600	1118354	1164867	4029600	integrase,tRNA,coat	Bacillus_phage(22.22%)	54	1121721:1121734	1171692:1171705
WP_024085121.1|1118354_1119347_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012117282.1|1120090_1121725_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1121721:1121734	attL	AATAAAAGCCGGTT	NA	NA	NA	NA
WP_003155043.1|1121831_1122767_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003155041.1|1122770_1123688_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_003155039.1|1123700_1124777_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_003155037.1|1124769_1125687_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_003155036.1|1125793_1126981_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_024085122.1|1127099_1127678_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155034.1|1127856_1128252_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003155033.1|1128309_1128966_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	40.4	3.8e-30
WP_003155032.1|1129241_1129898_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_024085124.1|1130048_1131209_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_024085125.1|1131436_1133266_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|1133303_1133471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085126.1|1133756_1134659_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003155023.1|1134655_1135054_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_024085127.1|1135282_1135969_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.9e-39
WP_015388447.1|1135973_1136549_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003155020.1|1136673_1137039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155019.1|1137066_1137702_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155018.1|1137723_1138524_+	NAD kinase	NA	NA	NA	NA	NA
WP_024085128.1|1138538_1139432_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.2	1.4e-06
WP_003155015.1|1139465_1140215_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.7	1.2e-11
WP_003155014.1|1140442_1142287_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003155011.1|1142536_1143244_+	thiaminase II	NA	NA	NA	NA	NA
WP_024085129.1|1143221_1143839_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_024085130.1|1143822_1144932_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_003155008.1|1144928_1145132_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_088005363.1|1145128_1145899_+	thiazole synthase	NA	NA	NA	NA	NA
WP_024085131.1|1145895_1146906_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_003155003.1|1146928_1147741_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003155001.1|1147871_1148648_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_170936232.1|1148739_1149354_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154997.1|1149412_1149856_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024085134.1|1150001_1150484_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154994.1|1150634_1151135_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154993.1|1151227_1151542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154992.1|1151579_1151966_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014304801.1|1152136_1152493_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003154990.1|1152779_1152977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154988.1|1153069_1153237_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154986.1|1153399_1153654_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_015388439.1|1153722_1156008_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.2	1.9e-84
WP_003154980.1|1156128_1156383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015388438.1|1156451_1157201_+	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_003154977.1|1157241_1157964_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003154975.1|1157956_1158694_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	5.2e-28
WP_003154973.1|1158694_1158928_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003154971.1|1159088_1159520_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003154969.1|1159524_1160040_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_003154967.1|1160065_1160788_-	esterase family protein	NA	NA	NA	NA	NA
WP_024085136.1|1161155_1162277_+	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_003154961.1|1162269_1163445_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_024085137.1|1163817_1164867_+|integrase	tyrosine-type recombinase/integrase	integrase	Q938N9	Temperate_phage	27.9	1.3e-08
1171692:1171705	attR	AATAAAAGCCGGTT	NA	NA	NA	NA
>prophage 3
NZ_CP053377	Bacillus velezensis strain EN01 chromosome, complete genome	4029600	1239430	1271320	4029600	capsid,terminase,tail,portal,holin,plate	Bacillus_phage(33.33%)	44	NA	NA
WP_087920760.1|1239430_1240567_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1240556_1240691_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003154880.1|1240833_1241787_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154878.1|1241824_1242202_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	1.1e-15
WP_003154876.1|1242301_1242907_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.8	7.4e-41
WP_003154875.1|1242896_1243046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154873.1|1243061_1243652_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1243800_1244139_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_003154869.1|1244330_1244510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154867.1|1244499_1245327_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.9	6.4e-19
WP_003154865.1|1245226_1246027_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	3.6e-59
WP_003154863.1|1246026_1246194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154861.1|1246291_1246633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1246622_1246826_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_003154857.1|1246938_1247451_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	5.0e-22
WP_003154855.1|1247563_1248361_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.6	9.4e-60
WP_024085188.1|1248357_1249656_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.6	8.5e-151
WP_099762611.1|1249704_1251084_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.4	5.1e-138
WP_015417286.1|1251115_1251961_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	57.6	4.3e-55
WP_003154848.1|1251987_1252923_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	2.5e-104
WP_015388357.1|1252939_1253323_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003154844.1|1253319_1253676_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_014304847.1|1253672_1254176_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_014304848.1|1254172_1254619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154839.1|1254615_1254825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015388356.1|1254824_1256222_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_003154837.1|1256223_1256667_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1256743_1257190_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1257231_1257384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083058681.1|1257371_1262498_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	1.5e-41
WP_024085190.1|1262490_1263150_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_003154829.1|1263163_1264141_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	2.9e-34
WP_007610818.1|1264140_1264407_+	DUF2577 family protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_003154825.1|1264510_1264936_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_003154824.1|1264928_1265975_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	7.7e-70
WP_003154823.1|1265958_1266537_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
WP_003154822.1|1266533_1266806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154821.1|1266808_1268431_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	5.3e-41
WP_014304856.1|1268443_1268815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154819.1|1268820_1269018_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	4.3e-14
WP_046559521.1|1269074_1269836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1269887_1270151_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1270164_1270428_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_024085195.1|1270441_1271320_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	4.8e-81
>prophage 4
NZ_CP053377	Bacillus velezensis strain EN01 chromosome, complete genome	4029600	2118420	2131562	4029600		Bacillus_phage(90.0%)	13	NA	NA
WP_024085504.1|2118420_2118795_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.8	2.8e-30
WP_024085505.1|2119029_2119482_-	hypothetical protein	NA	O64117	Bacillus_phage	77.3	3.7e-61
WP_003153656.1|2119844_2120981_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	76.7	8.2e-166
WP_003153655.1|2120970_2121153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014305240.1|2122558_2122918_-	hypothetical protein	NA	O64028	Bacillus_phage	60.5	3.7e-32
WP_024085506.1|2122923_2123391_-	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	57.1	1.0e-42
WP_014305242.1|2123965_2124304_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	56.2	1.1e-25
WP_024085507.1|2125075_2125654_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	84.6	3.5e-88
WP_024085508.1|2125708_2126167_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_024085509.1|2126181_2127981_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	64.4	7.3e-169
WP_041482372.1|2128915_2129224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041482373.1|2129281_2130949_+	recombinase family protein	NA	O64015	Bacillus_phage	89.8	7.8e-274
WP_025852502.1|2130971_2131562_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	30.5	1.1e-12
>prophage 5
NZ_CP053377	Bacillus velezensis strain EN01 chromosome, complete genome	4029600	2166134	2217235	4029600	capsid,head,terminase,tail,protease,portal,holin,integrase,plate,coat	Bacillus_phage(40.0%)	64	2182714:2182732	2222787:2222805
WP_046341328.1|2166134_2166380_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	58.8	8.5e-20
WP_046341330.1|2166894_2167710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046341331.1|2167800_2169291_-	glycosyltransferase	NA	A0A1V0SGA9	Hokovirus	25.7	7.3e-05
WP_046341332.1|2169413_2170574_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	66.2	2.9e-70
WP_046341333.1|2170619_2171042_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	87.2	1.6e-58
WP_079891870.1|2171093_2171279_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	70.5	1.7e-20
WP_046341335.1|2171278_2171641_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	58.0	1.7e-29
WP_046341336.1|2171637_2173461_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	35.9	5.8e-81
WP_046341337.1|2173475_2176040_-	peptidase G2	NA	D6R401	Bacillus_phage	79.8	0.0e+00
WP_046341338.1|2176093_2177797_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	57.2	2.1e-181
WP_046341339.1|2177811_2178651_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	57.6	2.2e-91
WP_083059059.1|2178644_2183132_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.7	1.3e-65
2182714:2182732	attL	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
WP_014418189.1|2183328_2183706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083059057.1|2183771_2184380_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	35.5	3.7e-24
WP_083059055.1|2184394_2184778_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_025852578.1|2184774_2185173_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_025852580.1|2185169_2185487_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	4.9e-12
WP_025852582.1|2185476_2185779_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	44.0	3.6e-12
WP_060560124.1|2185796_2186213_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	50.6	1.7e-12
WP_038458896.1|2186235_2187528_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	48.7	3.1e-92
WP_046341349.1|2187566_2188193_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	77.7	3.3e-84
WP_046341350.1|2188155_2189436_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.1	1.6e-154
WP_014418199.1|2189440_2189611_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	61.8	7.9e-09
WP_046341351.1|2189624_2191334_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	63.1	2.2e-207
WP_046341352.1|2191330_2191846_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	42.3	5.4e-32
WP_046341353.1|2192073_2192439_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	1.0e-29
WP_154018702.1|2192443_2192605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863621.1|2192745_2193465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863619.1|2193487_2194300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863616.1|2194489_2194702_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	43.9	3.8e-08
WP_162839616.1|2194964_2195114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046341354.1|2195248_2195461_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	2.5e-12
WP_014304494.1|2195759_2195897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046341355.1|2196002_2196518_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	6.8e-27
WP_046341357.1|2196742_2197183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131242019.1|2197231_2197465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046341359.1|2197701_2198055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083059051.1|2198193_2198451_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	40.5	1.7e-07
WP_025852610.1|2198486_2198690_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	70.3	2.8e-21
WP_165869030.1|2198771_2198936_-	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	68.0	5.1e-13
WP_047935875.1|2198986_2199415_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	3.0e-44
WP_131242021.1|2199650_2200598_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.2	3.2e-54
WP_083059049.1|2200482_2201184_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	33.8	7.6e-05
WP_079891319.1|2201381_2202119_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2P1JU03	Anoxybacillus_phage	42.4	4.8e-42
WP_025852621.1|2202138_2203059_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	64.0	4.5e-90
WP_038458929.1|2203055_2203244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046341367.1|2203345_2203543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418217.1|2203539_2203797_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	39.8	1.1e-09
WP_014418218.1|2203793_2204366_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.9	4.7e-61
WP_046341368.1|2204423_2205152_-	Rha family transcriptional regulator	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	68.3	3.0e-89
WP_032863594.1|2205148_2205463_-	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	49.3	1.9e-11
WP_076983071.1|2205475_2205724_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043021753.1|2205894_2206275_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	42.7	3.3e-10
WP_038458937.1|2206637_2207834_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	43.9	5.5e-80
WP_052586183.1|2207877_2209182_-	purine permease	NA	NA	NA	NA	NA
WP_058906135.1|2209178_2209763_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025852639.1|2210094_2211597_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_017418013.1|2211708_2213628_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	2.3e-11
WP_003153550.1|2213731_2213923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003153548.1|2214089_2214242_+	YpzG family protein	NA	NA	NA	NA	NA
WP_024085525.1|2214282_2215449_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003153541.1|2215982_2216282_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_014305282.1|2216361_2216910_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003153539.1|2216998_2217235_-|coat	spore coat protein	coat	NA	NA	NA	NA
2222787:2222805	attR	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
>prophage 6
NZ_CP053377	Bacillus velezensis strain EN01 chromosome, complete genome	4029600	2308787	2315040	4029600		Staphylococcus_phage(66.67%)	9	NA	NA
WP_003153378.1|2308787_2309381_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_003153377.1|2309370_2310126_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153376.1|2310333_2310423_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153375.1|2310510_2311032_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2311097_2311472_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2311588_2312053_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_024085543.1|2312085_2313282_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_003153370.1|2313296_2313944_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_024085544.1|2313924_2315040_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.9	5.2e-56
>prophage 7
NZ_CP053377	Bacillus velezensis strain EN01 chromosome, complete genome	4029600	2668569	2728475	4029600	protease,tRNA,coat	uncultured_Mediterranean_phage(25.0%)	60	NA	NA
WP_007408194.1|2668569_2669013_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003152716.1|2669025_2671230_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_003152714.1|2671387_2671900_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_024085650.1|2671905_2674266_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	1.1e-90
WP_003152709.1|2674321_2674648_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_014305499.1|2674711_2675209_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_003152704.1|2675340_2677560_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	2.0e-27
WP_003152702.1|2677596_2677893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152700.1|2678008_2679565_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_003152699.1|2679572_2680229_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003152697.1|2680395_2680782_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2680833_2681094_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_014305500.1|2681125_2682271_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_003152692.1|2682298_2683327_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_015387898.1|2683352_2683553_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152685.1|2683545_2684550_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
WP_003152683.1|2684560_2685166_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_012118093.1|2685300_2685810_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015387897.1|2685942_2686182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152677.1|2686195_2686789_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_014305504.1|2686936_2688142_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_024085652.1|2688268_2689372_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_003152672.1|2689373_2690222_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_024085653.1|2690203_2691769_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_024085654.1|2691874_2693026_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	26.8	1.7e-30
WP_024085655.1|2693022_2693565_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003152668.1|2693593_2694451_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003152667.1|2694464_2694908_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003152665.1|2694961_2696248_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003152664.1|2696279_2696858_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152662.1|2697175_2697460_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_024085656.1|2697472_2697814_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2697816_2698125_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014305510.1|2698270_2699137_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_007408168.1|2699129_2699933_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2700060_2700864_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003152653.1|2700866_2701547_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003152650.1|2701600_2702119_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003152649.1|2702115_2702979_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003152647.1|2703009_2704023_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_003152646.1|2704114_2704810_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_014305513.1|2704841_2705411_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_024085657.1|2705551_2706553_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003152643.1|2706679_2707432_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_024085658.1|2707571_2708864_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003152640.1|2708922_2711565_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.2	3.7e-161
WP_003152639.1|2712017_2712209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024085659.1|2712223_2713246_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_131242026.1|2713279_2715196_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003152633.1|2715328_2716618_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003152632.1|2716646_2717621_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_024085661.1|2717623_2718406_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003152630.1|2718395_2719337_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003152629.1|2719371_2720202_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_015387890.1|2720209_2721577_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014305520.1|2721771_2722263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152626.1|2722295_2722883_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003152624.1|2722879_2725204_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.3	8.0e-184
WP_003152622.1|2725403_2727062_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_003152620.1|2727212_2728475_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
>prophage 8
NZ_CP053377	Bacillus velezensis strain EN01 chromosome, complete genome	4029600	3104694	3189999	4029600	capsid,head,terminase,tail,protease,portal,holin,integrase,bacteriocin,plate,coat	Bacillus_phage(40.91%)	100	3150833:3150868	3186919:3186954
WP_003151973.1|3104694_3105030_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_014305740.1|3105097_3105670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085752.1|3106077_3106377_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014305743.1|3106416_3107178_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003151967.1|3107320_3107683_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	44.9	1.4e-18
WP_014305744.1|3107760_3108615_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_024085753.1|3108738_3109956_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	23.2	2.0e-13
WP_007408721.1|3110089_3110326_-	YuzB family protein	NA	NA	NA	NA	NA
WP_003151959.1|3110592_3111660_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003151957.1|3111697_3112024_-	YuzD family protein	NA	NA	NA	NA	NA
WP_169510385.1|3112103_3112439_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	42.4	3.7e-10
WP_003151941.1|3112479_3114456_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_003151940.1|3114559_3115489_-	homoserine kinase	NA	NA	NA	NA	NA
WP_015387765.1|3115485_3116544_-	threonine synthase	NA	NA	NA	NA	NA
WP_003151938.1|3116543_3117845_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_031306537.1|3118046_3119063_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_014305750.1|3119217_3119718_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.4	5.2e-40
WP_024085754.1|3119746_3120517_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_003151930.1|3120550_3120985_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003151928.1|3121010_3121286_-	YutD family protein	NA	NA	NA	NA	NA
WP_003151923.1|3121504_3122401_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_024085755.1|3122602_3123580_+	M23 family metallopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.2	7.9e-08
WP_024085756.1|3123617_3124376_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_024085757.1|3124502_3125897_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_015387760.1|3125914_3126736_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014305754.1|3126755_3127607_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_015387759.1|3127633_3127987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085758.1|3128059_3129424_-	allantoinase	NA	NA	NA	NA	NA
WP_024085759.1|3129603_3131199_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024085761.1|3131591_3132197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025853885.1|3133047_3133284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151906.1|3133316_3134513_-	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	20.5	4.5e-05
WP_046341409.1|3134634_3135888_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024085764.1|3135906_3137148_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_003151902.1|3137367_3138237_+	ribonuclease	NA	NA	NA	NA	NA
WP_015387756.1|3138286_3139393_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	46.1	5.6e-18
WP_003151898.1|3139548_3140277_+	transcriptional regulator PhoB	NA	NA	NA	NA	NA
WP_015387755.1|3140301_3141156_-	fructosamine kinase	NA	NA	NA	NA	NA
WP_003151895.1|3141169_3142054_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_024085765.1|3142058_3142937_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_024085766.1|3142973_3144239_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003151892.1|3144312_3145299_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-11
WP_024085767.1|3145495_3146422_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007410095.1|3146693_3146966_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_003151888.1|3147004_3147379_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_003151885.1|3147445_3148561_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_041482380.1|3148598_3149300_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	28.0	2.1e-10
WP_003151879.1|3149970_3150807_+	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.4	3.4e-20
3150833:3150868	attL	GGTTTTACTATTAACCGATGGAGCCTTCCATTTCGA	NA	NA	NA	NA
WP_047936147.1|3151013_3151166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083058955.1|3151205_3151772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131242031.1|3152085_3153249_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	49.8	1.5e-69
WP_015239640.1|3153293_3153716_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	89.5	3.8e-60
WP_073982130.1|3153752_3153908_-	XkdX family protein	NA	A0A1W6JQ64	Staphylococcus_phage	58.1	4.0e-07
WP_083058853.1|3153909_3154293_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	56.7	1.1e-29
WP_083058855.1|3154289_3155522_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	79.8	2.1e-138
WP_083058858.1|3155535_3158112_-	peptidase G2	NA	D6R401	Bacillus_phage	51.7	9.0e-245
WP_083058859.1|3158116_3160003_-|tail	phage tail protein	tail	M5AC19	Bacillus_phage	36.7	7.7e-36
WP_083058862.1|3160015_3160846_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_083058863.1|3160849_3165088_-|tail	phage tail tape measure protein	tail	A0A0S2SXL7	Bacillus_phage	32.1	2.1e-65
WP_083058866.1|3165287_3165668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058867.1|3165667_3166306_-	hypothetical protein	NA	A0A1J0MFV0	Staphylococcus_phage	32.6	2.8e-14
WP_083058870.1|3166305_3166689_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_083058871.1|3166694_3167102_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_083058874.1|3167085_3167430_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_083058875.1|3167410_3167683_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	44.4	6.5e-13
WP_083058878.1|3167666_3168953_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	52.3	1.0e-87
WP_165869031.1|3168949_3169540_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	58.9	2.6e-54
WP_083058882.1|3169529_3170708_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	54.8	4.6e-111
WP_083058883.1|3170719_3172453_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	51.5	1.3e-167
WP_083058906.1|3172449_3172854_-|terminase	P27 family phage terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	39.7	6.1e-23
WP_083058886.1|3172931_3173300_-	HNH endonuclease	NA	A0A1B0T6C5	Bacillus_phage	52.8	1.9e-31
WP_083058888.1|3173296_3173515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058908.1|3173549_3173831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058890.1|3174620_3174833_-	hypothetical protein	NA	A0A0K2CPG8	Brevibacillus_phage	56.8	1.8e-05
WP_017417279.1|3175449_3175992_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	59.4	1.8e-54
WP_083058959.1|3175988_3176441_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	58.1	5.7e-38
WP_083058946.1|3176793_3177069_-	hypothetical protein	NA	Q38076	Bacillus_phage	37.1	5.8e-09
WP_083058944.1|3177058_3177406_-	hypothetical protein	NA	Q9ZXC0	Bacillus_phage	88.1	7.2e-49
WP_083058942.1|3177492_3178233_-	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	68.8	6.9e-89
WP_083058940.1|3178328_3178583_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.0	1.5e-06
WP_083058938.1|3178579_3178987_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	43.5	4.7e-23
WP_083058937.1|3178983_3179364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085436.1|3179504_3179708_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
WP_165869032.1|3179787_3179943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387918.1|3179955_3180096_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_083058934.1|3180203_3180752_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.7e-05
WP_165869033.1|3180748_3180907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165869034.1|3180903_3181053_-	type VI secretion system contractile sheath protein TssC	NA	NA	NA	NA	NA
WP_046560205.1|3181067_3181901_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	34.8	2.7e-33
WP_083058933.1|3181884_3182763_-	conserved phage C-terminal domain-containing protein	NA	A0A0U3TZZ4	Bacillus_phage	49.4	1.4e-61
WP_083058930.1|3182755_3182986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058928.1|3182954_3183185_-	hypothetical protein	NA	R9TQ08	Paenibacillus_phage	64.9	4.5e-15
WP_165869037.1|3183226_3183430_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083058926.1|3183607_3183997_+	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	35.9	9.4e-05
WP_083058924.1|3184224_3184422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058922.1|3184418_3185543_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	29.2	1.4e-21
WP_083058920.1|3185819_3186857_+|integrase	site-specific integrase	integrase	A0A1J0MF14	Staphylococcus_phage	46.6	1.2e-86
WP_003151878.1|3186928_3188326_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
3186919:3186954	attR	GGTTTTACTATTAACCGATGGAGCCTTCCATTTCGA	NA	NA	NA	NA
WP_003151877.1|3188345_3188789_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_007410089.1|3188778_3189999_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.6	6.8e-118
>prophage 9
NZ_CP053377	Bacillus velezensis strain EN01 chromosome, complete genome	4029600	3298793	3350907	4029600	capsid,head,terminase,tail,protease,portal,holin,integrase,plate	Bacillus_phage(68.09%)	71	3297261:3297285	3336621:3336645
3297261:3297285	attL	GTTATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_063636433.1|3298793_3299957_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.2	3.9e-70
WP_063636434.1|3300003_3300426_-|holin	holin family protein	holin	D6R405	Bacillus_phage	98.5	2.3e-65
WP_043867136.1|3300477_3300666_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	98.4	8.2e-31
WP_063636435.1|3300662_3301025_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	91.7	4.9e-56
WP_063636436.1|3301021_3302299_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	82.1	4.0e-153
WP_063636437.1|3302315_3304877_-	peptidase G2	NA	D6R401	Bacillus_phage	97.3	0.0e+00
WP_063636438.1|3304916_3306620_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	99.1	6.3e-312
WP_063636439.1|3306631_3307471_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	93.5	1.7e-152
WP_083058952.1|3307470_3311346_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	88.5	0.0e+00
WP_065180836.1|3311546_3311885_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	94.6	1.2e-53
WP_065180837.1|3311936_3312545_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	82.2	8.4e-93
WP_065180838.1|3312545_3312926_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	95.2	2.9e-59
WP_065180839.1|3312922_3313306_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	96.9	2.7e-65
WP_039251289.1|3313298_3313658_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	96.6	8.0e-59
WP_065180840.1|3313590_3313938_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	97.4	1.1e-57
WP_065180841.1|3313952_3314363_-	hypothetical protein	NA	D6R3Z0	Bacillus_phage	67.4	6.8e-38
WP_065180842.1|3314390_3314699_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	96.0	4.8e-44
WP_065180843.1|3314712_3315915_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	72.5	7.8e-159
WP_065180844.1|3315954_3316581_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	98.6	2.2e-112
WP_048367364.1|3316570_3317821_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	98.3	7.7e-242
WP_063636448.1|3318068_3319778_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	96.7	0.0e+00
WP_046559655.1|3319777_3320284_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	95.8	3.1e-85
WP_063636449.1|3320370_3320697_-	hypothetical protein	NA	Q9T203	Bacillus_phage	97.2	1.1e-54
WP_083058950.1|3320665_3321040_-	HNH endonuclease	NA	Q38456	Bacillus_phage	93.5	2.6e-68
WP_052364764.1|3321039_3321648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058948.1|3321637_3321883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017417279.1|3322486_3323029_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	59.4	1.8e-54
WP_017417278.1|3323025_3323478_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
WP_017417277.1|3323496_3323673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017417276.1|3323778_3324213_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	4.1e-49
WP_026092239.1|3324215_3324461_-	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
WP_017417274.1|3324457_3324766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017417272.1|3324955_3325159_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	44.8	2.1e-08
WP_063636452.1|3325174_3325402_-	hypothetical protein	NA	A0A217EQZ3	Bacillus_phage	63.5	2.0e-23
WP_063636453.1|3325398_3325701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063636454.1|3325702_3326380_-	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	46.7	4.3e-37
WP_063636455.1|3326376_3326700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058892.1|3326810_3327821_-	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	43.2	6.1e-64
WP_083058894.1|3327825_3328080_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.3	1.9e-06
WP_083058896.1|3328076_3328484_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	44.3	9.5e-24
WP_083058900.1|3328877_3329081_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.7	2.6e-14
WP_164967571.1|3329160_3329316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387918.1|3329328_3329469_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_065180849.1|3329577_3330126_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_024085441.1|3330277_3330427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063636460.1|3330441_3331272_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.6	8.4e-35
WP_063636461.1|3331255_3332122_-	hypothetical protein	NA	D2XR43	Bacillus_phage	62.4	1.1e-50
WP_049627410.1|3332114_3332345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049627411.1|3332362_3332686_-	DUF771 domain-containing protein	NA	A0A1B1IME6	Lactococcus_phage	38.0	5.6e-11
WP_063636462.1|3332705_3332897_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.7	2.7e-13
WP_063636586.1|3332932_3333136_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047936207.1|3333298_3333697_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049627412.1|3334123_3335224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047936209.1|3335484_3336549_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	65.3	3.6e-131
WP_003151688.1|3337156_3337627_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	7.0e-47
3336621:3336645	attR	GTTATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_024085805.1|3337766_3340100_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.4	7.0e-87
WP_024085806.1|3340118_3340859_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003151681.1|3340977_3341208_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_087920807.1|3341331_3341517_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003151677.1|3341713_3342124_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.0	7.8e-18
WP_003151674.1|3342148_3342580_+	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	64.2	6.5e-15
WP_003151672.1|3342661_3342979_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024085807.1|3343063_3344467_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003151668.1|3344457_3345120_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024085808.1|3345141_3345912_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_014305836.1|3345908_3346643_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_003151665.1|3346639_3347353_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.1	2.5e-56
WP_007613829.1|3347463_3348141_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014305837.1|3348159_3349077_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003151662.1|3349091_3349745_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024085809.1|3349761_3350907_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	1.5e-13
