The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053376	Bacillus amyloliquefaciens strain WF02 chromosome, complete genome	4026648	662842	672733	4026648		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|662842_664135_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_003155762.1|664210_664930_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	5.2e-49
WP_003155758.1|664929_665184_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_015388591.1|665180_665864_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_024084976.1|665847_668076_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	1.1e-158
WP_003155754.1|668051_669482_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.6e-54
WP_003155753.1|669573_670614_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	2.4e-63
WP_003155752.1|670610_671198_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	1.0e-26
WP_003155751.1|671194_672733_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	8.7e-78
>prophage 2
NZ_CP053376	Bacillus amyloliquefaciens strain WF02 chromosome, complete genome	4026648	1118100	1164613	4026648	coat,integrase,tRNA	Bacillus_phage(22.22%)	54	1121467:1121480	1171438:1171451
WP_024085121.1|1118100_1119093_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012117282.1|1119836_1121471_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1121467:1121480	attL	AATAAAAGCCGGTT	NA	NA	NA	NA
WP_171451259.1|1121577_1122513_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003155041.1|1122516_1123434_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_003155039.1|1123446_1124523_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_003155037.1|1124515_1125433_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_003155036.1|1125539_1126727_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_024085122.1|1126845_1127424_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155034.1|1127602_1127998_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003155033.1|1128055_1128712_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	40.4	3.8e-30
WP_003155032.1|1128987_1129644_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_024085124.1|1129794_1130955_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_024085125.1|1131182_1133012_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|1133049_1133217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085126.1|1133502_1134405_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003155023.1|1134401_1134800_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_024085127.1|1135028_1135715_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.9e-39
WP_015388447.1|1135719_1136295_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003155020.1|1136419_1136785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155019.1|1136812_1137448_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155018.1|1137469_1138270_+	NAD kinase	NA	NA	NA	NA	NA
WP_024085128.1|1138284_1139178_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.2	1.4e-06
WP_003155015.1|1139211_1139961_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.7	1.2e-11
WP_003155014.1|1140188_1142033_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003155011.1|1142282_1142990_+	thiaminase II	NA	NA	NA	NA	NA
WP_024085129.1|1142967_1143585_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_024085130.1|1143568_1144678_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_003155008.1|1144674_1144878_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_088005363.1|1144874_1145645_+	thiazole synthase	NA	NA	NA	NA	NA
WP_024085131.1|1145641_1146652_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_003155003.1|1146674_1147487_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003155001.1|1147617_1148394_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_170936232.1|1148485_1149100_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154997.1|1149158_1149602_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024085134.1|1149747_1150230_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154994.1|1150380_1150881_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154993.1|1150973_1151288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154992.1|1151325_1151712_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014304801.1|1151882_1152239_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003154990.1|1152525_1152723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154988.1|1152815_1152983_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154986.1|1153145_1153400_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_015388439.1|1153468_1155754_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.2	1.9e-84
WP_003154980.1|1155874_1156129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015388438.1|1156197_1156947_+	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_003154977.1|1156987_1157710_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003154975.1|1157702_1158440_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	5.2e-28
WP_003154973.1|1158440_1158674_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003154971.1|1158834_1159266_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003154969.1|1159270_1159786_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_003154967.1|1159811_1160534_-	esterase family protein	NA	NA	NA	NA	NA
WP_024085136.1|1160901_1162023_+	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_003154961.1|1162015_1163191_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_024085137.1|1163563_1164613_+|integrase	tyrosine-type recombinase/integrase	integrase	Q938N9	Temperate_phage	27.9	1.3e-08
1171438:1171451	attR	AATAAAAGCCGGTT	NA	NA	NA	NA
>prophage 3
NZ_CP053376	Bacillus amyloliquefaciens strain WF02 chromosome, complete genome	4026648	1239177	1271067	4026648	terminase,holin,capsid,tail,portal,plate	Bacillus_phage(33.33%)	44	NA	NA
WP_087920760.1|1239177_1240314_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1240303_1240438_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003154880.1|1240580_1241534_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154878.1|1241571_1241949_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	1.1e-15
WP_003154876.1|1242048_1242654_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.8	7.4e-41
WP_003154875.1|1242643_1242793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154873.1|1242808_1243399_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1243547_1243886_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_003154869.1|1244077_1244257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154867.1|1244246_1245074_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.9	6.4e-19
WP_003154865.1|1244973_1245774_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	3.6e-59
WP_003154863.1|1245773_1245941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154861.1|1246038_1246380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1246369_1246573_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_003154857.1|1246685_1247198_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	5.0e-22
WP_003154855.1|1247310_1248108_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.6	9.4e-60
WP_024085188.1|1248104_1249403_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.6	8.5e-151
WP_099762611.1|1249451_1250831_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.4	5.1e-138
WP_015417286.1|1250862_1251708_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	57.6	4.3e-55
WP_003154848.1|1251734_1252670_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	2.5e-104
WP_015388357.1|1252686_1253070_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003154844.1|1253066_1253423_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_014304847.1|1253419_1253923_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_014304848.1|1253919_1254366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154839.1|1254362_1254572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015388356.1|1254571_1255969_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_003154837.1|1255970_1256414_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1256490_1256937_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1256978_1257131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083058681.1|1257118_1262245_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	1.5e-41
WP_024085190.1|1262237_1262897_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_003154829.1|1262910_1263888_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	2.9e-34
WP_007610818.1|1263887_1264154_+	DUF2577 family protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_003154825.1|1264257_1264683_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_003154824.1|1264675_1265722_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	7.7e-70
WP_003154823.1|1265705_1266284_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
WP_003154822.1|1266280_1266553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154821.1|1266555_1268178_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	5.3e-41
WP_014304856.1|1268190_1268562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154819.1|1268567_1268765_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	4.3e-14
WP_046559521.1|1268821_1269583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1269634_1269898_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1269911_1270175_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_024085195.1|1270188_1271067_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	4.8e-81
>prophage 4
NZ_CP053376	Bacillus amyloliquefaciens strain WF02 chromosome, complete genome	4026648	2118166	2131308	4026648		Bacillus_phage(90.0%)	13	NA	NA
WP_024085504.1|2118166_2118541_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.8	2.8e-30
WP_024085505.1|2118775_2119228_-	hypothetical protein	NA	O64117	Bacillus_phage	77.3	3.7e-61
WP_003153656.1|2119590_2120727_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	76.7	8.2e-166
WP_003153655.1|2120716_2120899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014305240.1|2122304_2122664_-	hypothetical protein	NA	O64028	Bacillus_phage	60.5	3.7e-32
WP_024085506.1|2122669_2123137_-	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	57.1	1.0e-42
WP_014305242.1|2123711_2124050_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	56.2	1.1e-25
WP_024085507.1|2124821_2125400_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	84.6	3.5e-88
WP_024085508.1|2125454_2125913_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_024085509.1|2125927_2127727_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	64.4	7.3e-169
WP_041482372.1|2128661_2128970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041482373.1|2129027_2130695_+	recombinase family protein	NA	O64015	Bacillus_phage	89.8	7.8e-274
WP_025852502.1|2130717_2131308_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	30.5	1.1e-12
>prophage 5
NZ_CP053376	Bacillus amyloliquefaciens strain WF02 chromosome, complete genome	4026648	2165880	2216981	4026648	coat,terminase,head,holin,integrase,protease,capsid,tail,portal,plate	Bacillus_phage(40.0%)	64	2182460:2182478	2222533:2222551
WP_046341328.1|2165880_2166126_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	58.8	8.5e-20
WP_046341330.1|2166640_2167456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046341331.1|2167546_2169037_-	glycosyltransferase	NA	A0A1V0SGA9	Hokovirus	25.7	7.3e-05
WP_046341332.1|2169159_2170320_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	66.2	2.9e-70
WP_046341333.1|2170365_2170788_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	87.2	1.6e-58
WP_079891870.1|2170839_2171025_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	70.5	1.7e-20
WP_046341335.1|2171024_2171387_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	58.0	1.7e-29
WP_046341336.1|2171383_2173207_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	35.9	5.8e-81
WP_046341337.1|2173221_2175786_-	peptidase G2	NA	D6R401	Bacillus_phage	79.8	0.0e+00
WP_046341338.1|2175839_2177543_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	57.2	2.1e-181
WP_046341339.1|2177557_2178397_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	57.6	2.2e-91
WP_083059059.1|2178390_2182878_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.7	1.3e-65
2182460:2182478	attL	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
WP_014418189.1|2183074_2183452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083059057.1|2183517_2184126_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	35.5	3.7e-24
WP_083059055.1|2184140_2184524_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_025852578.1|2184520_2184919_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_025852580.1|2184915_2185233_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	4.9e-12
WP_025852582.1|2185222_2185525_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	44.0	3.6e-12
WP_060560124.1|2185542_2185959_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	50.6	1.7e-12
WP_038458896.1|2185981_2187274_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	48.7	3.1e-92
WP_046341349.1|2187312_2187939_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	77.7	3.3e-84
WP_046341350.1|2187901_2189182_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.1	1.6e-154
WP_014418199.1|2189186_2189357_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	61.8	7.9e-09
WP_046341351.1|2189370_2191080_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	63.1	2.2e-207
WP_046341352.1|2191076_2191592_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	42.3	5.4e-32
WP_046341353.1|2191819_2192185_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	1.0e-29
WP_154018702.1|2192189_2192351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863621.1|2192491_2193211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863619.1|2193233_2194046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863616.1|2194235_2194448_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	43.9	3.8e-08
WP_162839616.1|2194710_2194860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046341354.1|2194994_2195207_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	2.5e-12
WP_014304494.1|2195505_2195643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046341355.1|2195748_2196264_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	6.8e-27
WP_046341357.1|2196488_2196929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131242019.1|2196977_2197211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046341359.1|2197447_2197801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083059051.1|2197939_2198197_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	40.5	1.7e-07
WP_025852610.1|2198232_2198436_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	70.3	2.8e-21
WP_165869030.1|2198517_2198682_-	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	68.0	5.1e-13
WP_047935875.1|2198732_2199161_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	3.0e-44
WP_131242021.1|2199396_2200344_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.2	3.2e-54
WP_083059049.1|2200228_2200930_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	33.8	7.6e-05
WP_079891319.1|2201127_2201865_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2P1JU03	Anoxybacillus_phage	42.4	4.8e-42
WP_025852621.1|2201884_2202805_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	64.0	4.5e-90
WP_038458929.1|2202801_2202990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046341367.1|2203091_2203289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418217.1|2203285_2203543_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	39.8	1.1e-09
WP_014418218.1|2203539_2204112_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.9	4.7e-61
WP_046341368.1|2204169_2204898_-	Rha family transcriptional regulator	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	68.3	3.0e-89
WP_032863594.1|2204894_2205209_-	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	49.3	1.9e-11
WP_076983071.1|2205221_2205470_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043021753.1|2205640_2206021_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	42.7	3.3e-10
WP_038458937.1|2206383_2207580_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	43.9	5.5e-80
WP_052586183.1|2207623_2208928_-	purine permease	NA	NA	NA	NA	NA
WP_058906135.1|2208924_2209509_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025852639.1|2209840_2211343_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_017418013.1|2211454_2213374_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	2.3e-11
WP_003153550.1|2213477_2213669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003153548.1|2213835_2213988_+	YpzG family protein	NA	NA	NA	NA	NA
WP_024085525.1|2214028_2215195_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003153541.1|2215728_2216028_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_014305282.1|2216107_2216656_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003153539.1|2216744_2216981_-|coat	spore coat protein	coat	NA	NA	NA	NA
2222533:2222551	attR	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
>prophage 6
NZ_CP053376	Bacillus amyloliquefaciens strain WF02 chromosome, complete genome	4026648	2308533	2314786	4026648		Staphylococcus_phage(66.67%)	9	NA	NA
WP_003153378.1|2308533_2309127_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_003153377.1|2309116_2309872_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153376.1|2310079_2310169_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153375.1|2310256_2310778_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2310843_2311218_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2311334_2311799_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_024085543.1|2311831_2313028_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_003153370.1|2313042_2313690_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_024085544.1|2313670_2314786_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.9	5.2e-56
>prophage 7
NZ_CP053376	Bacillus amyloliquefaciens strain WF02 chromosome, complete genome	4026648	2666151	2725937	4026648	coat,protease,tRNA	uncultured_Mediterranean_phage(25.0%)	60	NA	NA
WP_007408194.1|2666151_2666595_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003152716.1|2666607_2668812_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_003152714.1|2668969_2669482_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_024085650.1|2669487_2671848_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	1.1e-90
WP_003152709.1|2671903_2672230_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_014305499.1|2672293_2672791_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_003152704.1|2672922_2675142_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	2.0e-27
WP_003152702.1|2675178_2675475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152700.1|2675590_2677147_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_003152699.1|2677154_2677811_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003152697.1|2677977_2678364_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2678415_2678676_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_014305500.1|2678707_2679853_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_003152692.1|2679880_2680909_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_015387898.1|2680934_2681135_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152685.1|2681127_2682132_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
WP_003152683.1|2682142_2682748_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_012118093.1|2682882_2683392_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015387897.1|2683524_2683764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152677.1|2683777_2684371_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_014305504.1|2684518_2685724_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_024085652.1|2685850_2686954_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_003152672.1|2686955_2687804_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_024085653.1|2687785_2689351_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_024085654.1|2689456_2690608_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	26.8	1.7e-30
WP_024085655.1|2690604_2691147_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003152668.1|2691175_2692033_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003152667.1|2692046_2692490_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003152665.1|2692543_2693830_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003152664.1|2693861_2694440_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152662.1|2694757_2695042_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_024085656.1|2695054_2695396_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2695398_2695707_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014305510.1|2695852_2696719_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_007408168.1|2696711_2697515_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2697642_2698446_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003152653.1|2698448_2699129_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003152650.1|2699182_2699701_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003152649.1|2699697_2700561_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003152647.1|2700591_2701605_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_003152646.1|2701696_2702392_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_014305513.1|2702423_2702993_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_024085657.1|2703133_2704135_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003152643.1|2704261_2705014_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_024085658.1|2705153_2706446_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003152640.1|2706504_2709147_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.2	3.7e-161
WP_003152639.1|2709599_2709791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024085659.1|2709805_2710828_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_171451262.1|2710861_2712658_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003152633.1|2712790_2714080_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003152632.1|2714108_2715083_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_024085661.1|2715085_2715868_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003152630.1|2715857_2716799_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003152629.1|2716833_2717664_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_015387890.1|2717671_2719039_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014305520.1|2719233_2719725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152626.1|2719757_2720345_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003152624.1|2720341_2722666_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.3	8.0e-184
WP_003152622.1|2722865_2724524_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_003152620.1|2724674_2725937_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
>prophage 8
NZ_CP053376	Bacillus amyloliquefaciens strain WF02 chromosome, complete genome	4026648	3102156	3187461	4026648	bacteriocin,coat,terminase,head,holin,integrase,protease,capsid,tail,portal,plate	Bacillus_phage(40.91%)	99	3148295:3148330	3184381:3184416
WP_003151973.1|3102156_3102492_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_014305740.1|3102559_3103132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085752.1|3103539_3103839_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014305743.1|3103878_3104640_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003151967.1|3104782_3105145_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	44.9	1.4e-18
WP_014305744.1|3105222_3106077_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_024085753.1|3106200_3107418_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	23.2	2.0e-13
WP_007408721.1|3107551_3107788_-	YuzB family protein	NA	NA	NA	NA	NA
WP_003151959.1|3108054_3109122_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003151957.1|3109159_3109486_-	YuzD family protein	NA	NA	NA	NA	NA
WP_169510385.1|3109565_3109901_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	42.4	3.7e-10
WP_003151941.1|3109941_3111918_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_003151940.1|3112021_3112951_-	homoserine kinase	NA	NA	NA	NA	NA
WP_015387765.1|3112947_3114006_-	threonine synthase	NA	NA	NA	NA	NA
WP_003151938.1|3114005_3115307_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_031306537.1|3115508_3116525_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_014305750.1|3116679_3117180_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.4	5.2e-40
WP_024085754.1|3117208_3117979_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_003151930.1|3118012_3118447_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003151928.1|3118472_3118748_-	YutD family protein	NA	NA	NA	NA	NA
WP_003151923.1|3118966_3119863_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_024085755.1|3120064_3121042_+	M23 family metallopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.2	7.9e-08
WP_024085756.1|3121079_3121838_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_024085757.1|3121964_3123359_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_015387760.1|3123376_3124198_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014305754.1|3124217_3125069_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_015387759.1|3125095_3125449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085758.1|3125521_3126886_-	allantoinase	NA	NA	NA	NA	NA
WP_024085759.1|3127065_3128661_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024085761.1|3129053_3129659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151906.1|3130778_3131975_-	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	20.5	4.5e-05
WP_046341409.1|3132096_3133350_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024085764.1|3133368_3134610_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_003151902.1|3134829_3135699_+	ribonuclease	NA	NA	NA	NA	NA
WP_015387756.1|3135748_3136855_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	46.1	5.6e-18
WP_003151898.1|3137010_3137739_+	transcriptional regulator PhoB	NA	NA	NA	NA	NA
WP_015387755.1|3137763_3138618_-	fructosamine kinase	NA	NA	NA	NA	NA
WP_003151895.1|3138631_3139516_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_024085765.1|3139520_3140399_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_024085766.1|3140435_3141701_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003151892.1|3141774_3142761_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-11
WP_024085767.1|3142957_3143884_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007410095.1|3144155_3144428_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_003151888.1|3144466_3144841_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_003151885.1|3144907_3146023_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_041482380.1|3146060_3146762_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	28.0	2.1e-10
WP_003151879.1|3147432_3148269_+	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.4	3.4e-20
3148295:3148330	attL	GGTTTTACTATTAACCGATGGAGCCTTCCATTTCGA	NA	NA	NA	NA
WP_047936147.1|3148475_3148628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083058955.1|3148667_3149234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131242031.1|3149547_3150711_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	49.8	1.5e-69
WP_015239640.1|3150755_3151178_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	89.5	3.8e-60
WP_073982130.1|3151214_3151370_-	XkdX family protein	NA	A0A1W6JQ64	Staphylococcus_phage	58.1	4.0e-07
WP_083058853.1|3151371_3151755_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	56.7	1.1e-29
WP_083058855.1|3151751_3152984_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	79.8	2.1e-138
WP_083058858.1|3152997_3155574_-	peptidase G2	NA	D6R401	Bacillus_phage	51.7	9.0e-245
WP_083058859.1|3155578_3157465_-|tail	phage tail protein	tail	M5AC19	Bacillus_phage	36.7	7.7e-36
WP_083058862.1|3157477_3158308_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_083058863.1|3158311_3162550_-|tail	phage tail tape measure protein	tail	A0A0S2SXL7	Bacillus_phage	32.1	2.1e-65
WP_083058866.1|3162749_3163130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058867.1|3163129_3163768_-	hypothetical protein	NA	A0A1J0MFV0	Staphylococcus_phage	32.6	2.8e-14
WP_083058870.1|3163767_3164151_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_083058871.1|3164156_3164564_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_083058874.1|3164547_3164892_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_083058875.1|3164872_3165145_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	44.4	6.5e-13
WP_083058878.1|3165128_3166415_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	52.3	1.0e-87
WP_165869031.1|3166411_3167002_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	58.9	2.6e-54
WP_083058882.1|3166991_3168170_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	54.8	4.6e-111
WP_083058883.1|3168181_3169915_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	51.5	1.3e-167
WP_083058906.1|3169911_3170316_-|terminase	P27 family phage terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	39.7	6.1e-23
WP_083058886.1|3170393_3170762_-	HNH endonuclease	NA	A0A1B0T6C5	Bacillus_phage	52.8	1.9e-31
WP_083058888.1|3170758_3170977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058908.1|3171011_3171293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058890.1|3172082_3172295_-	hypothetical protein	NA	A0A0K2CPG8	Brevibacillus_phage	56.8	1.8e-05
WP_017417279.1|3172911_3173454_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	59.4	1.8e-54
WP_083058959.1|3173450_3173903_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	58.1	5.7e-38
WP_083058946.1|3174255_3174531_-	hypothetical protein	NA	Q38076	Bacillus_phage	37.1	5.8e-09
WP_083058944.1|3174520_3174868_-	hypothetical protein	NA	Q9ZXC0	Bacillus_phage	88.1	7.2e-49
WP_083058942.1|3174954_3175695_-	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	68.8	6.9e-89
WP_083058940.1|3175790_3176045_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.0	1.5e-06
WP_083058938.1|3176041_3176449_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	43.5	4.7e-23
WP_083058937.1|3176445_3176826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085436.1|3176966_3177170_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
WP_165869032.1|3177249_3177405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387918.1|3177417_3177558_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_083058934.1|3177665_3178214_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.7e-05
WP_165869033.1|3178210_3178369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165869034.1|3178365_3178515_-	type VI secretion system contractile sheath protein TssC	NA	NA	NA	NA	NA
WP_046560205.1|3178529_3179363_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	34.8	2.7e-33
WP_083058933.1|3179346_3180225_-	conserved phage C-terminal domain-containing protein	NA	A0A0U3TZZ4	Bacillus_phage	49.4	1.4e-61
WP_083058930.1|3180217_3180448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058928.1|3180416_3180647_-	hypothetical protein	NA	R9TQ08	Paenibacillus_phage	64.9	4.5e-15
WP_165869037.1|3180688_3180892_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083058926.1|3181069_3181459_+	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	35.9	9.4e-05
WP_083058924.1|3181686_3181884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058922.1|3181880_3183005_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	29.2	1.4e-21
WP_083058920.1|3183281_3184319_+|integrase	site-specific integrase	integrase	A0A1J0MF14	Staphylococcus_phage	46.6	1.2e-86
WP_003151878.1|3184390_3185788_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
3184381:3184416	attR	GGTTTTACTATTAACCGATGGAGCCTTCCATTTCGA	NA	NA	NA	NA
WP_003151877.1|3185807_3186251_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_007410089.1|3186240_3187461_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.6	6.8e-118
>prophage 9
NZ_CP053376	Bacillus amyloliquefaciens strain WF02 chromosome, complete genome	4026648	3296255	3348369	4026648	terminase,head,holin,integrase,protease,capsid,tail,portal,plate	Bacillus_phage(68.09%)	71	3294723:3294747	3334083:3334107
3294723:3294747	attL	GTTATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_063636433.1|3296255_3297419_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.2	3.9e-70
WP_063636434.1|3297465_3297888_-|holin	holin family protein	holin	D6R405	Bacillus_phage	98.5	2.3e-65
WP_043867136.1|3297939_3298128_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	98.4	8.2e-31
WP_063636435.1|3298124_3298487_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	91.7	4.9e-56
WP_063636436.1|3298483_3299761_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	82.1	4.0e-153
WP_063636437.1|3299777_3302339_-	peptidase G2	NA	D6R401	Bacillus_phage	97.3	0.0e+00
WP_063636438.1|3302378_3304082_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	99.1	6.3e-312
WP_063636439.1|3304093_3304933_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	93.5	1.7e-152
WP_083058952.1|3304932_3308808_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	88.5	0.0e+00
WP_065180836.1|3309008_3309347_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	94.6	1.2e-53
WP_065180837.1|3309398_3310007_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	82.2	8.4e-93
WP_065180838.1|3310007_3310388_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	95.2	2.9e-59
WP_065180839.1|3310384_3310768_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	96.9	2.7e-65
WP_039251289.1|3310760_3311120_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	96.6	8.0e-59
WP_065180840.1|3311052_3311400_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	97.4	1.1e-57
WP_065180841.1|3311414_3311825_-	hypothetical protein	NA	D6R3Z0	Bacillus_phage	67.4	6.8e-38
WP_065180842.1|3311852_3312161_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	96.0	4.8e-44
WP_065180843.1|3312174_3313377_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	72.5	7.8e-159
WP_065180844.1|3313416_3314043_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	98.6	2.2e-112
WP_048367364.1|3314032_3315283_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	98.3	7.7e-242
WP_063636448.1|3315530_3317240_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	96.7	0.0e+00
WP_046559655.1|3317239_3317746_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	95.8	3.1e-85
WP_063636449.1|3317832_3318159_-	hypothetical protein	NA	Q9T203	Bacillus_phage	97.2	1.1e-54
WP_083058950.1|3318127_3318502_-	HNH endonuclease	NA	Q38456	Bacillus_phage	93.5	2.6e-68
WP_052364764.1|3318501_3319110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058948.1|3319099_3319345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017417279.1|3319948_3320491_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	59.4	1.8e-54
WP_017417278.1|3320487_3320940_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
WP_017417277.1|3320958_3321135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017417276.1|3321240_3321675_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	4.1e-49
WP_026092239.1|3321677_3321923_-	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
WP_017417274.1|3321919_3322228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017417272.1|3322417_3322621_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	44.8	2.1e-08
WP_063636452.1|3322636_3322864_-	hypothetical protein	NA	A0A217EQZ3	Bacillus_phage	63.5	2.0e-23
WP_063636453.1|3322860_3323163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063636454.1|3323164_3323842_-	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	46.7	4.3e-37
WP_063636455.1|3323838_3324162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058892.1|3324272_3325283_-	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	43.2	6.1e-64
WP_083058894.1|3325287_3325542_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.3	1.9e-06
WP_083058896.1|3325538_3325946_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	44.3	9.5e-24
WP_083058900.1|3326339_3326543_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.7	2.6e-14
WP_164967571.1|3326622_3326778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387918.1|3326790_3326931_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_065180849.1|3327039_3327588_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_024085441.1|3327739_3327889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063636460.1|3327903_3328734_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.6	8.4e-35
WP_063636461.1|3328717_3329584_-	hypothetical protein	NA	D2XR43	Bacillus_phage	62.4	1.1e-50
WP_049627410.1|3329576_3329807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049627411.1|3329824_3330148_-	DUF771 domain-containing protein	NA	A0A1B1IME6	Lactococcus_phage	38.0	5.6e-11
WP_063636462.1|3330167_3330359_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.7	2.7e-13
WP_063636586.1|3330394_3330598_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047936207.1|3330760_3331159_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049627412.1|3331585_3332686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047936209.1|3332946_3334011_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	65.3	3.6e-131
WP_003151688.1|3334618_3335089_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	7.0e-47
3334083:3334107	attR	GTTATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_024085805.1|3335228_3337562_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.4	7.0e-87
WP_024085806.1|3337580_3338321_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003151681.1|3338439_3338670_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_087920807.1|3338793_3338979_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003151677.1|3339175_3339586_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.0	7.8e-18
WP_003151674.1|3339610_3340042_+	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	64.2	6.5e-15
WP_003151672.1|3340123_3340441_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024085807.1|3340525_3341929_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003151668.1|3341919_3342582_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024085808.1|3342603_3343374_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_014305836.1|3343370_3344105_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_003151665.1|3344101_3344815_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.1	2.5e-56
WP_007613829.1|3344925_3345603_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014305837.1|3345621_3346539_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003151662.1|3346553_3347207_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024085809.1|3347223_3348369_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	1.5e-13
