The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051218	Salmonella sp. SCFS4 chromosome, complete genome	4988969	664832	793297	4988969	holin,transposase,integrase,lysis,terminase,capsid,portal,tail,plate,head,tRNA	Salmonella_phage(40.45%)	139	674033:674054	795606:795627
WP_023226578.1|664832_665231_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|665233_665539_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|665580_665949_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917512.1|666093_666477_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|666480_667143_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|667592_668837_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|669091_670060_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_023226577.1|670329_671328_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951045.1|671415_672108_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|672259_672757_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_023226576.1|672842_673979_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
674033:674054	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_023226575.1|674059_676078_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|676248_677628_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_000094645.1|678057_679578_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_000478462.1|680742_682311_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
WP_089541743.1|682307_682955_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023226573.1|683186_683954_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_001748617.1|684164_685202_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|685188_686082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|686110_686689_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|686808_687030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|687060_687564_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|687573_687801_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|687790_688216_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|688215_688617_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|688763_688940_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|688930_689527_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|689523_689853_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|689842_690703_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|690699_692721_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|692840_693047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|693020_693344_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|693340_694402_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|694398_696174_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|696334_697135_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|697196_698219_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|698222_698927_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|698930_699125_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_023181179.1|699221_699674_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	2.3e-63
WP_000084220.1|699670_700177_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|700173_700881_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|700877_702005_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|702001_702457_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|702466_702760_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|702756_703098_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|703097_703430_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|703576_703834_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|704021_705992_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|705988_706318_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136922.1|706314_707499_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.1	2.0e-178
WP_001001827.1|707491_708079_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	81.5	2.1e-88
WP_149427444.1|708088_710101_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_051129144.1|710103_710634_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	33.0	8.9e-14
WP_000267954.1|710623_711349_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|711320_711866_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000977529.1|711865_713569_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_001128281.1|714156_714318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290290.1|714782_716099_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	3.5e-35
WP_000268404.1|716228_716825_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
WP_000256688.1|716907_718512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265818.1|719290_719518_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001354442.1|719580_720327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001428286.1|720608_721109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000628304.1|721490_722105_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000287905.1|722132_722699_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001360193.1|722905_723892_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	2.2e-167
WP_000053329.1|724317_725328_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	28.3	5.1e-18
WP_000433621.1|725421_727548_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001099189.1|727602_728880_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813683.1|728876_730307_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_000523728.1|730370_730886_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001313182.1|730891_731095_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001313183.1|731156_731468_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000108760.1|731497_732424_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000716410.1|732523_734020_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_001189119.1|736515_738024_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	2.3e-43
WP_001065545.1|738818_739997_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_001060305.1|739989_742035_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_001385107.1|742031_744818_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	33.2	2.8e-119
WP_000282126.1|746288_746471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024214938.1|746801_747674_+	GTPase family protein	NA	NA	NA	NA	NA
WP_024214937.1|748045_750892_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001117566.1|750962_751196_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234397.1|751285_752104_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	5.2e-45
WP_024214936.1|752195_752681_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	9.0e-13
WP_001384029.1|752696_753173_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692334.1|753241_753463_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	7.2e-10
WP_000086744.1|753477_754122_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	33.8	3.4e-28
WP_001360188.1|754171_754540_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854801.1|754629_755007_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000761658.1|755003_755492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839269.1|755503_755701_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_015386347.1|756889_757903_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
WP_015386349.1|758129_758744_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.6	7.8e-38
WP_015386350.1|758845_759082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015386351.1|759116_759626_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
WP_015386352.1|759633_759834_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_000963477.1|759797_760139_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	86.7	2.6e-51
WP_001744223.1|760206_760440_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
WP_039505139.1|760439_760667_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	1.9e-34
WP_079792110.1|760663_761515_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.9	8.1e-118
WP_039505137.1|761511_763905_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	90.3	0.0e+00
WP_001154443.1|764066_764255_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_001217561.1|764266_764500_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_079964945.1|765421_765619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053216775.1|765698_765878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053216774.1|765931_766981_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	80.6	7.1e-156
WP_017382378.1|766980_768744_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
WP_053216773.1|768893_769721_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	56.0	1.3e-72
WP_053216772.1|769736_770885_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	69.1	1.6e-132
WP_006777754.1|770888_771542_+|terminase	Small terminase subunit	terminase	E5G6M7	Salmonella_phage	56.1	5.2e-56
WP_047746799.1|771640_772108_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_000868184.1|772107_772311_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|772314_772530_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_032266129.1|772510_773020_+	lysozyme	NA	E5G6N1	Salmonella_phage	79.9	1.7e-75
WP_032266128.1|773024_773402_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	95.2	2.4e-58
WP_164848160.1|773398_773827_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
WP_001039961.1|773922_774354_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_039505111.1|774346_774793_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	1.7e-66
WP_023223445.1|774861_775440_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.9	2.6e-107
WP_023223444.1|775436_775796_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	92.4	1.4e-55
WP_023223443.1|775782_776691_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	92.1	8.3e-145
WP_039505106.1|776683_777211_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	84.1	8.1e-84
WP_053216770.1|777218_779120_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	76.8	5.1e-96
WP_023223490.1|779145_779556_+|tail	tail fiber assembly protein	tail	A0A291LAV4	Bordetella_phage	28.6	2.6e-05
WP_039505102.1|779689_780862_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	95.1	1.1e-213
WP_039505100.1|780871_781387_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	6.7e-91
WP_032233623.1|781441_781744_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	94.9	1.5e-42
WP_000763315.1|781758_781878_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_164848159.1|782104_784648_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	45.0	1.3e-107
WP_058800071.1|784644_785130_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	1.5e-71
WP_058800072.1|785126_786227_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.6	3.4e-185
WP_039505088.1|786295_786514_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	80.6	5.2e-29
WP_039505087.1|786529_786904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|787232_787739_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|787862_789710_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|789859_791605_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|791840_792056_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|792283_793297_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
795606:795627	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP051218	Salmonella sp. SCFS4 chromosome, complete genome	4988969	1360838	1442224	4988969	holin,integrase,terminase,capsid,portal,tail,plate,head,tRNA	Cronobacter_phage(51.22%)	82	1368815:1368830	1396505:1396520
WP_000469807.1|1360838_1361606_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1361646_1361994_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1362149_1363370_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1363362_1363881_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1364320_1365391_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1365400_1366522_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1366579_1367488_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1367448_1368609_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1368708_1368756_-	hypothetical protein	NA	NA	NA	NA	NA
1368815:1368830	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1368919_1369912_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1369978_1370278_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1370386_1370725_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1370750_1371083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1371092_1371662_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1371664_1371883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1371921_1374579_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_001264830.1|1374606_1374876_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	78.4	5.1e-34
WP_054175273.1|1374929_1375949_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1375945_1377730_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|1377940_1378777_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1378811_1379840_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1379851_1380550_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1380648_1381101_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_171455498.1|1381097_1381580_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.1	8.8e-37
WP_001534848.1|1381576_1382281_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1382277_1383405_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1383401_1383857_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1383869_1384166_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1384162_1384504_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_171455499.1|1384503_1384836_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	5.7e-35
WP_000411500.1|1384982_1385240_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1385427_1387395_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1387391_1387721_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136922.1|1387717_1388902_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.1	2.0e-178
WP_001001827.1|1388894_1389482_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	81.5	2.1e-88
WP_149427444.1|1389491_1391504_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_051129144.1|1391506_1392037_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	33.0	8.9e-14
WP_000267954.1|1392026_1392752_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|1392723_1393269_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000977529.1|1393268_1394972_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_001748131.1|1396005_1396392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1396549_1396888_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1396505:1396520	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1397159_1397897_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1398028_1399009_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1399005_1399737_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1399866_1402440_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1408473_1408929_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1409032_1410334_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1410330_1410654_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1410698_1412054_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1412168_1414829_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1414882_1415563_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1415635_1416055_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_171455500.1|1416258_1417296_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1417411_1418101_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1418419_1418803_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1418864_1419452_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1419554_1420454_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1420471_1421806_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1421935_1422673_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1422657_1424280_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1424543_1424708_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1424704_1425280_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1425311_1425962_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1425961_1426918_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1426914_1427394_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1427645_1429445_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1429461_1430436_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1430709_1431390_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1431386_1432292_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1432303_1433032_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1433043_1433775_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1433774_1434155_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1434266_1434527_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1434564_1435491_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1435606_1436803_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1436824_1437742_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1437779_1438628_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1438743_1439637_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1439647_1441009_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1441012_1441648_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1441672_1442224_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP051218	Salmonella sp. SCFS4 chromosome, complete genome	4988969	1653963	1660824	4988969	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1653963_1654110_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1654125_1654269_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1655258_1657181_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1657187_1657454_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1657422_1657812_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1657923_1658628_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1659882_1660824_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 4
NZ_CP051218	Salmonella sp. SCFS4 chromosome, complete genome	4988969	1893186	1902357	4988969	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1893186_1894134_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1894117_1894849_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1894829_1894937_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1894996_1895728_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1895950_1897636_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1897632_1898352_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1898398_1898866_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1898922_1899453_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1899624_1900083_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1900323_1902357_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_CP051218	Salmonella sp. SCFS4 chromosome, complete genome	4988969	1981389	1991896	4988969		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1981389_1982793_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1982970_1983864_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1984240_1985326_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1985325_1986225_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1986272_1987151_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1987151_1987703_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1987708_1988683_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1988698_1989472_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1989476_1990556_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1990582_1991896_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP051218	Salmonella sp. SCFS4 chromosome, complete genome	4988969	2102018	2113308	4988969	integrase	Burkholderia_phage(25.0%)	12	2096272:2096287	2110619:2110634
2096272:2096287	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|2102018_2103200_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|2103200_2103947_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|2104048_2105305_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|2105785_2105947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|2106073_2106493_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|2106495_2107764_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|2108218_2108431_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2108441_2108630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|2108888_2110067_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|2110717_2111029_+	hypothetical protein	NA	NA	NA	NA	NA
2110619:2110634	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|2111108_2111804_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|2111877_2113308_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP051218	Salmonella sp. SCFS4 chromosome, complete genome	4988969	2392186	2397998	4988969		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2392186_2392993_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2392994_2393987_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2393986_2394877_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2395000_2395402_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_170967352.1|2395701_2396586_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2396895_2397165_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2397519_2397660_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2397698_2397998_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 8
NZ_CP051218	Salmonella sp. SCFS4 chromosome, complete genome	4988969	2830408	2908505	4988969	transposase,holin,integrase,protease,terminase,capsid,portal,tail,plate,head,tRNA	Salmonella_phage(65.52%)	103	2844114:2844128	2917856:2917870
WP_165488522.1|2830408_2830927_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_023226919.1|2830923_2831025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2831230_2831677_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2831656_2832451_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2832551_2833736_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2833856_2834204_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487126.1|2834189_2834501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023226918.1|2834569_2834821_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2835016_2835115_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2835253_2835502_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001669273.1|2835815_2836457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2836686_2836869_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_023226917.1|2836871_2837234_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2837406_2838045_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2838242_2838788_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000208086.1|2839102_2839351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2839604_2840453_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|2840521_2841115_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023226916.1|2841259_2842048_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_162493628.1|2842156_2842804_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2843000_2843327_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2843520_2844654_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
2844114:2844128	attL	CGATAAGCCCTTCGA	NA	NA	NA	NA
WP_023226915.1|2844735_2845326_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950207.1|2845319_2846117_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
WP_000966637.1|2846110_2846923_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001726984.1|2846912_2847887_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946099.1|2847886_2849521_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023226914.1|2850202_2850517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023226913.1|2850665_2851196_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
WP_023226912.1|2851278_2852322_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218118.1|2852660_2853128_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_077909976.1|2853325_2853553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2853752_2853878_-	lipoprotein	NA	NA	NA	NA	NA
WP_023226911.1|2854255_2854600_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_023226910.1|2855836_2856394_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_024148167.1|2857200_2857464_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2857595_2857808_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_023226908.1|2858224_2858746_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2858936_2859176_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2860049_2860859_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2860931_2861309_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2861456_2861999_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2862190_2862919_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2862935_2863349_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2864299_2865424_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2865940_2866399_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001521673.1|2866594_2866807_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
WP_080198124.1|2867055_2867574_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_080198123.1|2867576_2868818_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	94.4	6.6e-52
WP_023171039.1|2868804_2869392_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023215805.1|2869394_2870474_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	1.2e-203
WP_000605051.1|2870466_2870880_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_058800701.1|2870884_2871418_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	98.9	3.2e-96
WP_171455505.1|2871417_2872476_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	1.9e-201
WP_171455506.1|2872472_2873813_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.1	6.3e-250
WP_171455507.1|2873876_2874320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171455508.1|2874329_2876261_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	96.7	0.0e+00
WP_000588852.1|2876345_2876672_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2876668_2877025_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_064163355.1|2877024_2878521_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	99.8	3.6e-278
WP_000497756.1|2878510_2878675_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	98.1	2.2e-24
WP_063863721.1|2878678_2879239_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	98.9	1.2e-104
WP_064163354.1|2879235_2879748_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.1e-80
WP_039501164.1|2879719_2880124_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	76.9	1.0e-54
WP_064163353.1|2880120_2880444_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	1.8e-54
WP_000601360.1|2880446_2880647_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_064163352.1|2880696_2881902_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	99.5	7.7e-223
WP_001193639.1|2881916_2882567_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_064163351.1|2882544_2883786_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.0	8.5e-241
WP_000605609.1|2883785_2883968_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088185.1|2883979_2885713_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
WP_000929191.1|2885709_2886204_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135212.1|2886329_2886680_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	98.3	1.2e-64
WP_000384006.1|2886726_2887212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000778467.1|2887368_2887803_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.6	3.9e-52
WP_124835952.1|2887786_2888263_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	98.1	2.2e-88
WP_171455537.1|2888266_2888602_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	89.2	3.4e-51
WP_171455538.1|2888739_2888982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171455509.1|2889271_2890024_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	95.2	9.0e-137
WP_171455510.1|2890037_2891027_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.9	4.9e-191
WP_046376800.1|2891034_2891895_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	7.8e-161
WP_171455511.1|2891911_2892301_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	98.4	5.4e-69
WP_088758906.1|2892309_2893191_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.0	1.9e-170
WP_000054227.1|2893187_2893661_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_171455512.1|2893657_2894632_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	97.5	2.0e-165
WP_000620702.1|2894628_2894853_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_171455513.1|2894849_2895992_-	Rha family transcriptional regulator	NA	A0A1C9IHV9	Salmonella_phage	87.1	9.0e-181
WP_000509727.1|2895988_2896543_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
WP_001191666.1|2896571_2896796_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_111769351.1|2896893_2897589_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.1	8.6e-126
WP_171455514.1|2897794_2897980_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	71.1	4.4e-13
WP_000078504.1|2898055_2898307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997190.1|2898879_2899251_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_023223560.1|2899308_2900136_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.5	1.2e-150
WP_000008351.1|2900272_2900812_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023209987.1|2901613_2902087_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	9.5e-68
WP_000089141.1|2902976_2903213_+	excisionase	NA	NA	NA	NA	NA
WP_171455515.1|2903202_2904345_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	79.7	3.1e-173
WP_000444509.1|2904458_2905709_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_023227247.1|2905880_2906546_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825956.1|2906542_2906872_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|2906883_2907345_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2907398_2908505_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2917856:2917870	attR	TCGAAGGGCTTATCG	NA	NA	NA	NA
>prophage 9
NZ_CP051218	Salmonella sp. SCFS4 chromosome, complete genome	4988969	3730004	3794726	4988969	transposase,holin,protease,integrase	Streptococcus_phage(18.18%)	51	3725506:3725520	3762290:3762304
3725506:3725520	attL	AGGTAGAGGTTATCG	NA	NA	NA	NA
WP_000144692.1|3730004_3731324_+|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.2	5.6e-17
WP_096195002.1|3731416_3732265_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_085949090.1|3732349_3732547_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000854821.1|3732768_3733146_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001285610.1|3733235_3733604_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692350.1|3733683_3733905_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186711.1|3733991_3734468_-	RadC family protein	NA	NA	NA	NA	NA
WP_171455520.1|3734483_3734969_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	3.1e-13
WP_001610805.1|3735060_3735879_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	2.7e-46
WP_171455521.1|3736206_3739053_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_021527023.1|3739420_3740293_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000960228.1|3740647_3741388_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000569129.1|3741533_3741881_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171455522.1|3741971_3743042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001336040.1|3743951_3745100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021527306.1|3747507_3748110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371489.1|3748203_3748410_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_089541817.1|3748539_3749768_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_001335904.1|3750130_3750922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000453330.1|3751966_3752179_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_171455523.1|3752410_3753010_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_171455524.1|3753381_3753765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063100935.1|3753761_3754187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001193073.1|3754451_3756536_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_072662974.1|3756546_3759144_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_115209593.1|3759320_3762932_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
3762290:3762304	attR	CGATAACCTCTACCT	NA	NA	NA	NA
WP_072662972.1|3762977_3766619_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_000566901.1|3766630_3767233_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_086538008.1|3767229_3767832_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_053287614.1|3768128_3769127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548954.1|3769410_3771408_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_096194958.1|3771470_3771929_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_171455525.1|3772049_3773030_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.2	3.7e-183
WP_171455526.1|3773749_3774313_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_047928881.1|3775295_3776729_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000120392.1|3776977_3777205_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000266639.1|3777310_3777538_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_096194950.1|3778228_3779860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893225.1|3781050_3782301_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
WP_001285275.1|3782312_3783416_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3783698_3784751_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
WP_000174693.1|3784801_3785203_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_051129355.1|3785260_3786505_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001292018.1|3786593_3787052_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023227321.1|3787300_3788758_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602086.1|3788912_3789527_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_023227322.1|3789523_3790663_-	RNA ligase RtcB family protein	NA	A0A222ZM82	Mycobacterium_phage	30.5	1.0e-30
WP_001226204.1|3790881_3791937_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_023227323.1|3792186_3792927_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333387.1|3792897_3793665_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_023226548.1|3793739_3794726_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
