The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053337	Lactobacillus paraplantarum strain CK401 chromosome, complete genome	3164408	902	50049	3164408	lysis,transposase,portal,plate,protease,tail,capsid,tRNA	Lactobacillus_phage(46.43%)	56	NA	NA
WP_171284678.1|902_2369_+|portal	phage portal protein	portal	X2CY64	Lactobacillus_phage	56.1	5.8e-140
WP_103127098.1|2355_4026_+|capsid	minor capsid protein	capsid	A9D9S7	Lactobacillus_prophage	43.5	1.5e-78
WP_056988255.1|4012_4264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988256.1|4411_4966_+	phage scaffolding protein	NA	X2CYF9	Lactobacillus_phage	56.8	8.9e-49
WP_056988257.1|4978_6019_+	hypothetical protein	NA	Q20DD4	Lactobacillus_phage	73.4	2.4e-140
WP_056988258.1|6032_6422_+	hypothetical protein	NA	X2CXX4	Lactobacillus_phage	42.6	5.9e-23
WP_056988259.1|6418_6814_+	hypothetical protein	NA	A9D9T8	Lactobacillus_prophage	63.3	6.8e-35
WP_056988260.1|6794_7193_+	HK97 gp10 family phage protein	NA	A0A0A7RVN8	Clostridium_phage	28.7	8.1e-12
WP_056988261.1|7202_7616_+	hypothetical protein	NA	A9D9U4	Lactobacillus_prophage	36.3	6.9e-22
WP_056988262.1|7608_7800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171284585.1|7800_9258_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q20DC8	Lactobacillus_phage	46.2	3.4e-100
WP_056944246.1|9172_10093_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	7.1e-35
WP_056988264.1|10227_10710_+|tail	phage tail tube protein	tail	Q20DC7	Lactobacillus_phage	74.5	3.0e-61
WP_056988265.1|10723_11155_+	hypothetical protein	NA	S6B9X5	Thermus_phage	33.8	4.5e-08
WP_056988266.1|11386_15070_+	hypothetical protein	NA	X2CYG3	Lactobacillus_phage	35.9	2.7e-08
WP_056988267.1|15085_15778_+	hypothetical protein	NA	L0P8M9	Lactobacillus_phage	45.3	1.1e-35
WP_056988268.1|15781_16801_+	hypothetical protein	NA	L0P6D8	Lactobacillus_phage	41.2	3.5e-59
WP_103127101.1|16831_17107_+	DUF2577 domain-containing protein	NA	A9D9W8	Lactobacillus_prophage	35.2	1.5e-12
WP_082618897.1|17117_17549_+	DUF2634 domain-containing protein	NA	A9D9X1	Lactobacillus_prophage	51.3	9.1e-25
WP_056988270.1|17538_18687_+|plate	baseplate J/gp47 family protein	plate	L0P7C2	Lactobacillus_phage	56.3	8.1e-121
WP_056988271.1|18679_19321_+	DUF2313 domain-containing protein	NA	Q9AZ88	Lactobacillus_prophage	42.1	2.5e-26
WP_056988272.1|19321_20155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988273.1|20271_21099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988274.1|21150_22110_+	hypothetical protein	NA	A0A1B1IN44	Lactococcus_phage	33.2	6.5e-15
WP_146029293.1|22111_22453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120247159.1|22452_22620_+	XkdX family protein	NA	NA	NA	NA	NA
WP_056988276.1|22711_23122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988277.1|23135_23519_+	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	63.5	2.1e-41
WP_056988279.1|23729_24014_+|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	54.3	3.7e-19
WP_056988280.1|24013_24922_+	SH3 domain-containing protein	NA	A0A2P0ZLG2	Lactobacillus_phage	76.9	4.5e-98
WP_021732299.1|25662_26874_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_021732298.1|27352_29095_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_021732297.1|29113_29905_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	7.0e-31
WP_080235726.1|29885_31070_+	LCP family protein	NA	NA	NA	NA	NA
WP_021732295.1|31429_32371_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	48.7	3.1e-78
WP_021732294.1|32847_33240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021732293.1|33404_33797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021732292.1|33832_35002_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_021732291.1|35048_35678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021732290.1|35777_36431_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003640747.1|36530_37163_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_021732289.1|37296_37554_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_080235722.1|37651_37888_+	YneF family protein	NA	NA	NA	NA	NA
WP_021730789.1|37946_38585_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_021730790.1|38697_39453_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_021730791.1|39439_39745_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003640741.1|39829_40828_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_021730792.1|41067_41790_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_021730793.1|42013_42817_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_021730794.1|42919_43798_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_021730795.1|43997_44720_+	UMP kinase	NA	NA	NA	NA	NA
WP_021730796.1|44721_45285_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_021730797.1|45404_46184_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.8	3.7e-24
WP_021730798.1|46199_46985_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_021730799.1|47022_48300_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_021730800.1|48339_50049_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP053337	Lactobacillus paraplantarum strain CK401 chromosome, complete genome	3164408	581262	593081	3164408		Lactobacillus_phage(75.0%)	8	NA	NA
WP_021731391.1|581262_582552_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	49.6	9.5e-102
WP_171284599.1|582581_584864_+	HAD-IC family P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	24.2	3.3e-33
WP_021731388.1|585273_587175_-	outer membrane protein	NA	A0A2P0ZL91	Lactobacillus_phage	76.6	5.0e-59
WP_021731387.1|587577_588018_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	94.5	6.3e-74
WP_021731386.1|588086_588647_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	93.0	2.8e-95
WP_056988701.1|588734_591173_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	96.7	0.0e+00
WP_021731384.1|591175_591790_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	97.1	1.3e-109
WP_021731383.1|592133_593081_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	95.9	1.4e-171
>prophage 3
NZ_CP053337	Lactobacillus paraplantarum strain CK401 chromosome, complete genome	3164408	1184867	1193578	3164408		Streptococcus_phage(66.67%)	11	NA	NA
WP_021731227.1|1184867_1185863_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	7.7e-51
WP_021731228.1|1185996_1186782_-	oleoyl-[acyl-carrier protein] thioesterase	NA	NA	NA	NA	NA
WP_021731229.1|1186785_1187682_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.3	4.9e-81
WP_021731230.1|1187781_1188129_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	5.4e-12
WP_021731231.1|1188153_1189173_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.2	4.8e-32
WP_003640965.1|1189189_1189519_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_021731232.1|1189515_1190181_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.2	2.5e-53
WP_021731234.1|1190669_1190921_-	YaaL family protein	NA	NA	NA	NA	NA
WP_021731235.1|1190935_1191535_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|1191550_1191859_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_021731236.1|1191880_1193578_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.0e-55
>prophage 4
NZ_CP053337	Lactobacillus paraplantarum strain CK401 chromosome, complete genome	3164408	1327108	1433034	3164408	bacteriocin,transposase,protease,tRNA	uncultured_Mediterranean_phage(15.38%)	97	NA	NA
WP_021731861.1|1327108_1328407_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.8	2.2e-42
WP_003637671.1|1328540_1328786_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_021731863.1|1328912_1330205_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_003642050.1|1330234_1331515_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_021731865.1|1332972_1333167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021731867.1|1333998_1334727_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_021731868.1|1334877_1335777_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_021731869.1|1335796_1336450_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_021731870.1|1336801_1338082_-	serine transporter	NA	NA	NA	NA	NA
WP_021731871.1|1338433_1339705_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	2.9e-95
WP_021731872.1|1340184_1341798_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.4	3.9e-145
WP_021731873.1|1341971_1342580_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_021731874.1|1342624_1343065_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_021731876.1|1343538_1344348_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_171284682.1|1344356_1345715_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_021731878.1|1345735_1346545_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_021731880.1|1346927_1347914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021731881.1|1347996_1349019_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|1349308_1350289_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_021731882.1|1350678_1351503_-	serine hydrolase	NA	NA	NA	NA	NA
WP_021731883.1|1351672_1353055_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	32.4	3.7e-27
WP_021731884.1|1353123_1353960_-	pur operon repressor	NA	NA	NA	NA	NA
WP_033609531.1|1354436_1355234_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_021731887.1|1355226_1355925_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.5	2.8e-15
WP_021731888.1|1356217_1357162_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021731889.1|1357461_1358328_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|1358459_1358711_-	Veg family protein	NA	NA	NA	NA	NA
WP_033609513.1|1358815_1359706_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_033609514.1|1359702_1360266_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_021731892.1|1360252_1361029_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_021731893.1|1361171_1361912_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_021731894.1|1362000_1362414_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021731895.1|1362482_1363664_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_021731896.1|1363899_1365951_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.3	1.8e-91
WP_021731897.1|1366278_1367121_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_021731898.1|1367120_1367825_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_021731899.1|1367846_1368806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021731900.1|1368798_1370073_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_011101010.1|1370100_1371018_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_021731901.1|1371434_1372448_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_021731902.1|1372560_1373307_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021731903.1|1373458_1374355_-	ROK family protein	NA	NA	NA	NA	NA
WP_021731904.1|1374475_1375912_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	6.3e-30
WP_033609533.1|1375929_1377285_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|1377507_1377930_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|1377919_1378108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021731906.1|1378114_1379476_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_021731907.1|1379548_1380259_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021731908.1|1380649_1381666_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021731909.1|1382103_1382880_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_021731910.1|1383138_1385448_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033609515.1|1385540_1385744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021731911.1|1385899_1386586_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_033609516.1|1386681_1387362_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021731913.1|1387449_1388118_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021731914.1|1388185_1388875_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021731915.1|1388965_1390342_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_021731916.1|1390358_1392509_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	4.7e-45
WP_003641985.1|1392774_1392945_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_033609517.1|1392969_1393128_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_021731918.1|1393221_1393995_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021731919.1|1394298_1395042_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_021731920.1|1395161_1395905_-	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033609518.1|1395905_1397234_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003641979.1|1397424_1397571_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_021731922.1|1398416_1398572_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_021731923.1|1398595_1398754_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_021731924.1|1400171_1400840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021731925.1|1402005_1403277_-	glycosyltransferase	NA	A0A0P0YMN8	Yellowstone_lake_mimivirus	27.1	2.1e-05
WP_021731926.1|1403361_1403523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021731927.1|1403563_1403848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021731928.1|1404368_1405553_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_021731929.1|1405597_1406974_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_021731930.1|1407487_1408315_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021731931.1|1408474_1409347_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021731932.1|1409417_1410209_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_021731933.1|1410212_1411373_+	MFS transporter	NA	NA	NA	NA	NA
WP_021731934.1|1411376_1411994_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_021731935.1|1412081_1412492_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_021731936.1|1412491_1413061_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003641945.1|1413802_1414525_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_021731938.1|1414539_1416369_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_021731939.1|1416383_1417901_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_021731940.1|1418380_1419712_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021731941.1|1419790_1420762_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.1e-22
WP_056988338.1|1420762_1422289_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_021731943.1|1422526_1422973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021731944.1|1423276_1424188_-	oxidoreductase	NA	NA	NA	NA	NA
WP_021731945.1|1424324_1425245_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_021731946.1|1425411_1425984_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003646440.1|1426561_1427032_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_021731948.1|1427141_1428338_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|1428368_1428878_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_021731949.1|1429007_1429376_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_021731950.1|1429955_1431461_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_021731951.1|1431608_1432277_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_021731952.1|1432470_1433034_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP053337	Lactobacillus paraplantarum strain CK401 chromosome, complete genome	3164408	2813567	2872670	3164408	integrase,holin,terminase,portal,protease,tail,capsid,head	Lactobacillus_phage(37.21%)	73	2813369:2813390	2842577:2842592
2813369:2813390	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_171284655.1|2813567_2814725_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	5.0e-54
2813369:2813390	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_050480186.1|2814774_2815425_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	46.5	4.7e-09
WP_027822981.1|2815600_2815783_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027823047.1|2816051_2816282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089197950.1|2816295_2817096_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_171284656.1|2817095_2818490_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	36.0	1.1e-68
WP_027822990.1|2818636_2819056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171284657.1|2819079_2819391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063489182.1|2819377_2819719_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_171284658.1|2819711_2820101_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	46.1	2.1e-20
WP_021356979.1|2820909_2821383_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_171284659.1|2821379_2823083_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.7	3.7e-122
WP_171284660.1|2823237_2824338_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.2	2.1e-49
WP_171284661.1|2824334_2825873_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.4	6.3e-44
WP_171284662.1|2826069_2826339_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_171284663.1|2826521_2826893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171284664.1|2826975_2827281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021732652.1|2827700_2827907_+	hypothetical protein	NA	NA	NA	NA	NA
2827373:2827394	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_021732651.1|2828256_2829378_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.7	9.9e-47
2827373:2827394	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_021732650.1|2829667_2830762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642778.1|2830956_2831133_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	2.6e-10
WP_003642779.1|2831407_2831689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021732649.1|2831910_2832630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642781.1|2833235_2833604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021732646.1|2833947_2834883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644968.1|2834905_2835319_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
WP_011101082.1|2835330_2835693_-	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	2.6e-09
WP_011101083.1|2835865_2836096_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003642787.1|2836168_2836483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021732645.1|2836520_2837399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033609666.1|2837398_2837635_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	32.4	7.4e-05
WP_033609665.1|2837769_2837976_+	helix-turn-helix transcriptional regulator	NA	A0A142F1D1	Bacillus_phage	51.0	8.5e-05
WP_003642791.1|2837975_2838272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642792.1|2838296_2838467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642793.1|2838478_2838784_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_033609664.1|2838851_2839364_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	43.5	8.0e-28
WP_021732643.1|2839734_2840121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021732642.1|2840117_2841005_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.0	1.6e-60
WP_021732641.1|2841036_2841789_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	51.4	7.0e-73
WP_021732640.1|2841867_2842776_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_021732639.1|2842772_2843060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021732638.1|2843056_2843590_+	hypothetical protein	NA	O03915	Lactobacillus_phage	54.3	2.8e-39
WP_021732637.1|2843582_2844002_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	42.3	9.7e-24
WP_021732636.1|2843998_2844229_+	hypothetical protein	NA	O03916	Lactobacillus_phage	63.2	2.6e-23
WP_165570769.1|2844308_2844470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021732634.1|2844500_2844680_+	hypothetical protein	NA	K4HZV9	Lactobacillus_phage	66.1	1.9e-16
WP_003642805.1|2844843_2845305_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_021732633.1|2846698_2846968_+	DUF2829 domain-containing protein	NA	A0A0K2FLC4	Brevibacillus_phage	45.5	2.5e-12
WP_033609662.1|2847009_2847537_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	73.1	5.0e-41
WP_003642809.1|2847526_2848765_+|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.3	1.9e-139
WP_021732631.1|2848776_2850285_+|portal	phage portal protein	portal	V5US18	Oenococcus_phage	51.6	5.3e-136
WP_033609661.1|2850214_2850511_+|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
WP_003642814.1|2850657_2852343_+|capsid	minor capsid protein	capsid	V5US81	Oenococcus_phage	58.5	3.5e-120
WP_003642815.1|2852317_2852596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642816.1|2852647_2852854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021732629.1|2853026_2853704_+	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	32.1	4.6e-15
WP_021732628.1|2853718_2854069_+	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	4.5e-30
WP_021732627.1|2854088_2855111_+|capsid	major capsid protein	capsid	V5US24	Oenococcus_phage	62.8	9.7e-118
WP_003642820.1|2855123_2855300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355731.1|2855311_2855644_+|head,tail	phage head-tail connector protein	head,tail	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_003642822.1|2855643_2855991_+	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_021732626.1|2855992_2856544_+	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.8	5.1e-65
WP_013355729.1|2856543_2856909_+	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
WP_099447638.1|2857010_2857394_+|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	58.4	1.8e-37
WP_003642826.1|2857493_2857892_+	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.8	3.0e-46
WP_031275283.1|2857999_2858263_+	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
WP_021732625.1|2858278_2864110_+|tail	phage tail protein	tail	V5URV5	Oenococcus_phage	40.9	8.6e-227
WP_099739626.1|2864153_2864486_+	hypothetical protein	NA	V5UQS8	Oenococcus_phage	73.4	2.2e-42
WP_021732623.1|2869816_2870266_+	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	40.5	7.5e-22
WP_021732622.1|2870268_2870703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114685360.1|2870830_2872003_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	88.2	7.1e-197
WP_021732620.1|2872003_2872300_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	76.5	9.9e-39
WP_024971558.1|2872286_2872670_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	84.0	4.4e-15
>prophage 6
NZ_CP053337	Lactobacillus paraplantarum strain CK401 chromosome, complete genome	3164408	3150606	3159867	3164408		Lactobacillus_phage(55.56%)	15	NA	NA
WP_082618893.1|3150606_3151011_-	helix-turn-helix transcriptional regulator	NA	Q9T1J3	Lactobacillus_phage	36.6	3.5e-10
WP_056988234.1|3151264_3151474_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056988318.1|3151489_3152218_+	ORF6C domain-containing protein	NA	A0A1P8BM06	Lactococcus_phage	43.3	2.9e-47
WP_056988235.1|3152238_3152499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988236.1|3152669_3152927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988237.1|3152913_3153114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988238.1|3153463_3154222_+	ERF family protein	NA	D7RWM8	Brochothrix_phage	37.5	3.7e-13
WP_056988239.1|3154218_3154662_+	single-stranded DNA-binding protein	NA	A0A1U9WQM3	Geobacillus_phage	36.1	1.8e-15
WP_056988241.1|3155509_3156430_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	37.5	1.2e-42
WP_171284672.1|3156575_3156911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171284673.1|3156940_3157279_+	hypothetical protein	NA	A0A0P0IXI3	Lactobacillus_phage	48.2	8.4e-18
WP_171284674.1|3157265_3157727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988244.1|3158014_3158467_+	pentapeptide repeat-containing protein	NA	A8ASP3	Listeria_phage	59.2	1.9e-12
WP_082618895.1|3158764_3159190_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	79.3	2.2e-63
WP_056988245.1|3159543_3159867_+	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	50.0	1.8e-25
>prophage 1
NZ_CP053342	Lactobacillus paraplantarum strain CK401 plasmid pCK401E, complete sequence	41380	3593	15583	41380	transposase,integrase	Enterococcus_phage(22.22%)	10	5951:5965	9984:9998
WP_171284703.1|3593_4769_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.0	1.8e-27
WP_021356783.1|5128_6031_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	1.1e-51
5951:5965	attL	ACTGAACGCATAAAT	NA	NA	NA	NA
WP_105450226.1|6117_6750_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.2	8.1e-14
WP_171284704.1|6863_7676_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	28.5	2.7e-14
WP_105450228.1|7804_8755_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.6	1.2e-98
WP_105450229.1|8769_9696_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P8A9	Corynebacterium_phage	31.7	2.2e-36
WP_082265534.1|9802_11950_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.5	7.2e-256
9984:9998	attR	ACTGAACGCATAAAT	NA	NA	NA	NA
WP_071665479.1|11977_12436_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_057950377.1|14435_14687_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
WP_171284705.1|14740_15583_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.5	4.5e-153
