The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053286	Serratia marcescens strain FZSF02 chromosome, complete genome	5407775	849761	862326	5407775	integrase,transposase	uncultured_Mediterranean_phage(22.22%)	10	854082:854095	859623:859636
WP_033631815.1|849761_850523_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	3.3e-54
WP_044029655.1|850516_851143_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	48.8	2.7e-33
WP_015376692.1|851468_852467_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	38.6	8.0e-08
WP_004932578.1|852521_853520_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.2e-32
WP_171402988.1|853599_856161_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	19.9	1.5e-26
854082:854095	attL	TCAACACCAGGCTG	NA	NA	NA	NA
WP_171402989.1|856320_857772_+|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	26.6	2.1e-20
WP_171402699.1|857785_857938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171402891.1|858007_859036_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	43.7	1.4e-68
WP_171402890.1|859032_859824_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.8	2.1e-75
859623:859636	attR	CAGCCTGGTGTTGA	NA	NA	NA	NA
WP_171402990.1|860496_862326_-	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	25.2	4.5e-33
>prophage 2
NZ_CP053286	Serratia marcescens strain FZSF02 chromosome, complete genome	5407775	963974	970604	5407775	transposase	Streptococcus_phage(33.33%)	7	NA	NA
WP_015376738.1|963974_965078_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
WP_171403028.1|965087_966341_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.4	8.0e-98
WP_016929262.1|967477_967711_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	55.8	4.9e-17
WP_171403029.1|967730_968168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403030.1|968220_969813_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.4	2.9e-185
WP_171403031.1|969843_970194_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_171403032.1|970190_970604_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	78.6	1.1e-32
>prophage 3
NZ_CP053286	Serratia marcescens strain FZSF02 chromosome, complete genome	5407775	1394739	1444313	5407775	head,portal,tail,capsid,terminase,tRNA,holin,protease	Enterobacteria_phage(21.62%)	62	NA	NA
WP_164095272.1|1394739_1395672_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_033642249.1|1395713_1395980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015377028.1|1396226_1397273_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.3	1.4e-31
WP_171403172.1|1397284_1399363_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_015377030.1|1399430_1400462_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_171403173.1|1400458_1401763_-	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
WP_171403174.1|1401847_1403389_-	MASE1 domain-containing protein	NA	NA	NA	NA	NA
WP_171403175.1|1403388_1404018_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_171403176.1|1406192_1406438_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	72.4	1.1e-27
WP_171403177.1|1406636_1407020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403178.1|1408438_1408780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403179.1|1408789_1409098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403180.1|1409100_1409481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128868794.1|1409480_1409666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403181.1|1409684_1409879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403182.1|1409875_1410787_-	phosphoadenosine phosphosulfate reductase family protein	NA	S4TN48	Salmonella_phage	76.6	8.6e-142
WP_171403183.1|1410786_1411407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403184.1|1411403_1411931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403185.1|1411914_1412754_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	55.6	1.2e-73
WP_154582428.1|1412757_1412901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403186.1|1413524_1413719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403187.1|1413736_1413895_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	50.0	6.5e-05
WP_151429266.1|1414246_1414645_-	helix-turn-helix domain-containing protein	NA	Q37946	Enterobacteria_phage	57.5	1.3e-20
WP_171403188.1|1414762_1414999_+	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	71.2	2.5e-21
WP_171403189.1|1414991_1415303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403190.1|1415323_1415896_+	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	46.3	3.2e-17
WP_171404671.1|1416221_1416377_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_171403191.1|1416373_1416757_+	HNH endonuclease	NA	G8EYC9	Synechococcus_phage	47.6	9.6e-10
WP_171403192.1|1416753_1417797_+	conserved phage C-terminal domain-containing protein	NA	K4NZ18	Pseudomonas_phage	38.5	2.7e-30
WP_171403193.1|1417793_1418201_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	49.2	9.8e-05
WP_171403194.1|1418197_1419034_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	40.5	4.5e-52
WP_171403195.1|1419442_1419931_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.0	1.9e-26
WP_171403196.1|1421054_1421549_+	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	54.9	1.4e-42
WP_081274826.1|1422295_1422475_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	66.1	3.7e-17
WP_171403197.1|1422608_1422965_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_171403198.1|1422954_1423350_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	61.8	3.8e-38
WP_154871518.1|1423346_1423895_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	43.8	1.5e-24
WP_171404672.1|1424266_1424461_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	73.8	4.1e-17
WP_171403199.1|1424584_1424866_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	84.9	2.1e-38
WP_171403200.1|1424945_1425242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403201.1|1425306_1425636_+	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	64.9	3.5e-37
WP_047574388.1|1425760_1426228_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.8	3.1e-47
WP_171403202.1|1426178_1427924_+|terminase	terminase large subunit	terminase	M4QNU0	Tetraselmis_viridis_virus	43.0	2.5e-137
WP_049301604.1|1427923_1429228_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	80.9	1.3e-207
WP_033655091.1|1429240_1430092_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	79.8	8.4e-123
WP_171403203.1|1430107_1431328_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	80.0	1.4e-179
WP_171403204.1|1431714_1432041_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	56.5	8.9e-33
WP_171403205.1|1432037_1432376_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	50.0	3.4e-19
WP_076740629.1|1432362_1432752_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	51.9	6.9e-32
WP_076740630.1|1432748_1433153_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	67.4	1.7e-41
WP_033655098.1|1433187_1433643_+	hypothetical protein	NA	Q7Y403	Yersinia_phage	73.5	8.0e-56
WP_075206170.1|1433639_1433903_+	immunoglobulin domain-containing protein	NA	Q7Y402	Yersinia_phage	58.1	1.1e-17
WP_049301618.1|1433912_1434272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403206.1|1434504_1437453_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	28.4	1.9e-44
WP_060559914.1|1437452_1437791_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	55.5	1.6e-32
WP_171404673.1|1437800_1438553_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	66.8	2.0e-99
WP_047574432.1|1438561_1439266_+	C40 family peptidase	NA	K7PGR2	Enterobacteria_phage	77.0	6.1e-111
WP_150130715.1|1439303_1439642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403207.1|1439696_1440311_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	55.3	1.9e-52
WP_171403208.1|1440332_1440620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403209.1|1440634_1440934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403210.1|1441106_1444313_+	host specificity protein J	NA	F1C571	Cronobacter_phage	64.0	0.0e+00
>prophage 4
NZ_CP053286	Serratia marcescens strain FZSF02 chromosome, complete genome	5407775	2065722	2113597	5407775	head,integrase,plate,terminase,holin	Pectobacterium_phage(54.05%)	58	2065621:2065644	2114984:2115007
2065621:2065644	attL	AGGAATCGTATTCGGTCTTTTTTT	NA	NA	NA	NA
WP_171403419.1|2065722_2066805_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	49.3	5.3e-98
WP_171403420.1|2066779_2067052_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.2	3.4e-09
WP_060444327.1|2067127_2067631_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	50.9	1.5e-34
WP_171403421.1|2067627_2069754_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	1.6e-101
WP_171403422.1|2069768_2070089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403423.1|2070183_2070621_-	hypothetical protein	NA	A0A2H4JG91	uncultured_Caudovirales_phage	50.8	1.9e-14
WP_171403424.1|2070753_2071065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116286447.1|2071077_2071251_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_171403425.1|2071273_2071471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403426.1|2071733_2072141_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	29.4	2.0e-05
WP_116286445.1|2072244_2072481_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.9	1.6e-15
WP_033638075.1|2072500_2072965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072270890.1|2072979_2073210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154870763.1|2074184_2074583_+	hypothetical protein	NA	A0A2P1JUB0	Erwinia_phage	56.5	2.1e-39
WP_171403427.1|2074598_2075024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403428.1|2075034_2076645_+	DUF4942 domain-containing protein	NA	A0A059VA49	Pseudomonas_phage	56.8	2.3e-169
WP_171403429.1|2076648_2077476_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	46.5	5.2e-61
WP_171403430.1|2077472_2077880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403431.1|2077872_2078097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403432.1|2078325_2079432_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	33.0	4.1e-21
WP_171403433.1|2079438_2081697_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_171403434.1|2082187_2082784_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	53.0	6.8e-55
WP_033638080.1|2082780_2083068_+	DUF1364 domain-containing protein	NA	A0A220NRL6	Escherichia_phage	67.4	1.1e-31
WP_072022393.1|2083064_2083430_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	63.1	2.7e-38
WP_171403435.1|2084700_2085294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072022394.1|2085290_2086007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171403436.1|2086645_2087002_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_171403437.1|2086991_2087384_+	M15 family metallopeptidase	NA	S4TRL9	Salmonella_phage	71.7	4.1e-48
WP_171403438.1|2087380_2087767_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_171403439.1|2088055_2088397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403440.1|2088785_2089295_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	48.4	1.5e-34
WP_171403441.1|2089291_2089906_+	protein Mom	NA	C9E2P8	Enterococcus_phage	61.1	6.3e-64
WP_171403442.1|2089908_2090166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403443.1|2090173_2091169_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	49.8	1.1e-60
WP_171403444.1|2091168_2092809_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	80.3	2.2e-268
WP_060559438.1|2092811_2094212_+	DUF1073 domain-containing protein	NA	H9C192	Pectobacterium_phage	66.8	2.5e-180
WP_171404694.1|2094261_2095014_+|head	phage head morphogenesis protein	head	H9C193	Pectobacterium_phage	74.3	5.2e-100
WP_171403445.1|2095022_2096207_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	65.3	5.6e-101
WP_060559442.1|2096885_2097824_+	DUF2184 domain-containing protein	NA	H9C196	Pectobacterium_phage	72.4	3.0e-129
WP_060559444.1|2097826_2098138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060559446.1|2098200_2098623_+	DUF4054 domain-containing protein	NA	H9C198	Pectobacterium_phage	68.1	1.1e-46
WP_171403446.1|2098619_2099087_+	hypothetical protein	NA	H9C199	Pectobacterium_phage	79.4	1.8e-63
WP_060559450.1|2099089_2099509_+	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	61.3	4.2e-43
WP_171403447.1|2099505_2100042_+	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	56.7	1.0e-46
WP_171403448.1|2100048_2101305_+	DUF3383 family protein	NA	H9C1A2	Pectobacterium_phage	58.1	9.7e-136
WP_060559457.1|2101312_2101717_+	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	73.9	1.8e-51
WP_171403449.1|2101716_2101980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403450.1|2101992_2102382_+	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	55.0	5.1e-35
WP_171403451.1|2102635_2103187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403452.1|2103266_2104937_+	glycoside hydrolase family 104 protein	NA	H9C1A7	Pectobacterium_phage	40.3	2.5e-94
WP_060559466.1|2105910_2106807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403453.1|2106803_2107406_+	hypothetical protein	NA	H9C1B1	Pectobacterium_phage	52.3	1.6e-56
WP_060559472.1|2107421_2107769_+	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	63.5	7.8e-35
WP_171403454.1|2107768_2108974_+|plate	baseplate J/gp47 family protein	plate	H9C1B3	Pectobacterium_phage	58.2	2.0e-130
WP_171403455.1|2108966_2109827_+	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	51.6	2.5e-74
WP_171403456.1|2109839_2110838_+	collagen-like protein	NA	A0A1S6UAI5	Serratia_phage	26.6	1.3e-05
WP_171404695.1|2111005_2111545_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_171403457.1|2111614_2113597_+	Ig-like domain-containing protein	NA	A0A0K1YA92	Cronobacter_phage	39.2	2.2e-49
2114984:2115007	attR	AGGAATCGTATTCGGTCTTTTTTT	NA	NA	NA	NA
>prophage 5
NZ_CP053286	Serratia marcescens strain FZSF02 chromosome, complete genome	5407775	2261417	2298621	5407775	coat,protease	Moraxella_phage(25.0%)	32	NA	NA
WP_021505510.1|2261417_2262350_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004931512.1|2262370_2264791_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_171403513.1|2264858_2265623_-	molecular chaperone	NA	NA	NA	NA	NA
WP_171403514.1|2265647_2266196_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033633239.1|2266201_2266705_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_015377665.1|2266707_2267247_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_171403515.1|2267521_2268958_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_171403516.1|2269060_2271691_-	MCE family protein	NA	NA	NA	NA	NA
WP_171403517.1|2271659_2272907_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_088381512.1|2273162_2273660_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_171403518.1|2273756_2274467_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_088381513.1|2274486_2276535_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.5e-85
WP_171403519.1|2276604_2277450_-	DMT family transporter	NA	NA	NA	NA	NA
WP_171403520.1|2277446_2278754_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_171403521.1|2278746_2279544_-	nicotianamine synthase	NA	NA	NA	NA	NA
WP_171403522.1|2279531_2280317_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	6.7e-10
WP_171403523.1|2280313_2281354_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_121976571.1|2281356_2282448_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004931482.1|2282816_2283701_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_044031371.1|2283985_2284693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171403524.1|2284772_2286167_-	MFS transporter	NA	NA	NA	NA	NA
WP_015377677.1|2286397_2287189_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_171403525.1|2288033_2288897_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_171403526.1|2288898_2290035_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	9.7e-26
WP_004931467.1|2290031_2291042_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_171403527.1|2291219_2291939_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_171403528.1|2292093_2293197_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_171403529.1|2293206_2294016_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_004931458.1|2294079_2295471_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_004931456.1|2295652_2296201_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.1	1.4e-06
WP_048323136.1|2296610_2297276_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_171403530.1|2297340_2298621_-|protease	protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP053286	Serratia marcescens strain FZSF02 chromosome, complete genome	5407775	3596065	3641896	5407775	head,portal,tail,integrase,capsid,plate,terminase,transposase,holin,protease	Salmonella_phage(37.78%)	56	3594655:3594702	3638732:3638779
3594655:3594702	attL	CATGGGGTGTCGGGGGTCGGAGGTTCGAATCCTCTCATGCCGACCAAA	NA	NA	NA	NA
WP_171404007.1|3596065_3596476_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	51.5	1.1e-35
WP_171404008.1|3596533_3597568_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.5	4.0e-10
WP_171404009.1|3597608_3597821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171404010.1|3599087_3599675_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	77.9	3.4e-91
WP_171404011.1|3599678_3600752_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	72.1	7.8e-150
WP_171404746.1|3600744_3601158_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	70.8	1.4e-51
WP_171404012.1|3601157_3601694_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	51.7	6.8e-38
WP_171404013.1|3601693_3602764_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	69.9	4.4e-145
WP_171404014.1|3602760_3604062_-	DNA circularization N-terminal domain-containing protein	NA	U5P4I0	Shigella_phage	60.0	8.2e-146
WP_171404015.1|3604097_3606005_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	56.1	9.8e-180
WP_055312938.1|3606089_3606413_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	58.9	3.3e-27
WP_025303576.1|3606409_3606766_-|tail	phage tail tube protein	tail	Q8W622	Enterobacteria_phage	82.2	7.2e-52
WP_151523078.1|3606765_3608283_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	70.1	1.1e-194
WP_171404016.1|3608279_3608453_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	61.8	4.6e-12
WP_171404017.1|3608456_3609017_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	81.7	3.9e-84
WP_055312932.1|3609013_3609532_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	84.1	5.0e-78
WP_055312929.1|3609503_3609914_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	69.9	3.0e-46
WP_025303580.1|3609910_3610234_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	65.1	3.2e-35
WP_171404018.1|3610314_3611553_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	83.2	1.5e-189
WP_049193565.1|3611562_3612162_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.9	1.4e-87
WP_048796487.1|3612154_3613381_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	80.2	1.4e-195
WP_025303584.1|3613370_3613532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049193569.1|3613528_3615262_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	85.2	7.5e-304
WP_048796489.1|3615258_3615753_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	85.4	3.6e-78
WP_025303587.1|3615848_3616205_-	HNH endonuclease	NA	S5FKR6	Shigella_phage	76.3	3.9e-50
WP_171404019.1|3616185_3616548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171404020.1|3616544_3617174_-	methyltransferase domain-containing protein	NA	A0A2H4PI74	Pseudomonas_phage	46.9	2.6e-44
WP_171404021.1|3617148_3618018_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	47.0	1.7e-70
WP_171404022.1|3618001_3618547_-	HNH endonuclease	NA	A0A2H4J5T2	uncultured_Caudovirales_phage	37.5	2.6e-21
WP_101453884.1|3619303_3619498_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	72.1	6.9e-17
WP_171404023.1|3619650_3620043_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_171404024.1|3620039_3620432_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	73.1	4.3e-50
WP_171404025.1|3620421_3620778_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_151523087.1|3622097_3622919_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	38.5	3.1e-50
WP_171404026.1|3622915_3623953_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	46.9	3.2e-84
WP_171404027.1|3623949_3624489_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	62.6	3.7e-60
WP_171404028.1|3624485_3624728_-	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	38.8	1.6e-07
WP_171404029.1|3624724_3625738_-	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	60.9	1.2e-32
WP_171404030.1|3625734_3625914_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_171404747.1|3625915_3626554_-	phage antirepressor KilAC domain-containing protein	NA	A0A2I7R827	Vibrio_phage	55.9	1.4e-53
WP_171404031.1|3626776_3627325_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	57.6	5.9e-53
WP_171404032.1|3627694_3628165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156865523.1|3628380_3628605_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	51.7	5.8e-07
WP_171404033.1|3628744_3629308_+	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	26.8	4.2e-06
WP_171404034.1|3630272_3630494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171402890.1|3630628_3631420_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.8	2.1e-75
WP_171402891.1|3631416_3632445_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	43.7	1.4e-68
WP_049193629.1|3633425_3633797_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	74.0	2.1e-46
WP_171404035.1|3633851_3634673_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	62.9	6.0e-94
WP_171404036.1|3634755_3635289_+	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	61.4	2.2e-57
WP_171404037.1|3635290_3635599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171404038.1|3636380_3636554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171404039.1|3636546_3637128_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	66.7	2.2e-66
WP_071826138.1|3637172_3637391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025303613.1|3637390_3638590_+|integrase	site-specific integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	30.0	7.6e-29
WP_171404040.1|3638824_3641896_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	27.1	3.2e-07
3638732:3638779	attR	CATGGGGTGTCGGGGGTCGGAGGTTCGAATCCTCTCATGCCGACCAAA	NA	NA	NA	NA
>prophage 7
NZ_CP053286	Serratia marcescens strain FZSF02 chromosome, complete genome	5407775	4005343	4038323	5407775	tail,terminase,integrase	Salmonella_phage(24.24%)	41	4028566:4028580	4044507:4044521
WP_171404166.1|4005343_4008733_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	35.5	2.2e-182
WP_171404754.1|4008732_4011489_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	40.0	7.2e-99
WP_171404167.1|4011498_4012068_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	47.9	6.1e-29
WP_171404168.1|4012060_4012534_-	hypothetical protein	NA	Q858G2	Salmonella_phage	64.7	1.2e-51
WP_171404169.1|4012533_4015035_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	61.3	5.2e-306
WP_171404170.1|4015034_4015643_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.9	5.0e-61
WP_171404171.1|4015642_4015966_-	hypothetical protein	NA	T1SBJ0	Salmonella_phage	54.9	1.6e-21
WP_065404214.1|4016005_4016284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171404172.1|4016300_4016747_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	59.9	4.2e-33
WP_104874763.1|4016800_4017784_-	hypothetical protein	NA	A0A0F6TJQ9	Escherichia_coli_O157_typing_phage	74.3	3.5e-141
WP_171404173.1|4017790_4018507_-	peptidase	NA	Q2A089	Sodalis_phage	69.8	5.5e-43
WP_053091965.1|4018517_4018784_-	hypothetical protein	NA	V5KSC6	Escherichia_phage	89.6	8.9e-23
WP_171404755.1|4018749_4019046_-	hypothetical protein	NA	Q2A090	Sodalis_phage	72.9	2.4e-29
WP_171404174.1|4019045_4020731_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.5	7.3e-187
WP_171404175.1|4021028_4021292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171404176.1|4021317_4022790_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.6	1.8e-234
WP_171404177.1|4022786_4023338_-|terminase	terminase small subunit	terminase	Q858H4	Salmonella_phage	59.7	2.2e-55
WP_171404178.1|4023444_4023831_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	35.1	1.3e-11
WP_171404179.1|4023823_4024504_-	hypothetical protein	NA	R9W0X9	Serratia_phage	49.6	1.6e-44
WP_171404180.1|4024513_4024822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171404181.1|4024827_4025151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171404182.1|4025140_4025329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171404183.1|4025325_4025526_-	hypothetical protein	NA	R9VYJ0	Serratia_phage	92.4	1.1e-30
WP_171404184.1|4025537_4026569_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	44.3	4.6e-67
WP_171404185.1|4026568_4027201_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	51.8	4.4e-60
WP_171404186.1|4027197_4027731_-	hypothetical protein	NA	J9Q748	Salmonella_phage	65.1	1.8e-62
WP_049234891.1|4028166_4028379_-	TraR/DksA C4-type zinc finger protein	NA	A2I309	Vibrio_virus	56.8	2.9e-08
WP_171404187.1|4028381_4028852_-	hypothetical protein	NA	A0A193GYM2	Enterobacter_phage	74.8	2.8e-59
4028566:4028580	attL	ATAAACAGCCCCTGC	NA	NA	NA	NA
WP_171404188.1|4029061_4029622_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	37.0	2.1e-21
WP_033632341.1|4030483_4030690_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	45.0	2.5e-09
WP_171404189.1|4030833_4031052_-	hypothetical protein	NA	Q858D6	Salmonella_phage	58.0	1.9e-15
WP_171404190.1|4031200_4031797_+	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	51.3	8.1e-48
WP_072270178.1|4032071_4032224_+	DUF2985 domain-containing protein	NA	T1SA20	Salmonella_phage	50.0	1.6e-05
WP_171404191.1|4032220_4033267_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	59.5	3.0e-37
WP_049234883.1|4033274_4033580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171404192.1|4033579_4034401_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	79.0	1.6e-126
WP_171404193.1|4034397_4035276_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	73.6	2.6e-119
WP_049234879.1|4035316_4035568_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	54.7	8.4e-15
WP_171404194.1|4035682_4036183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171404195.1|4036832_4037117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171404196.1|4037120_4038323_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	69.3	6.2e-156
4044507:4044521	attR	ATAAACAGCCCCTGC	NA	NA	NA	NA
>prophage 8
NZ_CP053286	Serratia marcescens strain FZSF02 chromosome, complete genome	5407775	4510191	4557699	5407775	transposase,tRNA,protease	Escherichia_phage(25.0%)	53	NA	NA
WP_004937462.1|4510191_4510704_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_015379043.1|4510805_4511501_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_015379044.1|4511570_4512302_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_171404361.1|4512312_4513263_+	glutathione synthase	NA	NA	NA	NA	NA
WP_004937452.1|4513396_4513960_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_015379046.1|4513959_4514382_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_171404362.1|4514378_4515401_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_171404364.1|4515421_4516129_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_171404366.1|4516148_4516970_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_103086314.1|4517001_4517556_+	YggT family protein	NA	NA	NA	NA	NA
WP_171404367.1|4517552_4517846_+	YggU family protein	NA	NA	NA	NA	NA
WP_016930092.1|4517986_4518580_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_171404368.1|4518572_4519715_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_025304253.1|4519752_4520001_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_171404370.1|4520090_4520813_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_047575480.1|4520843_4521767_-	glutaminase B	NA	NA	NA	NA	NA
WP_019456098.1|4521862_4522189_-	YggL family protein	NA	NA	NA	NA	NA
WP_004937410.1|4522188_4522908_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_021504756.1|4523040_4524186_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004937404.1|4524182_4524455_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_033644661.1|4524518_4525595_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_171404764.1|4525643_4527809_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_171404371.1|4528785_4529031_+	DUF4102 domain-containing protein	NA	I6R0M2	Salmonella_phage	58.7	3.0e-17
WP_171404372.1|4529504_4530242_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	28.7	1.7e-07
WP_171404373.1|4530306_4531347_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171404374.1|4531370_4532744_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_171404765.1|4532973_4533534_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.2e-32
WP_171404375.1|4533517_4535179_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_171404376.1|4535111_4536134_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_171404377.1|4536289_4536757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004929861.1|4537648_4537936_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	3.4e-20
WP_038883487.1|4537932_4538184_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_171404378.1|4538279_4538720_-	dehydrogenase	NA	NA	NA	NA	NA
WP_171404379.1|4539325_4540090_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_171404380.1|4540086_4540551_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_171404381.1|4540593_4542639_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_171404382.1|4543157_4543661_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	29.9	1.3e-06
WP_171404383.1|4544011_4544248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171404384.1|4544302_4544707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171404385.1|4544720_4544813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129993891.1|4545058_4545301_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171404386.1|4545696_4546101_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_129993888.1|4546103_4547078_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	45.4	5.3e-73
WP_171404387.1|4547336_4547678_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_171404388.1|4547724_4548228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171404389.1|4548683_4549454_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_171402891.1|4549687_4550716_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	43.7	1.4e-68
WP_171402890.1|4550712_4551504_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.8	2.1e-75
WP_171404390.1|4553003_4553513_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_171403030.1|4553573_4555166_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.4	2.9e-185
WP_171403031.1|4555196_4555547_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_171403032.1|4555543_4555957_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	78.6	1.1e-32
WP_171403030.1|4556106_4557699_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.4	2.9e-185
>prophage 9
NZ_CP053286	Serratia marcescens strain FZSF02 chromosome, complete genome	5407775	5014504	5088321	5407775	transposase,protease	Shigella_phage(28.57%)	59	NA	NA
WP_082997486.1|5014504_5015341_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_004930797.1|5015392_5016151_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171404514.1|5016398_5017907_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_031300290.1|5017966_5020414_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	84.5	9.4e-34
WP_044030024.1|5020555_5021986_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_004930810.1|5022121_5023399_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_033645309.1|5023414_5025397_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_075684686.1|5025393_5027580_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_171404515.1|5028023_5029127_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004930825.1|5029319_5029913_+	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_171404516.1|5029943_5030471_-	gluconokinase	NA	NA	NA	NA	NA
WP_171404517.1|5030582_5031899_-	gluconate transporter	NA	NA	NA	NA	NA
WP_004930833.1|5032239_5033235_-	gluconate operon transcriptional repressor GntR	NA	NA	NA	NA	NA
WP_004930835.1|5033527_5034223_-	pirin family protein	NA	NA	NA	NA	NA
WP_049186507.1|5034612_5035128_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171404518.1|5036360_5037257_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_004930845.1|5037316_5038201_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_171404519.1|5038240_5039254_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_171404520.1|5039289_5041230_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_171404521.1|5041778_5043710_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_004930856.1|5043913_5044750_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_131165336.1|5045145_5045415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154871820.1|5045590_5046412_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_099981731.1|5046489_5047995_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049186517.1|5048551_5049994_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_171404522.1|5050026_5050863_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_004930878.1|5050898_5051672_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_042785526.1|5051658_5052336_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.4	1.3e-22
WP_033645326.1|5052525_5052813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171404523.1|5052850_5053978_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_171404524.1|5053980_5054394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019455211.1|5055152_5055683_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_171404525.1|5055774_5056326_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_171404526.1|5056397_5058899_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_171404774.1|5058980_5059670_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_033645333.1|5059681_5060293_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_171404527.1|5060307_5061312_+	fimbrial protein	NA	NA	NA	NA	NA
WP_171404528.1|5061330_5061870_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_171404529.1|5061972_5062596_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171404530.1|5063094_5064267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171404531.1|5064950_5065220_-	hypothetical protein	NA	F1C5A5	Cronobacter_phage	59.3	7.6e-14
WP_171404532.1|5065280_5066457_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.6	3.6e-100
WP_171404533.1|5066852_5068154_-	T3SS effector OspC family protein	NA	NA	NA	NA	NA
WP_171404534.1|5069509_5070952_-	IpaD/SipD/SspD family type III secretion system needle tip protein	NA	NA	NA	NA	NA
WP_171404535.1|5071650_5072133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171404536.1|5072973_5073282_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171404537.1|5073683_5074406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171404538.1|5075314_5076528_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	3.4e-101
WP_171404539.1|5076642_5077437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171404540.1|5077443_5078430_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171404541.1|5078452_5078992_-	fimbrial protein	NA	NA	NA	NA	NA
WP_171404542.1|5078996_5079524_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_171404775.1|5079570_5080296_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_171404543.1|5080359_5082852_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_171404544.1|5082959_5083484_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_171404545.1|5084515_5084869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171404776.1|5086545_5086728_+	DUF1364 family protein	NA	A0A1Y0SX23	Pseudomonas_phage	61.2	2.2e-09
WP_171402705.1|5086744_5086999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171402891.1|5087292_5088321_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	43.7	1.4e-68
