The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053259	Escherichia coli strain GF3-3 chromosome, complete genome	4706754	1045692	1052832	4706754		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1045692_1046331_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001613685.1|1046327_1047590_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1047586_1048495_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_024249987.1|1048690_1049458_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	1.5e-70
WP_089559920.1|1049508_1050165_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	3.3e-50
WP_001272907.1|1050270_1052832_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 2
NZ_CP053259	Escherichia coli strain GF3-3 chromosome, complete genome	4706754	1666726	1676168	4706754		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569362.1|1666726_1667653_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_112023357.1|1667657_1668389_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1668369_1668477_-	protein YohO	NA	NA	NA	NA	NA
WP_021556974.1|1668536_1669268_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_171284154.1|1669489_1671175_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	1.2e-303
WP_000598641.1|1671171_1671891_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1671937_1672408_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|1672448_1672910_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_171284155.1|1673034_1675035_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001292770.1|1675031_1676168_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 3
NZ_CP053259	Escherichia coli strain GF3-3 chromosome, complete genome	4706754	1772616	1778924	4706754		Enterobacteria_phage(50.0%)	6	NA	NA
WP_062883445.1|1772616_1774011_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
WP_085459687.1|1774185_1775079_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.8	1.7e-46
WP_171284172.1|1775450_1776536_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.0e-101
WP_171284173.1|1776535_1777435_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	1.7e-28
WP_095374512.1|1777492_1778371_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_095374511.1|1778375_1778924_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.8	1.7e-52
>prophage 4
NZ_CP053259	Escherichia coli strain GF3-3 chromosome, complete genome	4706754	2190704	2254395	4706754	lysis,portal,protease,terminase,integrase,tail	Enterobacteria_phage(50.0%)	67	2202885:2202900	2240778:2240793
WP_001613138.1|2190704_2191526_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2191625_2191709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743947.1|2191801_2192137_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2192533_2193787_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2193893_2194787_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2194921_2196142_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001613136.1|2196266_2196962_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_171284225.1|2196914_2198207_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2198366_2198981_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_171284226.1|2199023_2199878_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_028132472.1|2199879_2200497_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	2.5e-76
2202885:2202900	attL	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_171284227.1|2202990_2205417_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_001295396.1|2205615_2205921_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_171284228.1|2206028_2206739_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2206741_2207302_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2207336_2207678_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_171284229.1|2207812_2208139_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_171284230.1|2208344_2209559_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001613128.1|2209570_2210590_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	2.2e-16
WP_001389342.1|2210647_2210776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2210777_2212058_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_000005552.1|2212092_2212344_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_171284562.1|2212416_2214498_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	2.5e-59
WP_001090200.1|2214980_2215172_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_171284231.1|2215168_2215357_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122989300.1|2215757_2215922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097338236.1|2216302_2216458_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000362155.1|2216724_2217144_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|2217244_2217526_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693835.1|2217509_2217935_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_112869013.1|2218006_2219077_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	1.4e-63
WP_073476951.1|2219117_2219540_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	5.9e-61
WP_112869014.1|2220247_2222752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122986767.1|2223390_2223498_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	89.7	4.6e-07
WP_097338460.1|2223542_2223755_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.3e-28
WP_001429486.1|2224213_2224492_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_032248510.1|2224493_2225543_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	1.5e-110
WP_000904114.1|2225555_2225930_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_171284232.1|2225926_2226748_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	3.2e-79
WP_039005563.1|2227649_2227778_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_134254004.1|2228145_2228574_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2228745_2229120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|2229371_2229587_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001135250.1|2229586_2230084_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|2230080_2230548_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001139675.1|2230535_2230688_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_000421825.1|2231361_2231901_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_023281932.1|2231909_2234009_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	97.1	0.0e+00
WP_001072975.1|2234005_2234218_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001459763.1|2234217_2235693_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.0e-281
WP_077761210.1|2235670_2237698_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.7	0.0e+00
WP_001097045.1|2237784_2238108_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|2238100_2238376_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677108.1|2238387_2238966_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|2238962_2239364_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211099.1|2239375_2240119_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001298500.1|2240179_2240566_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|2240574_2240904_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
2240778:2240793	attR	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_171284233.1|2240875_2243941_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_000447253.1|2243940_2244270_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_171284234.1|2244279_2244978_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.8	2.8e-132
WP_171284235.1|2244982_2245726_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	2.9e-148
WP_023277304.1|2245623_2246271_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_171284236.1|2246331_2249730_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.0	0.0e+00
WP_032200031.1|2249796_2250396_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	3.7e-109
WP_171284237.1|2250460_2253814_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_171284238.1|2253813_2254395_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.5e-102
>prophage 5
NZ_CP053259	Escherichia coli strain GF3-3 chromosome, complete genome	4706754	3598933	3696321	4706754	lysis,transposase,head,protease,portal,plate,terminase,holin,integrase,capsid,tail	Shigella_phage(54.24%)	108	3642598:3642653	3681512:3681567
WP_171284413.1|3598933_3600967_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.2	9.9e-21
WP_001301903.1|3601095_3601683_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_171284414.1|3601696_3603169_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_171284415.1|3603182_3604871_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	7.3e-62
WP_171284416.1|3605066_3605714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171284417.1|3605975_3606671_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_171284418.1|3606663_3608091_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102100.1|3608101_3608821_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_135563524.1|3609348_3610203_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046317.1|3610428_3611754_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474077.1|3611862_3612099_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3612110_3612704_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001301722.1|3612863_3613733_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.5e-53
WP_122986839.1|3613979_3614837_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171284419.1|3614957_3619211_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001174462.1|3619776_3620628_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	4.4e-47
WP_105458186.1|3620654_3621644_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001612438.1|3621674_3622568_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001612437.1|3622768_3623695_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001612435.1|3623851_3624772_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000182335.1|3625006_3626149_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000662258.1|3626622_3626724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803990.1|3627087_3627351_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3627350_3627491_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|3627525_3627753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|3628575_3629118_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3629192_3629780_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716394.1|3629837_3630506_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131079.1|3630531_3633057_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_171284420.1|3633046_3634690_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301243.1|3634658_3635369_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3635681_3636011_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3636256_3636871_-	YagU family protein	NA	NA	NA	NA	NA
WP_135563519.1|3636980_3637166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047082179.1|3637288_3637978_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3637974_3638931_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|3638927_3641126_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121330.1|3641135_3642092_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|3642070_3642481_+	transcriptional regulator	NA	NA	NA	NA	NA
3642598:3642653	attL	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_096981851.1|3643202_3644198_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_135404473.1|3644522_3644744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721149.1|3645022_3645649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000905044.1|3646026_3646581_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	85.6	1.2e-85
WP_112868222.1|3646610_3647102_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	1.4e-05
WP_001089533.1|3647104_3647548_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_096981905.1|3647519_3648122_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	90.5	1.0e-90
WP_112879557.1|3648121_3648871_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	5.8e-51
WP_096981903.1|3648874_3649459_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	4.6e-112
WP_096981902.1|3649449_3650508_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.6	8.9e-199
WP_000424747.1|3650494_3650920_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_171284421.1|3650919_3651468_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	2.8e-95
WP_000999508.1|3651467_3652547_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	1.5e-206
WP_096981901.1|3652543_3653920_-	DNA circularization N-terminal domain-containing protein	NA	U5P4I0	Shigella_phage	98.3	1.4e-252
WP_096981900.1|3653944_3655852_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.4	0.0e+00
WP_096981899.1|3655936_3656260_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	97.2	5.5e-51
WP_000090998.1|3656256_3656613_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_096981898.1|3656612_3658109_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	2.2e-272
WP_000497751.1|3658092_3658263_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_001407136.1|3658271_3658832_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	4.0e-105
WP_000224836.1|3658828_3659335_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_171284422.1|3659309_3659720_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	92.6	4.8e-68
WP_000924829.1|3659716_3660040_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	1.7e-52
WP_000766100.1|3660118_3661348_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999804.1|3661358_3661961_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	99.5	2.0e-110
WP_171284423.1|3661953_3663180_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.3	1.4e-240
WP_000838376.1|3663169_3663331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122999388.1|3663327_3664824_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.6	4.1e-290
WP_000929173.1|3665057_3665552_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_024245928.1|3665677_3666028_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	5.2e-63
WP_021556491.1|3666104_3666968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000778468.1|3667040_3667502_-|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	87.6	1.9e-68
WP_016239924.1|3667485_3667962_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	7.0e-87
WP_023145984.1|3667965_3668307_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	5.1e-55
WP_001752106.1|3668559_3669039_+	hypothetical protein	NA	F1C594	Cronobacter_phage	55.4	3.2e-39
WP_001752105.1|3669120_3669699_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	1.3e-47
WP_040074677.1|3669713_3670703_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.8e-194
WP_040074679.1|3670710_3671508_-	KilA-N domain-containing protein	NA	S5FM84	Shigella_phage	98.9	1.1e-148
WP_000767113.1|3671527_3671917_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210155.1|3671913_3672240_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_094321123.1|3672236_3672890_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	2.5e-127
WP_021576994.1|3672889_3673384_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	2.5e-87
WP_000104967.1|3673380_3674322_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_001250269.1|3674311_3674491_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|3674666_3675218_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|3675261_3675462_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3675552_3676227_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549623.1|3676461_3676668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3676639_3677074_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000135682.1|3677542_3677905_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001563274.1|3677970_3678795_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000008200.1|3678922_3679459_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3679449_3679812_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3679811_3680117_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051893.1|3680343_3681507_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_000893255.1|3681711_3682965_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3681512:3681567	attR	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3682976_3684080_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3684367_3685423_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000174677.1|3685461_3685863_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3685920_3687165_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3687256_3687715_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|3687975_3689433_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602112.1|3689489_3690104_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000528869.1|3690100_3691240_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.0e-31
WP_001059855.1|3691485_3691938_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226182.1|3691934_3692990_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207568.1|3693060_3693846_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001325255.1|3693790_3695530_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006258.1|3695823_3696321_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
