The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	691525	768279	5121204	integrase,lysis,capsid,terminase,tail,tRNA,plate,portal,holin,protease,head	Escherichia_phage(44.19%)	82	718497:718543	752300:752346
WP_000560978.1|691525_691963_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|692007_692949_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001774092.1|693012_693921_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000356397.1|694461_694752_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296612.1|695110_695389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001314326.1|695784_696003_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_000027720.1|696218_697148_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|697144_697780_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|697776_698679_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_171274412.1|698691_701742_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_001774093.1|701935_702769_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000749934.1|703763_705158_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619492.1|705198_705513_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001540285.1|705522_706347_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001540286.1|706807_708067_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001540290.1|709821_710658_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|710641_711580_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|711576_712611_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001298417.1|712896_713517_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	8.4e-64
WP_032146477.1|713814_714759_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001540294.1|714907_715582_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001033719.1|717124_717823_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|717972_718473_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
718497:718543	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023384.1|718658_719639_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001192857.1|719708_720002_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|720154_720427_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217670.1|720595_721096_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|721159_721384_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277961.1|721383_721686_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
WP_001113264.1|721685_721910_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001774094.1|721906_722182_+	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.5e-44
WP_001774095.1|722171_724448_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_001774096.1|724626_725178_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	47.0	7.0e-38
WP_001774097.1|725271_726831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774098.1|727184_728219_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	1.6e-200
WP_000156861.1|728218_729991_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085948.1|730164_731019_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_001774099.1|731077_732151_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.7	3.0e-202
WP_001774100.1|732154_732898_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	98.8	1.9e-123
WP_000988633.1|732997_733507_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|733506_733710_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123124.1|733713_733995_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|733994_734492_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_171274413.1|734506_734932_+	protein lysA	NA	U5N096	Enterobacteria_phage	97.2	3.3e-59
WP_001774101.1|734919_735345_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	1.0e-65
WP_001300730.1|735316_735490_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_001774102.1|735452_735920_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
WP_001774103.1|735912_736365_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	6.9e-76
WP_001774104.1|736431_737073_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	89.8	5.4e-98
WP_001774105.1|737069_737417_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	98.3	7.2e-57
WP_001121474.1|737421_738330_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001774106.1|738322_738853_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	96.6	2.4e-99
WP_001774107.1|738863_741593_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	80.7	0.0e+00
WP_001774108.1|741596_742121_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	93.7	7.5e-90
WP_001774109.1|742393_743779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774110.1|744058_745105_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_001286716.1|745586_746777_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|746789_747308_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001774111.1|747364_747640_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	6.3e-40
WP_000785970.1|747672_747792_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001774112.1|747784_750232_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_001774113.1|750246_750726_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.7	1.9e-84
WP_001774114.1|750725_751889_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.0	3.5e-204
WP_000468308.1|751970_752189_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076748.1|752424_753327_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
752300:752346	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_001318165.1|753507_754470_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758726.1|754789_755779_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001774116.1|755885_756641_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|756695_757463_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802217.1|757570_758170_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|758270_758711_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|758922_759222_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|759248_759677_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796345.1|759681_760428_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|760524_761535_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136804.1|761705_763214_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|763236_764082_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|764506_764752_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|764836_765322_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|765414_766341_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|766407_767739_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|767748_768279_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	1585547	1660588	5121204	plate,tRNA,protease	uncultured_Mediterranean_phage(12.5%)	60	NA	NA
WP_000753942.1|1585547_1586972_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
WP_000929439.1|1587126_1588284_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272188.1|1588337_1588724_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001532914.1|1588885_1589698_-	phosphodiesterase YaeI	NA	NA	NA	NA	NA
WP_001186656.1|1589751_1590576_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094534.1|1590606_1593279_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|1593340_1594135_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246882.1|1594502_1595228_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|1595362_1596214_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|1596360_1597086_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|1597235_1597793_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811911.1|1597884_1599081_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|1599269_1600028_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922441.1|1600040_1600898_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001298422.1|1600909_1602262_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|1602291_1604724_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|1604845_1605331_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001540749.1|1605334_1606360_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1606464_1606920_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|1606923_1607712_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139678.1|1607711_1608860_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569423.1|1608856_1609453_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294747.1|1609489_1612972_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000055741.1|1612984_1613944_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001540752.1|1614041_1616183_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901082.1|1616239_1616629_+	VOC family protein	NA	NA	NA	NA	NA
WP_001773843.1|1616693_1618007_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062305.1|1618040_1618301_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|1618287_1618488_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001540755.1|1618653_1619199_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|1619195_1619618_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000360465.1|1620495_1621320_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260694.1|1621372_1623091_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001773844.1|1623201_1623909_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|1623905_1624310_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|1624427_1625243_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294595.1|1625282_1625936_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_171274436.1|1625928_1626960_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001140167.1|1627147_1627720_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000648548.1|1634276_1635191_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1635431_1636232_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211705.1|1636309_1637080_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|1637126_1638485_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052743.1|1638556_1639312_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_171274437.1|1639345_1640068_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001308374.1|1640599_1641331_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001049698.1|1641868_1642654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000013180.1|1642993_1643473_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001538289.1|1643490_1644849_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_171274524.1|1644859_1648345_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001337590.1|1648407_1649850_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001538291.1|1649854_1650598_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001538292.1|1650594_1653357_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	6.1e-82
WP_001282178.1|1653366_1654131_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000224516.1|1654135_1655482_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013423.1|1655484_1656009_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433564.1|1656005_1657298_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896714.1|1657302_1658352_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001538293.1|1658315_1660157_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000946068.1|1660162_1660588_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	2293804	2361442	5121204	integrase,lysis,capsid,terminase,tail,plate,portal,protease,head	Salmonella_phage(65.38%)	78	2290586:2290600	2300843:2300857
2290586:2290600	attL	GCTGTCGCTGATGGT	NA	NA	NA	NA
WP_000290933.1|2293804_2294857_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001321204.1|2295043_2295235_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_097485749.1|2295250_2295820_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	5.5e-38
WP_001247707.1|2295945_2296167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|2296199_2296709_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|2296716_2296917_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|2296880_2297222_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_053294925.1|2297289_2297523_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	2.0e-31
WP_000752619.1|2297522_2297750_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_058101138.1|2297746_2298604_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	8.6e-160
WP_171274449.1|2298600_2301015_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
2300843:2300857	attR	ACCATCAGCGACAGC	NA	NA	NA	NA
WP_001154431.1|2301169_2301358_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|2301368_2301602_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_097335536.1|2303627_2304656_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.5	1.2e-171
WP_001098431.1|2304655_2306422_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216237.1|2306564_2307398_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742511.1|2307414_2308473_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059191.1|2308476_2309127_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673530.1|2309222_2309687_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_053294931.1|2309686_2309890_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
WP_000171568.1|2309893_2310109_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|2310089_2310602_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727851.1|2310603_2310981_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_058101141.1|2310977_2311406_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	3.8e-47
WP_001039943.1|2311501_2311933_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	7.6e-72
WP_058101142.1|2311925_2312369_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.4	2.8e-61
WP_058101143.1|2312387_2313149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058101144.1|2313241_2313820_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	84.9	1.0e-92
WP_040091093.1|2313816_2314176_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	89.1	6.5e-53
WP_058101145.1|2314162_2315071_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.7e-143
WP_058101146.1|2315063_2315669_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	5.8e-110
WP_171274450.1|2315665_2317066_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	82.5	2.0e-161
WP_001106829.1|2317087_2317528_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.3	2.5e-54
WP_049033594.1|2317499_2318102_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	89.5	6.2e-96
WP_171274451.1|2318101_2318635_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	97.7	1.1e-99
WP_058101149.1|2318662_2319229_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046120.1|2319371_2320544_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|2320553_2321069_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_007866361.1|2321123_2321426_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	2.7e-39
WP_000763311.1|2321440_2321560_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282787.1|2321552_2324630_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980413.1|2324626_2325112_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_034167057.1|2325108_2326209_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	2.9e-176
WP_000972391.1|2326299_2326518_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_147702098.1|2326753_2328439_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681104.1|2328708_2329086_+	membrane protein	NA	NA	NA	NA	NA
WP_001195231.1|2329115_2329373_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201570.1|2329532_2329820_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|2329803_2330526_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001538500.1|2330586_2331489_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|2331576_2332053_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_001538501.1|2332402_2333515_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|2333609_2334743_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105434.1|2334752_2335706_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|2335702_2336548_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|2336607_2337096_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001538502.1|2337136_2338264_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.7	6.7e-27
WP_001467833.1|2338292_2339024_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|2339249_2339918_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001692.1|2339917_2340634_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|2340640_2341372_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|2341389_2342118_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001538503.1|2342335_2342851_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|2342976_2343300_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255186.1|2343296_2344127_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001538504.1|2344123_2345137_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001538505.1|2345235_2346666_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000815372.1|2347713_2349432_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000178690.1|2349564_2350533_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458842.1|2350544_2352197_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|2352340_2353240_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|2353560_2354256_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599809.1|2354681_2356340_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|2356336_2357293_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746478.1|2357443_2358559_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_171274452.1|2358555_2360502_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|2360574_2360799_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_001538508.1|2361121_2361442_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	2.6e-13
>prophage 4
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	2597833	2682005	5121204	integrase,lysis,transposase,terminase,capsid,tail,tRNA,portal,holin,head	Enterobacteria_phage(46.15%)	86	2594867:2594882	2669005:2669020
2594867:2594882	attL	CAGCCAATGCATTATT	NA	NA	NA	NA
WP_000074984.1|2597833_2598952_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	5.9e-84
WP_000003742.1|2598920_2599190_-	excisionase	NA	NA	NA	NA	NA
WP_001070259.1|2601787_2601979_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|2601975_2602164_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001517906.1|2602564_2602768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2602732_2602951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2603110_2603266_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001420344.1|2603558_2603897_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|2604288_2604531_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|2604514_2604940_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|2605011_2606082_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|2606122_2606545_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000403785.1|2606602_2606959_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001550964.1|2607052_2607235_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	2.4e-27
WP_000753060.1|2607227_2607404_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_000813254.1|2608323_2608479_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_023141427.1|2608646_2608919_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_001550965.1|2608920_2609979_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	1.7e-88
WP_000139998.1|2609979_2610342_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001545909.1|2610356_2611178_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000562553.1|2612073_2612205_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001336019.1|2612485_2612821_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.4e-44
WP_023143432.1|2615181_2615364_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_001538590.1|2615401_2615647_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_000284506.1|2615723_2615939_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001037014.1|2615943_2616834_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_001092866.1|2616870_2617404_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001446668.1|2617560_2617743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|2617757_2617889_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032142285.1|2617891_2618359_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|2618669_2618996_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|2619118_2619472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001538594.1|2619940_2620489_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.0	1.4e-57
WP_001538595.1|2620460_2622389_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	6.1e-262
WP_000258993.1|2622372_2622579_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001538596.1|2622575_2624168_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	8.4e-185
WP_001773874.1|2624157_2625663_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	6.1e-100
WP_000256835.1|2625699_2626047_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_000522592.1|2626104_2627133_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000201498.1|2627184_2627568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|2627560_2627914_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_001538599.1|2627929_2628463_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.1e-56
WP_000683079.1|2628459_2628855_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_001538600.1|2628862_2629609_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	1.5e-123
WP_001299690.1|2629627_2630059_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_001538601.1|2630085_2630499_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001538602.1|2630479_2633041_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.7	0.0e+00
WP_000847298.1|2633037_2633367_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001327694.1|2633366_2634065_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_001351101.1|2634070_2634814_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_171274526.1|2634759_2635392_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.9	3.5e-102
WP_001563808.1|2639489_2640089_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	2.0e-107
WP_032154014.1|2640153_2642220_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	2.8e-148
WP_001204582.1|2642216_2642495_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_000355700.1|2642504_2642798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|2642837_2642936_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000937496.1|2643714_2643981_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_001538615.1|2644212_2645076_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	27.8	5.1e-11
WP_000531578.1|2645059_2646196_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2646445_2647672_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|2647720_2648842_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|2648917_2650378_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|2650377_2651049_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_171274462.1|2651218_2652589_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	4.7e-107
WP_001298466.1|2653268_2654375_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2654428_2654890_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248679.1|2654899_2655553_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_001773892.1|2655724_2656975_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001556895.1|2657411_2658929_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	53.0	8.1e-145
WP_001556896.1|2658928_2659786_+	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	38.9	8.3e-54
WP_001773870.1|2663733_2664810_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001538625.1|2666040_2666742_+	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	1.0e-126
WP_001773871.1|2666991_2670543_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
2669005:2669020	attR	AATAATGCATTGGCTG	NA	NA	NA	NA
WP_000700202.1|2670579_2671623_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072093903.1|2671972_2672074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053004.1|2672070_2672526_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_001538627.1|2672525_2672696_+	protein ninE	NA	K7P7K0	Enterobacteria_phage	67.9	4.1e-13
WP_000774478.1|2672688_2672979_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	6.7e-48
WP_001538628.1|2672975_2673338_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	2.1e-59
WP_000971095.1|2673334_2673475_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001204794.1|2673560_2673944_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000737271.1|2674132_2675215_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|2675805_2676021_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_050575893.1|2676200_2679611_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_001538630.1|2679669_2681730_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_000654168.1|2681726_2682005_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
>prophage 5
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	2787826	2854908	5121204	integrase,lysis,capsid,terminase,tail,holin,protease,head	Escherichia_phage(42.62%)	83	2787663:2787688	2840774:2840799
2787663:2787688	attL	CGGTCTGGTACATGGATATCGATACC	NA	NA	NA	NA
WP_000113674.1|2787826_2788957_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2788934_2789183_-	excisionase	NA	NA	NA	NA	NA
WP_001090200.1|2791812_2792004_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449191.1|2792000_2792189_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001351093.1|2792589_2793027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016238838.1|2793004_2793325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304608.1|2793327_2793567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|2793726_2793882_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|2794135_2794597_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_001053425.1|2794704_2794980_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000702041.1|2794963_2795389_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|2795460_2796501_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|2796412_2796955_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450708.1|2796988_2797759_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	1.5e-86
WP_001141099.1|2797774_2798167_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|2798163_2798460_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|2798456_2798918_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403780.1|2798895_2799195_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.3e-50
WP_001224665.1|2799347_2799530_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000753053.1|2799522_2799699_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001289989.1|2799695_2800055_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000510387.1|2800055_2800271_+	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001142588.1|2800272_2800491_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000224216.1|2800492_2800756_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_000207997.1|2800766_2800934_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000350274.1|2801041_2801275_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000967408.1|2801509_2801722_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001004956.1|2801887_2802538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|2802518_2803622_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687431.1|2803779_2803953_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001403449.1|2804012_2804285_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|2804286_2805333_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_000904114.1|2805345_2805720_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|2805716_2806538_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917768.1|2806764_2806962_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_000935524.1|2807112_2808171_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.9	5.2e-207
WP_171274528.1|2808592_2809069_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.4	1.9e-63
WP_000216690.1|2809065_2809230_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_001304601.1|2812292_2812475_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_001304600.1|2812512_2812758_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284510.1|2812834_2813050_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731249.1|2813054_2813405_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	93.0	4.0e-55
WP_000992075.1|2813468_2814002_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
WP_000459345.1|2814161_2814299_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082534.1|2814300_2814795_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.7	1.1e-74
WP_000736383.1|2814791_2815016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304598.1|2815214_2815415_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829186.1|2815456_2815822_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	1.7e-61
WP_000958372.1|2816113_2816677_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_001304597.1|2816673_2818335_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.6	0.0e+00
WP_000173054.1|2818399_2820337_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	97.8	0.0e+00
WP_001063027.1|2820381_2820603_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125984.1|2823129_2823456_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007909.1|2823468_2823819_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	4.6e-59
WP_000573362.1|2823815_2824262_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|2824258_2824603_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275433.1|2824668_2825382_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	2.3e-126
WP_000710952.1|2825399_2825774_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001538679.1|2825869_2826079_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	2.0e-33
WP_000212987.1|2826126_2829369_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.0	0.0e+00
WP_000807940.1|2829361_2829703_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_021524657.1|2829702_2830401_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_032300536.1|2831098_2831731_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_171274465.1|2832074_2835767_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_016238842.1|2835834_2836434_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	1.0e-106
WP_171274466.1|2837443_2838475_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	58.8	6.8e-103
WP_001204581.1|2838646_2838925_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_000355614.1|2838934_2839231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304590.1|2839348_2839681_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001304589.1|2839866_2840319_+	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_001357405.1|2840946_2841753_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
2840774:2840799	attR	CGGTCTGGTACATGGATATCGATACC	NA	NA	NA	NA
WP_000209513.1|2841752_2842946_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001538690.1|2842957_2844316_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763537.1|2844319_2845915_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001538691.1|2845914_2847477_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2847568_2847613_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001538692.1|2847750_2848632_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2848628_2849249_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_024186832.1|2849276_2851166_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|2851378_2852254_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278898.1|2852293_2852884_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559258.1|2852880_2853639_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	9.7e-06
WP_000422063.1|2853858_2854908_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	3107911	3120664	5121204	terminase,capsid,tail,portal,protease,head	uncultured_Caudovirales_phage(88.89%)	17	NA	NA
WP_001538780.1|3107911_3108733_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|3108771_3109101_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001538781.1|3109087_3109453_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000133423.1|3110727_3111009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001560954.1|3111022_3112684_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000113645.1|3112667_3113024_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3113146_3113329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145905.1|3113312_3113753_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000134109.1|3113752_3114049_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001020662.1|3114045_3114384_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000267605.1|3114380_3115592_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_000504056.1|3115593_3116166_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_001137337.1|3116205_3117363_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000233313.1|3117650_3117923_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126693.1|3117935_3118346_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000557476.1|3118342_3118621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761836.1|3118909_3120664_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
>prophage 7
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	3619818	3626130	5121204		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001557076.1|3619818_3620370_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.9	2.3e-49
WP_001681957.1|3620374_3621253_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	5.6e-106
WP_001023638.1|3621310_3622210_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_001557078.1|3622209_3623295_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.3e-101
WP_001773992.1|3623667_3624561_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_001557079.1|3624735_3626130_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.8e-18
>prophage 8
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	3716065	3725510	5121204		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001538973.1|3716065_3717202_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
WP_001538974.1|3717198_3719202_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|3719326_3719788_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|3719828_3720299_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3720345_3721065_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001538977.1|3721061_3722747_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	1.6e-303
WP_001240405.1|3722968_3723700_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001216963.1|3723759_3723867_+	protein YohO	NA	NA	NA	NA	NA
WP_001538978.1|3723847_3724579_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001538980.1|3724583_3725510_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 9
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	4094875	4140488	5121204	tail,holin,integrase,terminase	Escherichia_phage(56.25%)	53	4116206:4116223	4147421:4147438
WP_000017558.1|4094875_4095028_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	92.0	1.9e-17
WP_000076001.1|4095045_4095237_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|4095547_4096066_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001774017.1|4096081_4096621_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	5.1e-41
WP_000637727.1|4096815_4097313_-	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	66.5	1.0e-48
WP_032153852.1|4097309_4097939_-	glycoside hydrolase family 19 protein	NA	A0A0F6R8M1	Escherichia_coli_O157_typing_phage	97.6	1.7e-112
WP_016245479.1|4097928_4098237_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	4.6e-47
WP_000009883.1|4098223_4098628_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	95.5	3.9e-62
WP_032153853.1|4098700_4101163_-|tail	tail fiber domain-containing protein	tail	O09496	Escherichia_virus	48.8	3.3e-164
WP_016245482.1|4101359_4101617_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	6.3e-42
WP_000993735.1|4101934_4102591_+	phage antirepressor Ant	NA	A0A1U9AJ93	Stx1_converting_phage	52.2	4.3e-50
WP_000708858.1|4102662_4102824_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001260052.1|4102922_4103555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127505.1|4103701_4104397_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	100.0	5.4e-128
WP_001555166.1|4105176_4105473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153854.1|4105550_4106399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153855.1|4106400_4109790_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.8	3.4e-183
WP_032153984.1|4109789_4112537_-	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	43.8	8.1e-119
WP_001555169.1|4112536_4113103_-	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	81.5	1.5e-59
WP_000568023.1|4113102_4113567_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_000179264.1|4116038_4116644_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	6.2e-112
4116206:4116223	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_000424495.1|4116643_4116967_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_032153857.1|4117017_4117353_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	5.0e-55
WP_032153858.1|4117363_4117801_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	95.2	5.0e-71
WP_000268715.1|4117852_4118839_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_032153859.1|4118853_4119549_-	peptidase	NA	G9L6C4	Escherichia_phage	98.3	8.7e-94
WP_021517651.1|4119551_4119848_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	99.0	3.7e-46
WP_000852419.1|4119844_4121524_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.5	3.6e-303
WP_000335899.1|4121538_4121745_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_001600316.1|4122447_4122870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032153863.1|4122913_4124389_-	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	2.2e-296
WP_001090112.1|4124385_4125060_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_016235741.1|4125100_4125439_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	6.4e-58
WP_016235742.1|4125431_4125713_-	ASCH domain-containing protein	NA	A0A077SLL0	Escherichia_phage	97.8	1.1e-47
WP_032153864.1|4125705_4126479_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	47.7	2.0e-51
WP_000753053.1|4126835_4127012_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001224665.1|4127004_4127187_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_001018057.1|4127759_4128050_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_032153869.1|4128046_4128610_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	74.2	9.0e-65
WP_032153870.1|4128671_4129016_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	6.9e-60
WP_000843279.1|4129133_4129910_-	hypothetical protein	NA	G9L6A9	Escherichia_phage	100.0	4.6e-152
WP_001282459.1|4131054_4131285_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|4131439_4132024_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198620.1|4132177_4132330_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_001102251.1|4132332_4132632_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	4.9e-46
WP_032153871.1|4132628_4133450_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2R9YJH7	Escherichia_phage	98.5	5.2e-162
WP_001617197.1|4133446_4134388_+	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.7	1.0e-177
WP_000675390.1|4134437_4134686_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001550170.1|4134843_4135095_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	95.2	5.8e-40
WP_001617200.1|4135734_4135929_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	95.3	1.4e-25
WP_001617201.1|4135932_4137183_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	8.0e-239
WP_000138282.1|4137375_4138953_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|4139021_4140488_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
4147421:4147438	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
>prophage 10
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	4275063	4281887	5121204		Enterobacteria_phage(100.0%)	9	NA	NA
WP_001430678.1|4275063_4275636_-	phage polarity suppression family protein	NA	Q7M2A1	Enterobacteria_phage	96.8	1.4e-94
WP_001774020.1|4275709_4276210_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001392508.1|4276206_4276941_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	6.1e-130
WP_001149160.1|4277494_4277761_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_171274499.1|4277941_4278355_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	4.6e-50
WP_001244665.1|4278347_4278635_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459295.1|4278627_4279083_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4279218_4279539_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001774022.1|4279553_4281887_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 11
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	4354624	4361764	5121204		Escherichia_phage(83.33%)	6	NA	NA
WP_001539446.1|4354624_4357186_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	6.0e-31
WP_001141302.1|4357291_4357948_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001298167.1|4357998_4358766_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_000847997.1|4358961_4359870_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001539448.1|4359866_4361129_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|4361125_4361764_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 12
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	4633792	4713988	5121204	transposase,integrase	Caulobacter_phage(20.0%)	57	4666053:4666070	4719674:4719691
WP_000654298.1|4633792_4634863_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000938200.1|4634878_4636471_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_012368427.1|4636646_4636973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245726.1|4637116_4638118_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_001038587.1|4638202_4638502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368428.1|4638511_4639486_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.5	2.1e-45
WP_004239680.1|4639638_4640286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000542402.1|4640285_4640798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239684.1|4640908_4641265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639097.1|4641362_4641785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000171971.1|4641951_4642269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239688.1|4642350_4642626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861660.1|4643061_4643673_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_004252296.1|4643680_4644589_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_004245739.1|4645631_4645871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239694.1|4646512_4646920_+	DUF3742 family protein	NA	NA	NA	NA	NA
WP_000988923.1|4646962_4648477_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000160224.1|4648473_4648812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973818.1|4648812_4650255_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_036972223.1|4650269_4651244_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_036972221.1|4651240_4651681_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_171274507.1|4651759_4653991_-	trimeric autotransporter adhesin TaaP	NA	NA	NA	NA	NA
WP_004245744.1|4656953_4657391_-	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_004239705.1|4657387_4657873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239706.1|4657869_4659366_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_171274508.1|4659362_4660259_-	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000033152.1|4660255_4660900_-	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004239708.1|4660892_4661309_-	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_171274530.1|4661321_4661705_-	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_001070025.1|4661731_4661971_-	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001236300.1|4661967_4662294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239713.1|4662440_4663049_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000179437.1|4663136_4663886_-	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_012368437.1|4663872_4666020_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
4666053:4666070	attL	AAACAGTGTTTAAAAATT	NA	NA	NA	NA
WP_004245750.1|4666375_4666930_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004239718.1|4666919_4667558_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000790124.1|4667570_4668305_-	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000149725.1|4668318_4669059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239720.1|4669055_4669718_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000428182.1|4670484_4672473_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017827831.1|4680862_4690078_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	39.7	1.0e-48
WP_000801189.1|4690077_4691166_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004239723.1|4691165_4691939_+	thioesterase	NA	NA	NA	NA	NA
WP_171274509.1|4691957_4693724_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.8	4.0e-34
WP_000200567.1|4697424_4697613_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004239726.1|4698934_4699999_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004239729.1|4702116_4704486_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004239730.1|4706880_4707237_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077788456.1|4707495_4707693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351058.1|4707895_4708132_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_071550302.1|4708037_4708256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245764.1|4708339_4708801_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_032216024.1|4709155_4710136_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_000669584.1|4710337_4710748_-	fimbrial protein	NA	NA	NA	NA	NA
WP_105874332.1|4711594_4711651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239731.1|4711963_4712275_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_171274510.1|4713064_4713988_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.3	3.3e-56
4719674:4719691	attR	AATTTTTAAACACTGTTT	NA	NA	NA	NA
>prophage 13
NZ_CP053251	Escherichia coli strain SCU-204 chromosome, complete genome	5121204	4727507	4802328	5121204	transposase,protease,integrase,lysis	Shigella_phage(28.57%)	46	4721877:4721893	4762442:4762458
4721877:4721893	attL	GAGACCGGACTTTGAGA	NA	NA	NA	NA
WP_001218869.1|4727507_4728773_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001774069.1|4731763_4732315_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296368.1|4734817_4735039_+	pap operon regulatory protein PapI	NA	NA	NA	NA	NA
WP_001513409.1|4736906_4737020_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|4738853_4739114_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|4739155_4739716_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|4739755_4740184_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_103103190.1|4740892_4742120_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
WP_000074477.1|4742233_4743427_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|4743562_4745287_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|4745287_4746235_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|4746234_4747977_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|4747973_4749251_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_171274511.1|4749332_4751534_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|4752084_4752228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|4760861_4761077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001521284.1|4761080_4761449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296383.1|4761739_4761982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949836.1|4762614_4763827_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
4762442:4762458	attR	GAGACCGGACTTTGAGA	NA	NA	NA	NA
WP_001223343.1|4764104_4766195_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_096974168.1|4766529_4767685_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.8e-67
WP_000729638.1|4767862_4768018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296394.1|4768827_4769811_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
WP_000905924.1|4769882_4771031_+	capsule polysaccharide transporter	NA	NA	NA	NA	NA
WP_001298258.1|4771054_4772731_+	polysialic acid transporter KpsD	NA	NA	NA	NA	NA
WP_000030745.1|4772740_4773481_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000579517.1|4773477_4775505_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_001161835.1|4775539_4776745_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_171274512.1|4778183_4778663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000723250.1|4779251_4780427_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_000038461.1|4782714_4783338_-	acetyltransferase	NA	NA	NA	NA	NA
WP_000590258.1|4783387_4784047_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.7	2.9e-06
WP_000124301.1|4784043_4784820_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000942826.1|4785878_4786415_-	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
WP_000097240.1|4786416_4787595_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000633240.1|4787591_4788569_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_001254776.1|4788565_4789171_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000820092.1|4789167_4789539_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001087296.1|4790101_4790557_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173425.1|4790573_4791797_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000249375.1|4791796_4793290_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_171274513.1|4793289_4795350_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_001305091.1|4795379_4796339_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001305092.1|4796356_4796767_-	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_001335851.1|4796832_4797642_-	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001774042.1|4797771_4802328_-|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
>prophage 1
NZ_CP053252	Escherichia coli strain SCU-204 plasmid pSCU-204-2, complete sequence	47276	11615	46430	47276	protease,portal,plate,capsid,holin,tail	Vibrio_phage(40.0%)	44	NA	NA
WP_001523080.1|11615_12233_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	3.5e-86
WP_094316868.1|12232_15079_-|tail	tail fiber protein	tail	Q858V4	Yersinia_virus	47.0	2.7e-173
WP_023908964.1|15109_15691_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	40.0	3.6e-16
WP_001705026.1|15683_16808_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.2	4.9e-86
WP_001523074.1|16804_17125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000635200.1|17121_17589_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001523073.1|17585_18206_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	51.6	1.0e-29
WP_001705025.1|18208_19210_-	phage late control D family protein	NA	A0A067ZG47	Vibrio_phage	42.5	1.3e-69
WP_001523070.1|19410_22203_-|tail	phage tail tape measure protein	tail	A0A097P6S4	Vibrio_phage	39.6	4.8e-18
WP_000450805.1|22357_22639_-|tail	phage tail assembly protein	tail	A0A0C5AEP1	Bacteriophage	37.4	1.0e-05
WP_001706256.1|22648_23170_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	57.2	3.4e-50
WP_001706255.1|23186_24650_-	hypothetical protein	NA	A0A059WKP9	Vibrio_phage	53.6	1.4e-146
WP_001523067.1|24649_24940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609134.1|24940_25426_-	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	37.4	3.0e-16
WP_001083980.1|25422_25767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523066.1|25766_26159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523065.1|26159_27203_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	47.9	8.8e-74
WP_001523063.1|27223_27607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171274535.1|27616_28681_-|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	48.0	5.1e-77
WP_001022885.1|28673_30248_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	65.7	1.2e-191
WP_001523057.1|30244_30484_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	52.0	6.8e-14
WP_001019009.1|32358_32910_-	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	29.4	1.7e-07
WP_001185429.1|32909_33500_-	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	58.5	1.6e-40
WP_171274536.1|34056_34752_-	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	34.2	6.4e-28
WP_016238701.1|34792_36166_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001523051.1|36165_36789_-	ParB N-terminal domain-containing protein	NA	A0A0E3JS81	Verrucomicrobia_phage	43.2	1.5e-33
WP_001523049.1|37023_37434_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	78.6	4.7e-39
WP_001141358.1|37822_38122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001222808.1|38196_38394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000867916.1|38393_38663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171274534.1|38775_39369_-	S-adenosylmethionine-binding protein	NA	G9L699	Escherichia_phage	76.8	1.4e-79
WP_000147212.1|40045_40324_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.8	4.0e-18
WP_032154025.1|40320_40866_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	84.0	1.5e-88
WP_000254764.1|40849_41146_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	63.7	2.3e-27
WP_001271967.1|41132_41528_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	82.3	6.1e-52
WP_023908961.1|41906_42623_-	ead/Ea22-like family protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	92.6	1.5e-69
WP_001705006.1|42615_42960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032154033.1|42962_43574_-	phage family protein	NA	M1F3E2	Salmonella_phage	45.9	2.3e-42
WP_001706266.1|43570_43729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001521425.1|43758_44124_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	55.9	3.1e-10
WP_000823235.1|44120_44402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240767.1|44479_45547_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001250512.1|45716_46094_-	hypothetical protein	NA	A0A2I7R3L8	Vibrio_phage	35.1	6.3e-06
WP_001270825.1|46097_46430_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	39.8	2.9e-15
