The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053281	Escherichia coli strain SCU-308 chromosome, complete genome	4982336	1117789	1126546	4982336	integrase	Escherichia_phage(71.43%)	7	1124173:1124187	1146935:1146949
WP_001278994.1|1117789_1118428_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1118424_1119687_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1119683_1120592_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1120787_1121555_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1121605_1122262_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001474569.1|1122367_1124935_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
1124173:1124187	attL	GCAGGGTCGTGCGTT	NA	NA	NA	NA
WP_001474567.1|1125082_1126546_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	28.0	9.9e-23
WP_001474567.1|1125082_1126546_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	28.0	9.9e-23
1146935:1146949	attR	GCAGGGTCGTGCGTT	NA	NA	NA	NA
>prophage 2
NZ_CP053281	Escherichia coli strain SCU-308 chromosome, complete genome	4982336	1496652	1542244	4982336	plate,terminase,holin,lysis	Enterobacteria_phage(31.58%)	65	NA	NA
WP_000194515.1|1496652_1498086_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|1498301_1499216_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197023.1|1499287_1500535_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|1501064_1501265_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_100285433.1|1501377_1501575_-	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	98.3	1.2e-29
WP_171277361.1|1501671_1502301_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.2	2.8e-51
WP_001167293.1|1502302_1502794_-	hypothetical protein	NA	G9L661	Escherichia_phage	93.3	2.0e-84
WP_171277362.1|1502796_1503204_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	96.3	1.1e-67
WP_171277363.1|1503200_1503620_-	hypothetical protein	NA	G8C7K9	Escherichia_phage	80.3	1.4e-62
WP_001214452.1|1503616_1503781_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_000753560.1|1503797_1504112_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	2.7e-50
WP_089508021.1|1504123_1504606_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	95.6	2.3e-77
WP_000065840.1|1504589_1505501_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	99.3	1.1e-168
WP_000604110.1|1505497_1505806_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_001243355.1|1505890_1506043_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1506027_1506162_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_085668479.1|1506503_1506797_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	75.0	4.7e-33
WP_000213975.1|1506836_1507037_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000219337.1|1507115_1507415_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	99.0	3.4e-31
WP_000856967.1|1507952_1508603_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000276886.1|1508683_1508869_+	helix-turn-helix domain-containing protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000251072.1|1508977_1509271_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|1509293_1509566_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_153677324.1|1509628_1510516_+	replication protein	NA	A5VW95	Enterobacteria_phage	95.3	6.9e-144
WP_153677314.1|1510512_1512906_+	DNA helicase	NA	G9L681	Escherichia_phage	99.4	0.0e+00
WP_160348270.1|1513180_1513621_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	2.9e-79
WP_171277364.1|1513617_1514145_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.3	1.4e-99
WP_029394717.1|1514141_1514318_+	NinE family protein	NA	K7P7K5	Enterobacteria_phage	98.3	2.7e-28
WP_000924594.1|1514320_1514722_+	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	98.5	4.6e-71
WP_001543885.1|1514681_1514891_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001108028.1|1514883_1515495_+	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.0	5.1e-98
WP_171277365.1|1515491_1516163_+	serine/threonine protein phosphatase	NA	H6WZJ4	Escherichia_phage	96.9	2.8e-129
WP_000512811.1|1516153_1516672_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	2.0e-95
WP_000783732.1|1517133_1517457_+|holin	phage holin, lambda family	holin	K7PHK8	Enterobacteria_phage	100.0	1.0e-52
WP_153677319.1|1517440_1517917_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	2.2e-88
WP_144036213.1|1517913_1518381_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	88.4	6.5e-69
WP_171277427.1|1518726_1519215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032349855.1|1519165_1520566_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.5	1.9e-188
WP_001085714.1|1520803_1522255_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	2.5e-191
WP_000233062.1|1522310_1522859_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.8	7.0e-46
WP_029363697.1|1522897_1523320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064733417.1|1523375_1524578_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	49.5	3.7e-100
WP_029363699.1|1524581_1525076_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.1	2.1e-49
WP_153677320.1|1525087_1526029_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.5e-136
WP_000725700.1|1526068_1526350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|1526318_1526738_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|1526734_1527241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|1527240_1527627_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_171277428.1|1527721_1528162_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.0	4.6e-40
WP_029363716.1|1528165_1529311_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.1	2.7e-164
WP_029363718.1|1529320_1529764_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	3.3e-62
WP_029363719.1|1529767_1530187_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	65.2	1.5e-40
WP_016244729.1|1530228_1530381_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_153677321.1|1530370_1532287_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	58.4	5.5e-199
WP_025269945.1|1532286_1532862_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.0	5.0e-63
WP_020804067.1|1532937_1533165_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	5.6e-18
WP_029363723.1|1533167_1534229_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	67.9	7.4e-137
WP_096973667.1|1534238_1534571_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.3	1.6e-29
WP_029363727.1|1534573_1535020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124827415.1|1535082_1535736_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	57.1	1.4e-72
WP_004152573.1|1535737_1536091_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_029363736.1|1536090_1537287_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	73.6	3.9e-158
WP_029363738.1|1537283_1538057_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	53.3	1.4e-76
WP_171277366.1|1538935_1539106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149843736.1|1539187_1542244_+	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	27.8	2.1e-54
>prophage 3
NZ_CP053281	Escherichia coli strain SCU-308 chromosome, complete genome	4982336	1991190	2061243	4982336	transposase,portal,integrase,holin,protease,head,tail,terminase,capsid	Klebsiella_phage(17.65%)	81	1993710:1993769	2033976:2034039
WP_024165620.1|1991190_1992453_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	3.1e-73
WP_001325918.1|1992790_1993588_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1993710:1993769	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_004184758.1|1993883_1994876_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_004184757.1|1994877_1995105_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_171277381.1|1995412_1996063_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	1.8e-37
WP_171277382.1|1996055_1996400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171277383.1|1996527_1997313_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	1.2e-62
WP_048985128.1|1997312_1997612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317569.1|1997923_1998283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317570.1|1998584_1999280_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
WP_001191665.1|1999377_1999620_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_060876554.1|1999654_2000116_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	86.8	3.2e-68
WP_001208720.1|2000353_2000533_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_171277384.1|2000522_2001476_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	75.2	8.2e-103
WP_171277385.1|2001472_2002282_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	5.9e-110
WP_171277386.1|2002291_2002669_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	3.0e-48
WP_064164646.1|2002681_2003662_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.1e-134
WP_100757123.1|2003680_2004022_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	87.6	3.5e-56
WP_148811103.1|2005722_2006007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130983568.1|2006625_2006973_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	71.0	9.8e-38
WP_171277387.1|2006975_2007515_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	2.0e-101
WP_040173677.1|2007511_2007859_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	6.1e-40
WP_171277388.1|2007855_2008131_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	57.8	9.5e-20
WP_057729197.1|2008081_2008276_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.5	2.4e-25
WP_009483898.1|2008272_2008557_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	75.5	5.0e-32
WP_171277389.1|2008661_2008907_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	2.7e-18
WP_038992601.1|2008962_2009304_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	75.7	1.6e-48
WP_004177162.1|2009486_2009951_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_004177157.1|2009904_2011647_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	2.8e-141
WP_171277390.1|2011646_2012954_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.3	3.2e-214
WP_064174735.1|2012966_2013815_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	83.9	8.6e-128
WP_064168970.1|2013824_2015042_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	8.1e-196
WP_023342850.1|2015084_2015327_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	68.1	1.6e-10
WP_171277391.1|2015326_2015653_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	68.5	6.8e-41
WP_032428844.1|2015664_2016003_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	75.0	2.2e-42
WP_019705270.1|2015999_2016449_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|2016445_2016793_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_023313062.1|2016849_2017554_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
WP_021313622.1|2017584_2017989_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_032409576.1|2018000_2018297_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.9	2.5e-26
WP_171277392.1|2018667_2022054_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.6	2.1e-302
WP_031592499.1|2022075_2022549_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.9e-55
WP_171277393.1|2022535_2022964_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.5	1.5e-43
WP_032408661.1|2023024_2023405_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	5.3e-61
WP_171277394.1|2023401_2026479_+	kinase	NA	A0A286S259	Klebsiella_phage	61.9	0.0e+00
WP_171277395.1|2026541_2029538_+	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	62.7	8.2e-40
WP_023304739.1|2029624_2030719_+	SGNH/GDSL hydrolase family protein	NA	A0A2H4J709	uncultured_Caudovirales_phage	37.7	2.3e-32
WP_119621087.1|2030828_2031380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023284987.1|2033137_2033377_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.7	1.5e-21
WP_004184687.1|2033333_2033705_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	1.4e-26
WP_023147483.1|2034706_2035357_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
2033976:2034039	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
WP_001240098.1|2035614_2036250_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_023147484.1|2036250_2037255_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|2037363_2037777_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001353857.1|2037909_2038581_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.8e-32
WP_023147485.1|2038580_2039939_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218046.1|2040045_2040897_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824355.1|2041491_2042607_-	porin	NA	Q1MVN1	Enterobacteria_phage	47.7	1.0e-91
WP_001313057.1|2043178_2043544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365553.1|2043583_2044279_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	7.3e-08
WP_001157276.1|2044345_2045764_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000228678.1|2045744_2046215_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.1e-34
WP_001212219.1|2046203_2047124_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|2047296_2048214_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2048292_2048475_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_077695276.1|2048645_2050340_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.1	4.5e-19
WP_000949108.1|2050336_2051152_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|2051449_2051677_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867217.1|2051839_2052028_+	protein DsrB	NA	NA	NA	NA	NA
WP_000104001.1|2052071_2052695_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983977.1|2052984_2053770_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2053778_2054048_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253444.1|2054057_2054795_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001302429.1|2054794_2055160_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|2055162_2055576_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|2055572_2056577_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|2056581_2057046_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_023147488.1|2057150_2058278_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|2058274_2058718_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_171277429.1|2058736_2060068_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_085947771.1|2060080_2061243_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 4
NZ_CP053281	Escherichia coli strain SCU-308 chromosome, complete genome	4982336	3108543	3184001	4982336	integrase,transposase,holin,protease	Escherichia_phage(22.22%)	48	3162375:3162390	3185924:3185939
WP_171277431.1|3108543_3108840_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	97.1	1.4e-32
WP_069914306.1|3110945_3112304_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_001283626.1|3115044_3115566_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001513690.1|3115562_3116516_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_074767399.1|3116602_3118927_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879153.1|3118971_3119874_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125175.1|3119870_3120869_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|3120865_3121822_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|3121822_3122590_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|3123147_3123405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171277432.1|3127137_3127980_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001333382.1|3127982_3129071_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001300030.1|3129075_3130026_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001411475.1|3130090_3131035_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001293435.1|3132509_3134507_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001505014.1|3134569_3135847_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085947771.1|3136126_3137289_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001616049.1|3137678_3139148_+	amino acid permease	NA	NA	NA	NA	NA
WP_000671170.1|3139252_3141622_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_001331567.1|3141696_3143196_+	amino acid permease	NA	NA	NA	NA	NA
WP_000262195.1|3145076_3146375_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000677247.1|3146440_3147160_-	amino acid racemase	NA	NA	NA	NA	NA
WP_075210367.1|3147504_3148449_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_001505166.1|3149431_3149644_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001367704.1|3150145_3151168_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
WP_001297096.1|3151167_3151947_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000107484.1|3152597_3153611_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998343.1|3153622_3154939_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_001504743.1|3154966_3155887_-	ribokinase	NA	NA	NA	NA	NA
WP_001411493.1|3156192_3156975_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001411495.1|3157882_3158020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001441239.1|3158182_3158818_+	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_001411497.1|3158899_3159337_+	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_000072197.1|3159399_3160224_-	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_023277908.1|3160472_3160811_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001514348.1|3160924_3162496_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
3162375:3162390	attL	ATCAGCAGGCGCTGAA	NA	NA	NA	NA
WP_000459228.1|3162507_3163683_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_000757210.1|3163696_3165586_+	enterotoxin	NA	NA	NA	NA	NA
WP_024167628.1|3165754_3165961_-	methyltransferase	NA	NA	NA	NA	NA
WP_000622487.1|3166065_3167502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333439.1|3167498_3172457_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000282076.1|3173131_3173695_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335695.1|3174515_3175949_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3176167_3176365_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|3176591_3176888_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_077698487.1|3178816_3179818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279872.1|3180004_3181207_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000934041.1|3181724_3184001_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
3185924:3185939	attR	TTCAGCGCCTGCTGAT	NA	NA	NA	NA
>prophage 5
NZ_CP053281	Escherichia coli strain SCU-308 chromosome, complete genome	4982336	3524095	3593062	4982336	transposase,portal,integrase,protease,head,tRNA,tail,terminase,capsid,lysis	Enterobacteria_phage(57.89%)	74	3534309:3534355	3582858:3582904
WP_171277409.1|3524095_3524794_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	96.1	1.9e-128
WP_001614159.1|3527233_3529471_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|3529457_3532430_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224567.1|3532430_3533321_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|3533503_3534265_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3534309:3534355	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|3534777_3535731_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_120795384.1|3538971_3539085_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3539153_3539387_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|3539703_3540294_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_021548649.1|3540391_3540967_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_021548648.1|3540966_3544365_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233090.1|3544429_3545029_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_042050056.1|3545099_3548597_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.7	0.0e+00
WP_000090891.1|3548656_3549289_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000140728.1|3549225_3549969_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.4e-150
WP_001152632.1|3549974_3550673_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
WP_023147605.1|3550672_3551002_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	6.2e-58
WP_023147606.1|3550998_3553578_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.3	0.0e+00
WP_000459457.1|3553570_3554005_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479142.1|3553986_3554409_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_001406215.1|3554424_3555165_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	3.0e-129
WP_000683105.1|3555172_3555568_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_023147608.1|3555564_3556143_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000753019.1|3556154_3556508_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_029363232.1|3556519_3556915_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.7e-57
WP_023147610.1|3556956_3557982_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	5.2e-188
WP_001369910.1|3558037_3558370_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_000123273.1|3558379_3559699_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001369921.1|3559679_3561281_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000198149.1|3561277_3561484_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027283.1|3561480_3563406_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|3563380_3563926_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_074767180.1|3564314_3564509_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	2.2e-26
WP_000738423.1|3564871_3565165_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_077628513.1|3565255_3565438_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	2.5e-16
WP_001135277.1|3565654_3566152_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|3566151_3566367_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_109542680.1|3567010_3568060_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.1	2.2e-149
WP_001204780.1|3568249_3568633_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001307651.1|3568718_3568859_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	8.5e-09
WP_001099716.1|3568855_3569218_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774488.1|3569214_3569505_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224915.1|3569497_3569668_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053009.1|3569667_3570123_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_072114080.1|3570119_3570221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151203.1|3570320_3570524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122138.1|3570798_3571410_-	NADAR family protein	NA	A0A1X7BZM3	Faustovirus	31.6	9.0e-10
WP_021548563.1|3571412_3572432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021548564.1|3572635_3573337_-	replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	97.9	2.1e-127
WP_023147422.1|3573333_3574353_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.4e-110
WP_001182882.1|3574349_3574889_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000184665.1|3574919_3575147_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|3575257_3575950_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000389051.1|3576072_3576822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233576.1|3578157_3578364_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_021548566.1|3578439_3578736_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000100847.1|3578741_3579527_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001297092.1|3579523_3580204_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	3.3e-130
WP_000149544.1|3580200_3580383_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3580355_3580547_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|3580557_3580839_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|3580937_3581156_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3581203_3581482_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000051902.1|3581680_3582844_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_171277410.1|3583178_3583808_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3582858:3582904	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|3583810_3584326_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691056.1|3584336_3585344_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001306954.1|3585356_3587966_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988375.1|3587996_3588689_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001315309.1|3588908_3589451_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729154.1|3589931_3590798_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3590799_3591012_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3591119_3591641_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_021548567.1|3591676_3593062_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 6
NZ_CP053281	Escherichia coli strain SCU-308 chromosome, complete genome	4982336	3904052	3966249	4982336	tRNA,transposase,plate,protease	Enterobacteria_phage(12.5%)	49	NA	NA
WP_000611742.1|3904052_3904466_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|3904469_3906320_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3906283_3907366_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113703.1|3907390_3908671_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3908667_3909192_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246416.1|3909194_3910526_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343293.1|3910530_3911292_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614334.1|3911300_3914060_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
WP_000088859.1|3914056_3914800_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|3914804_3916217_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|3916325_3919760_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_021548578.1|3919770_3921123_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284199.1|3921146_3921629_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|3921672_3922587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|3923215_3924001_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|3924540_3925272_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3925336_3925804_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|3925800_3926523_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3927387_3928746_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211690.1|3928793_3929564_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3929641_3930442_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|3930682_3931597_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3931593_3932397_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|3938156_3938729_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3938916_3939948_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3939940_3940594_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3940633_3941449_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202335.1|3941566_3941971_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3941967_3942675_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3942786_3944505_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399648.1|3945585_3946566_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|3946815_3947526_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|3947539_3947962_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3947958_3948504_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3948669_3948870_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3948856_3949117_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|3949165_3950464_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3950528_3950918_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3950974_3953116_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3953214_3954174_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3954186_3957669_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3957705_3958302_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|3958298_3959447_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3959446_3960235_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3960238_3960694_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139288.1|3960798_3961824_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3961827_3962313_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3962434_3964867_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3964896_3966249_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 1
NZ_CP053282	Escherichia coli strain SCU-308 plasmid pSCU-308-1, complete sequence	151546	1262	71305	151546	integrase,transposase	Escherichia_phage(15.79%)	47	NA	NA
WP_001514245.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001332052.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134871692.1|8813_9080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171277435.1|9266_9446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000928804.1|14876_16064_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733252.1|16060_18001_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	3.0e-35
WP_001312828.1|18004_19375_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|20171_21113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|23373_24567_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_088130945.1|25790_27019_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.0e-174
WP_000738422.1|27645_27939_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|31084_32200_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001442133.1|32339_35999_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
WP_000933672.1|36102_37332_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271277.1|37416_38373_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|38417_40595_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001190234.1|41454_42489_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_000377483.1|43048_43357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514250.1|43455_43638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001332356.1|44546_45788_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_171277436.1|45762_47877_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	6.2e-34
WP_001259758.1|48046_48358_-	colicin V	NA	NA	NA	NA	NA
WP_001323890.1|48335_48572_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_000379710.1|49511_49781_+	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_001017350.1|49777_50044_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000670963.1|50099_50552_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000343091.1|50844_51105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518980.1|51101_51692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142431.1|51711_51969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171277437.1|52097_52427_+	colicin transporter	NA	NA	NA	NA	NA
WP_001283335.1|52453_54334_-	colicin	NA	NA	NA	NA	NA
WP_001057989.1|54519_55368_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	2.0e-28
WP_000969996.1|55413_55695_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000079941.1|55691_55961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138014.1|56604_59571_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|59574_60135_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000454193.1|60310_60661_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|60863_61877_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|62032_62506_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_001067855.1|62657_63362_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|63946_64807_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|65404_66109_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_137564668.1|66864_67737_+	replication protein C	NA	NA	NA	NA	NA
WP_001043265.1|68024_68840_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|68900_69704_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|69703_70540_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|70600_71305_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
