The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038513	Aeromonas sp. 2692-1 chromosome, complete genome	5018075	145830	243983	5018075	terminase,portal,capsid,transposase,tRNA,tail,integrase,plate,head,holin	Aeromonas_virus(66.67%)	93	170064:170121	227107:227164
WP_049045830.1|145830_146817_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_011707400.1|146819_146969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010636148.1|147044_147470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005305063.1|147571_147844_-	DNA-binding protein HU-alpha	NA	A0A249Y2G7	Serratia_phage	44.2	3.6e-11
WP_130631666.1|147902_148088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011707403.1|148185_148668_+	Rsd/AlgQ family anti-sigma factor	NA	NA	NA	NA	NA
WP_011707404.1|148769_149150_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011707405.1|149221_150586_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_171279714.1|150686_153065_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011707407.1|153191_154097_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_171279715.1|154146_155157_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_017411238.1|155277_155886_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171279716.1|155939_158186_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	32.6	6.0e-19
WP_011707410.1|158260_158977_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_024945853.1|159054_160263_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_171279717.1|160277_161609_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	8.9e-79
WP_011707413.1|161718_162492_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005305103.1|162883_163054_-	DUF1427 family protein	NA	R4TMJ4	Halovirus	60.0	6.3e-06
WP_011707414.1|163177_164452_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_171279718.1|164665_165454_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_171279719.1|165494_166112_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_171279720.1|166080_166263_-	DUF5363 family protein	NA	NA	NA	NA	NA
WP_171279721.1|166487_167840_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	42.7	1.3e-93
WP_016351995.1|168174_169611_-	ammonium transporter	NA	NA	NA	NA	NA
170064:170121	attL	ATGGTGCCCGGGGTCGGACTCGAACCGACACGATTATTCATCGGCGGATTTTGAATCC	NA	NA	NA	NA
WP_171279722.1|171022_171322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171279723.1|171523_172072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171279724.1|172065_172773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171279725.1|172869_175281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171279726.1|176383_177130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171279727.1|177518_179723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171279728.1|179923_180481_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	35.1	2.3e-20
WP_130632757.1|180723_180939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171279729.1|181001_183155_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_171281188.1|183518_183908_-|terminase	terminase	terminase	A0A2K8HN72	Pseudomonas_phage	57.4	4.0e-32
WP_171279730.1|184914_186714_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.5	1.3e-93
WP_024946432.1|186721_186955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162791266.1|187041_187188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024946433.1|187334_188129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171279731.1|188130_189870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171279732.1|189841_191575_+	dynamin family protein	NA	NA	NA	NA	NA
WP_171279733.1|192122_192866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171279734.1|193121_194147_-|integrase	tyrosine-type recombinase/integrase	integrase	B6SCW8	Bacteriophage	31.1	2.7e-19
WP_099368947.1|194187_195274_+|transposase	IS3-like element ISKpn10 family transposase	transposase	NA	NA	NA	NA
WP_171279735.1|195583_196645_-|integrase	site-specific integrase	integrase	A5X9F3	Aeromonas_virus	84.8	2.9e-173
WP_171279736.1|196625_197480_-	hypothetical protein	NA	A5X9F4	Aeromonas_virus	71.3	1.0e-64
WP_171279737.1|197489_198188_-	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	81.8	5.5e-104
WP_156853774.1|198325_198559_+	regulator	NA	NA	NA	NA	NA
WP_171279738.1|198585_199095_+	phage regulatory CII family protein	NA	A5X9F7	Aeromonas_virus	81.7	2.8e-73
WP_171279739.1|199105_199564_+	hypothetical protein	NA	A5X9F8	Aeromonas_virus	91.4	5.6e-73
WP_160163719.1|199630_199807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171279740.1|199761_199983_+	hypothetical protein	NA	A5X9F9	Aeromonas_virus	77.6	3.7e-22
WP_171279741.1|199979_200171_+	hypothetical protein	NA	A5X9G0	Aeromonas_virus	77.8	1.0e-20
WP_045525316.1|200167_200377_+	hypothetical protein	NA	A5X9G1	Aeromonas_virus	94.1	5.5e-28
WP_171279742.1|200373_200910_+	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	66.1	9.7e-69
WP_010636123.1|200906_201164_+	hypothetical protein	NA	A5X9G3	Aeromonas_virus	84.7	5.4e-33
WP_171279743.1|201160_203491_+	replication endonuclease	NA	A5X9G4	Aeromonas_virus	91.1	0.0e+00
WP_171279744.1|203487_203994_+	hypothetical protein	NA	A5X9G5	Aeromonas_virus	85.9	5.2e-72
WP_171279745.1|204140_205058_+	trypsin-like peptidase domain-containing protein	NA	S5FV10	Shigella_phage	25.9	6.7e-09
WP_049045784.1|205144_205396_-	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	85.5	1.7e-36
WP_171279746.1|205461_206475_-|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	91.1	1.3e-183
WP_171279747.1|206471_208292_-|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	90.9	0.0e+00
WP_171281189.1|208467_209319_+|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	80.3	1.1e-130
WP_171279748.1|209329_210388_+|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	90.7	8.9e-183
WP_171279749.1|210391_211120_+|terminase	terminase endonuclease subunit	terminase	A5X9H6	Aeromonas_virus	89.6	4.6e-122
WP_049045777.1|211233_211695_+|head	head completion/stabilization protein	head	A5X9H7	Aeromonas_virus	93.5	6.4e-69
WP_171279750.1|211691_212216_+|tail	phage tail protein	tail	A5X9H8	Aeromonas_virus	85.4	2.3e-86
WP_101316813.1|212212_212899_+	phage virion morphogenesis protein	NA	A5X9H9	Aeromonas_virus	88.2	1.2e-108
WP_171279751.1|212903_214028_+	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	81.8	1.3e-176
WP_019838945.1|214031_214487_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	86.1	1.4e-71
WP_171279752.1|214490_214700_+	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	71.2	2.9e-21
WP_019838947.1|214721_215048_+|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	60.4	2.8e-26
WP_171279753.1|215034_215496_+	glycoside hydrolase family 104 protein	NA	G0ZT35	Aeromonas_phage	92.2	3.3e-81
WP_171279754.1|215492_215936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171279755.1|216059_216323_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	80.5	3.0e-31
WP_171279756.1|216514_218284_+|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	76.1	3.4e-259
WP_016352032.1|218283_218607_+	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	86.9	1.1e-46
WP_171279757.1|218603_219791_+|plate	baseplate J/gp47 family protein	plate	A5X9J1	Aeromonas_virus	80.3	3.9e-179
WP_171279758.1|219783_220464_+|tail	phage tail protein	tail	A5X9J2	Aeromonas_virus	76.3	1.6e-87
WP_171281190.1|223611_224181_+	hypothetical protein	NA	A5X9J6	Aeromonas_virus	53.7	3.6e-45
WP_171279759.1|224177_224738_+	hypothetical protein	NA	A5X9J7	Aeromonas_virus	71.9	1.5e-59
WP_171279760.1|224734_226345_+	hypothetical protein	NA	A5X9J8	Aeromonas_virus	73.2	1.6e-236
WP_171279761.1|227336_227858_+	RDD family protein	NA	NA	NA	NA	NA
227107:227164	attR	ATGGTGCCCGGGGTCGGACTCGAACCGACACGATTATTCATCGGCGGATTTTGAATCC	NA	NA	NA	NA
WP_011707420.1|228021_229092_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_005305138.1|229117_230230_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011707422.1|230402_231911_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.6	4.4e-50
WP_168755755.1|232073_232529_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_171279762.1|232594_235447_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.0	3.4e-136
WP_171279763.1|235633_236926_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016352045.1|236944_237610_+	DedA family protein	NA	NA	NA	NA	NA
WP_011707427.1|237749_238577_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_005305164.1|239812_240001_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	2.9e-12
WP_011707428.1|240094_241342_-	aspartate kinase	NA	NA	NA	NA	NA
WP_024945613.1|241358_243983_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	6.2e-76
>prophage 2
NZ_CP038513	Aeromonas sp. 2692-1 chromosome, complete genome	5018075	1508610	1601666	5018075	terminase,capsid,portal,transposase,tRNA,tail,protease,plate,lysis,integrase,head,holin	Salmonella_phage(17.02%)	107	1588993:1589010	1603959:1603976
WP_171280060.1|1508610_1509573_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_171280061.1|1509683_1512092_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.1	8.7e-117
WP_011704596.1|1512309_1512810_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_011704597.1|1512872_1513691_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011704598.1|1513859_1515080_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.5e-44
WP_171280062.1|1515175_1516669_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_011704600.1|1516742_1517531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171280063.1|1517527_1518844_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	33.2	2.4e-28
WP_041218181.1|1519052_1520612_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	49.7	1.9e-35
WP_171280064.1|1520853_1521684_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011704604.1|1521847_1522138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011704605.1|1522202_1522577_-	YacL family protein	NA	NA	NA	NA	NA
WP_169853739.1|1522759_1522912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280065.1|1522898_1524014_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011704607.1|1524133_1525396_+	GntP family permease	NA	NA	NA	NA	NA
WP_171280066.1|1525405_1526539_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.1	1.3e-46
WP_171280067.1|1526749_1527313_+	NnrU family protein	NA	NA	NA	NA	NA
WP_171280068.1|1527375_1527909_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_171281204.1|1527991_1528927_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011704612.1|1529109_1530306_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_171281205.1|1530569_1531058_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.0	6.2e-22
WP_011704614.1|1531096_1531513_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011704615.1|1531714_1532053_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_060390419.1|1532257_1533268_+	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_171280069.1|1533307_1534933_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_171280070.1|1535002_1536037_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.8e-26
WP_171280071.1|1536140_1537046_+	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_005308670.1|1537132_1537603_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_171280072.1|1537804_1538545_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.9	1.6e-21
WP_171280073.1|1538570_1539308_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171280074.1|1539311_1539962_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_171280075.1|1539964_1540627_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_011704623.1|1540848_1541784_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_042064889.1|1542217_1542814_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_171280076.1|1542916_1544110_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_171280077.1|1544220_1544688_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011704627.1|1544721_1546002_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_011704628.1|1546042_1546834_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011704629.1|1547119_1548496_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005341383.1|1548680_1548929_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011704630.1|1548953_1549475_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011704631.1|1549509_1550259_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005313505.1|1550291_1550639_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_118881933.1|1550742_1551072_-	1,4-alpha-glucan branching protein	NA	NA	NA	NA	NA
WP_118881932.1|1551154_1551829_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_011704634.1|1552562_1553090_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_076361506.1|1553104_1555384_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	5.5e-12
WP_011704636.1|1555451_1556276_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_118881930.1|1556275_1557070_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.7	8.9e-119
WP_024944573.1|1557296_1558487_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.7	8.5e-89
WP_118881929.1|1558483_1558891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280078.1|1559008_1560169_-	phage late control D family protein	NA	E5E3P7	Burkholderia_phage	57.1	2.2e-97
WP_171280079.1|1560168_1560660_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	49.7	4.2e-34
WP_171280080.1|1560672_1563108_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	41.6	1.6e-126
WP_029306174.1|1563104_1563236_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_171280081.1|1563244_1563529_-|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	54.8	4.9e-19
WP_171280082.1|1563592_1564111_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	57.0	1.5e-50
WP_171280083.1|1564120_1565299_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	62.0	1.7e-134
WP_171280084.1|1565524_1566571_-	acyltransferase	NA	NA	NA	NA	NA
WP_171280085.1|1566678_1566861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171280086.1|1566874_1568071_-|tail	phage tail protein	tail	A0A1B0XUH9	Freshwater_phage	67.7	1.7e-25
WP_171280087.1|1568072_1569488_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	50.3	1.3e-32
WP_171280088.1|1569487_1569889_-	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	51.1	3.3e-29
WP_171280089.1|1569899_1570781_-|plate	baseplate J/gp47 family protein	plate	A0A218M4K5	Erwinia_phage	52.2	1.6e-68
WP_171280090.1|1570777_1571137_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	50.4	2.1e-22
WP_171280091.1|1571133_1571706_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	40.8	6.4e-26
WP_171280092.1|1571784_1572243_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	47.3	3.2e-28
WP_171280093.1|1572224_1572695_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	49.6	1.1e-31
WP_171280094.1|1572805_1573279_-|lysis	phage lysis regulatory protein LysB	lysis	E5FFH9	Burkholderia_phage	36.8	3.8e-08
WP_171280095.1|1573268_1574090_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	53.0	8.2e-67
WP_171280096.1|1574086_1574392_-|holin	phage holin family protein	holin	E5E3R8	Burkholderia_phage	47.1	4.8e-12
WP_017411174.1|1574393_1574756_-	membrane protein	NA	E5E3R9	Burkholderia_phage	38.8	2.3e-13
WP_171281206.1|1574771_1575002_-	TraR/DksA C4-type zinc finger protein	NA	A0A1S6L007	Salmonella_phage	39.4	5.0e-06
WP_171280097.1|1575004_1575208_-|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	59.1	6.1e-16
WP_171280098.1|1575207_1575678_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	50.3	7.1e-31
WP_171280099.1|1575784_1576468_-|terminase	terminase	terminase	A4PE31	Ralstonia_virus	45.6	2.1e-44
WP_171280100.1|1576477_1577530_-|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	59.1	6.3e-112
WP_171280101.1|1577542_1578373_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	46.4	7.5e-52
WP_171280102.1|1578522_1580289_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	69.6	1.7e-239
WP_171280103.1|1580288_1581362_+|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	54.2	6.4e-112
WP_171280104.1|1581939_1582572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171280105.1|1582659_1583001_-	hypothetical protein	NA	G9L6B6	Escherichia_phage	33.0	8.2e-05
WP_171280106.1|1582997_1583348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171280107.1|1583344_1583590_-	hypothetical protein	NA	A5X9G6	Aeromonas_virus	91.4	8.4e-36
WP_171280108.1|1583586_1584210_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	47.7	1.1e-44
WP_171280109.1|1584220_1586608_-	replication endonuclease	NA	A5X9G4	Aeromonas_virus	35.2	1.6e-99
WP_171280110.1|1586604_1586976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171280111.1|1587053_1587260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171280112.1|1587256_1587574_-	hypothetical protein	NA	A5X9G2	Aeromonas_virus	81.4	1.2e-42
WP_171280113.1|1587570_1587753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170921841.1|1587749_1587926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171280114.1|1587922_1588441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171280115.1|1588504_1588948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104455397.1|1588963_1589182_-	hypothetical protein	NA	NA	NA	NA	NA
1588993:1589010	attL	GCGGGCGAGGTTGATGGC	NA	NA	NA	NA
WP_139738068.1|1589178_1589436_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_171280116.1|1589447_1589960_-	phage regulatory CII family protein	NA	A5X9F7	Aeromonas_virus	44.5	2.5e-29
WP_048209136.1|1589987_1590197_-	regulator for prophage	NA	NA	NA	NA	NA
WP_171281207.1|1590828_1591158_+	S24 family peptidase	NA	A5X9F5	Aeromonas_virus	67.9	1.1e-38
WP_171280117.1|1591157_1593218_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_171280118.1|1593214_1594282_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	56.6	1.4e-103
WP_171280119.1|1594333_1595266_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_016349423.1|1595315_1595618_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005308808.1|1595668_1595932_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016349424.1|1596123_1597689_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_162901756.1|1597728_1597926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017409028.1|1597830_1598805_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	26.4	6.2e-05
WP_044799149.1|1598804_1601666_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	25.8	6.6e-79
1603959:1603976	attR	GCCATCAACCTCGCCCGC	NA	NA	NA	NA
>prophage 3
NZ_CP038513	Aeromonas sp. 2692-1 chromosome, complete genome	5018075	1760202	1770138	5018075	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_029305164.1|1760202_1760949_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	7.2e-70
WP_011704775.1|1760953_1761571_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	4.0e-34
WP_016349540.1|1761567_1762149_+	DedA family protein	NA	NA	NA	NA	NA
WP_026080441.1|1762159_1763200_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	35.6	6.6e-13
WP_011704778.1|1763247_1764231_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
WP_024946180.1|1764315_1765329_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	9.1e-108
WP_005309452.1|1765508_1765724_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016349543.1|1765739_1766183_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	1.7e-26
WP_041217120.1|1766271_1768059_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	5.2e-74
WP_073348937.1|1768272_1770138_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 4
NZ_CP038513	Aeromonas sp. 2692-1 chromosome, complete genome	5018075	2018808	2041998	5018075	transposase	Acidithiobacillus_phage(33.33%)	23	NA	NA
WP_099368947.1|2018808_2019896_-|transposase	IS3-like element ISKpn10 family transposase	transposase	NA	NA	NA	NA
WP_171281212.1|2019961_2020339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280219.1|2020321_2021593_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	55.4	8.1e-130
WP_010676201.1|2021596_2022019_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.1	5.5e-35
WP_087756365.1|2022150_2022360_+	antitoxin	NA	NA	NA	NA	NA
WP_001274811.1|2022905_2024447_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_000194037.1|2024461_2025217_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
WP_139127910.1|2027173_2027647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281213.1|2028034_2029087_-	Fic family protein	NA	NA	NA	NA	NA
WP_171280220.1|2029087_2030509_-|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
WP_171280221.1|2030587_2030818_-	DUF4172 domain-containing protein	NA	NA	NA	NA	NA
WP_099368947.1|2030989_2032076_+|transposase	IS3-like element ISKpn10 family transposase	transposase	NA	NA	NA	NA
WP_171280222.1|2032259_2033378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163136448.1|2033970_2035011_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011711659.1|2035393_2036134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069785041.1|2036136_2037072_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_069785042.1|2037194_2037683_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_005403706.1|2037686_2037947_+	glutaredoxin	NA	M4R2D4	Vibrio_phage	42.9	2.5e-06
WP_005403705.1|2037978_2038419_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_011711656.1|2038473_2038719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281573.1|2038924_2039587_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
WP_002119794.1|2039806_2040784_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	1.7e-18
WP_001809438.1|2040966_2041998_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038513	Aeromonas sp. 2692-1 chromosome, complete genome	5018075	2305334	2381207	5018075	holin,transposase,integrase	Bacillus_phage(33.33%)	49	2301453:2301467	2321717:2321731
2301453:2301467	attL	CACCAGCTCGCCCGC	NA	NA	NA	NA
WP_053288230.1|2305334_2306558_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	49.7	1.7e-100
WP_011705235.1|2306937_2307267_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_171280264.1|2307284_2307698_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_171280265.1|2307717_2308410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171280266.1|2308421_2309042_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_029303630.1|2309038_2309488_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_049048312.1|2309500_2310448_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_171280267.1|2310561_2313948_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_171280268.1|2313973_2315128_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010634663.1|2315143_2315401_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_171280269.1|2315427_2317014_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_002442217.1|2317067_2317346_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_011705244.1|2317360_2317645_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_010634659.1|2317661_2317940_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_017408465.1|2318665_2319181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118881653.1|2319180_2319990_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016350031.1|2320011_2320584_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	31.0	3.2e-09
WP_118881652.1|2320999_2321914_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2321717:2321731	attR	CACCAGCTCGCCCGC	NA	NA	NA	NA
WP_162902001.1|2322062_2322860_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_118881650.1|2322846_2325135_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_045529497.1|2325404_2326145_-	phosphatase	NA	NA	NA	NA	NA
WP_011705252.1|2326613_2327267_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168755062.1|2327315_2329640_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_171280270.1|2329810_2332873_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.9	4.3e-68
WP_017408448.1|2332888_2333935_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_060388857.1|2333999_2335439_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_005298732.1|2335602_2336457_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011705258.1|2336806_2337775_+	glucokinase	NA	NA	NA	NA	NA
WP_029301488.1|2338077_2339460_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_043160091.1|2339459_2340134_-	response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.3e-27
WP_171280271.1|2340272_2342438_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.6	4.1e-49
WP_171280272.1|2342434_2343799_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_171280273.1|2343795_2345883_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	27.5	4.5e-37
WP_045791060.1|2346260_2346590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161772470.1|2346610_2347072_+	RTX toxin-activating lysine-acyltransferase RtxC	NA	NA	NA	NA	NA
WP_171280274.1|2347089_2361606_+	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	NA	NA	NA	NA
WP_118881642.1|2361945_2362440_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171281216.1|2362540_2363866_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_171280275.1|2364377_2365394_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.9e-185
WP_026141496.1|2365626_2367552_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	39.2	3.4e-23
WP_109422605.1|2368855_2369041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128297483.1|2369651_2370044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161646766.1|2370068_2371778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161646767.1|2371899_2372622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026141240.1|2372992_2375206_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017778773.1|2375180_2376476_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_171280276.1|2376468_2378901_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099368947.1|2379170_2380257_+|transposase	IS3-like element ISKpn10 family transposase	transposase	NA	NA	NA	NA
WP_026141239.1|2380907_2381207_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038513	Aeromonas sp. 2692-1 chromosome, complete genome	5018075	2991496	3020852	5018075	protease,plate	Yersinia_phage(14.29%)	20	NA	NA
WP_076362878.1|2991496_2991928_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_118881410.1|2991931_2993698_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_029301185.1|2993661_2994660_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_171280458.1|2994716_2995967_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017411065.1|2995966_2996482_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_017411064.1|2996484_2997819_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_010634228.1|2997841_2998621_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_171280459.1|3001285_3002824_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_118881406.1|3002823_3003429_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_118881405.1|3003437_3004883_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_171280460.1|3004924_3008422_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_118881403.1|3008466_3009897_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017411057.1|3010154_3010442_+	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	39.4	2.3e-08
WP_171280461.1|3010452_3012498_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.5	2.1e-34
WP_118881401.1|3012507_3015066_+	glucosaminidase domain-containing protein	NA	A0EX80	Staphylococcus_virus	40.7	3.6e-36
WP_162901962.1|3015069_3015861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118881400.1|3016804_3017668_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.2	2.3e-27
WP_005300025.1|3017775_3017994_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_005300028.1|3018222_3018540_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	49.4	2.4e-14
WP_118881399.1|3018599_3020852_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.7	9.2e-169
>prophage 7
NZ_CP038513	Aeromonas sp. 2692-1 chromosome, complete genome	5018075	4265291	4301448	5018075	tail,head,plate,transposase	Vibrio_phage(86.11%)	53	NA	NA
WP_171281250.1|4265291_4265984_-	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	67.9	2.4e-51
WP_080602740.1|4266251_4266512_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	62.7	3.2e-17
WP_171280852.1|4266522_4268544_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2I7S9A8	Vibrio_phage	59.9	1.4e-229
WP_171280853.1|4268603_4269536_+	AAA family ATPase	NA	M4M9P4	Vibrio_phage	62.6	1.6e-103
WP_171280854.1|4269535_4269751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005301790.1|4269747_4270071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280855.1|4270086_4270707_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	56.9	7.6e-57
WP_171280856.1|4270715_4271051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280857.1|4271040_4271334_+	hypothetical protein	NA	A0A2I7S9G2	Vibrio_phage	60.0	9.2e-21
WP_171280858.1|4271326_4271557_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171280859.1|4271556_4272021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280860.1|4272129_4272351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280861.1|4272352_4272649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017410079.1|4272752_4273004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280862.1|4272979_4273228_+	hypothetical protein	NA	M4M9N5	Vibrio_phage	70.0	5.4e-14
WP_171280863.1|4273224_4273470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280864.1|4273459_4273978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280865.1|4273967_4274600_+	regulatory protein GemA	NA	A0A2I7S9B8	Vibrio_phage	43.5	6.6e-32
WP_005301765.1|4274694_4275114_+	hypothetical protein	NA	M4MHG9	Vibrio_phage	41.7	3.6e-26
WP_171280866.1|4275113_4275518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026080369.1|4275633_4276215_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	57.6	7.4e-54
WP_171280867.1|4276216_4276525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280868.1|4276509_4277121_+	hypothetical protein	NA	M1NVP4	Vibrio_phage	49.0	4.7e-35
WP_042007613.1|4277117_4277360_+	TraR/DksA family transcriptional regulator	NA	M4MHG5	Vibrio_phage	59.2	3.1e-14
WP_005301745.1|4277349_4277673_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_041202476.1|4277693_4277981_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	66.3	3.4e-28
WP_171280869.1|4277998_4278232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280870.1|4278504_4279083_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	57.8	7.3e-46
WP_171280871.1|4279082_4280672_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	72.8	8.9e-211
WP_171280872.1|4280668_4282234_+	DUF935 domain-containing protein	NA	M4M9P3	Vibrio_phage	69.6	5.5e-205
WP_171280873.1|4282226_4283018_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	69.2	4.6e-107
WP_171280874.1|4283387_4284344_+	peptidase	NA	M1Q578	Vibrio_phage	49.5	2.2e-79
WP_171280875.1|4284350_4285250_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2I7S9D0	Vibrio_phage	65.8	7.0e-112
WP_171280876.1|4285340_4285595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280877.1|4285598_4286111_+	hypothetical protein	NA	A0A1P8L658	Pectobacterium_phage	55.0	2.0e-34
WP_171280878.1|4286145_4286682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171280879.1|4286685_4287120_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	64.6	1.8e-49
WP_042007589.1|4287119_4287677_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	73.9	6.3e-71
WP_171280880.1|4287673_4288291_+	hypothetical protein	NA	M4MHF0	Vibrio_phage	50.7	1.1e-47
WP_042007585.1|4288299_4288509_+	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	45.3	2.9e-05
WP_171280881.1|4288511_4290002_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	58.4	3.0e-160
WP_171280882.1|4290012_4290369_+|tail	phage tail tube protein	tail	A0A2I7S9D5	Vibrio_phage	61.0	1.2e-33
WP_171280883.1|4290371_4290743_+|tail	phage tail assembly protein	tail	M4MB64	Vibrio_phage	57.6	1.4e-29
WP_171280884.1|4290882_4292634_+	hypothetical protein	NA	A0A2P9JZK0	Alteromonadaceae_phage	39.0	1.2e-80
WP_171280885.1|4292645_4294052_+	DNA circularization N-terminal domain-containing protein	NA	M4M9N2	Vibrio_phage	47.7	7.1e-111
WP_171280886.1|4294044_4295124_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	46.8	1.7e-83
WP_171280887.1|4295117_4295672_+|plate	phage baseplate assembly protein	plate	M4MCP6	Vibrio_phage	50.7	3.7e-39
WP_171280888.1|4295678_4296131_+	phage GP46 family protein	NA	M4MB61	Vibrio_phage	55.6	1.2e-30
WP_171280889.1|4296120_4297188_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	65.1	7.5e-129
WP_171280890.1|4297172_4297754_+	DUF2313 domain-containing protein	NA	A0A2I7S9L6	Vibrio_phage	55.2	1.5e-54
WP_171280891.1|4297756_4299877_+	hypothetical protein	NA	A0A0A0RVE3	Bacillus_phage	26.8	4.9e-31
WP_099368947.1|4299915_4301003_-|transposase	IS3-like element ISKpn10 family transposase	transposase	NA	NA	NA	NA
WP_171280892.1|4301043_4301448_+	hypothetical protein	NA	A0A0A0RUQ7	Bacillus_phage	39.3	7.5e-13
>prophage 8
NZ_CP038513	Aeromonas sp. 2692-1 chromosome, complete genome	5018075	4577736	4632313	5018075	transposase,tRNA,tail,plate,head	Vibrio_phage(84.21%)	63	NA	NA
WP_005298460.1|4577736_4578333_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016351608.1|4578567_4579659_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_041218664.1|4581073_4582906_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_011706944.1|4583168_4583891_+	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	27.4	8.1e-18
WP_171281007.1|4583887_4584613_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_162518647.1|4584740_4585412_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_101150250.1|4585455_4585773_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_016351614.1|4585840_4586242_+	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_171281008.1|4586442_4588083_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_171281009.1|4590768_4594314_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_171281010.1|4594576_4595317_-	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	52.8	1.5e-67
WP_103259275.1|4595466_4595691_+	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	50.8	1.7e-11
WP_171281011.1|4595702_4597724_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2I7S9A8	Vibrio_phage	59.7	6.6e-227
WP_171281012.1|4597783_4598716_+	AAA family ATPase	NA	M4M9P4	Vibrio_phage	61.3	7.6e-101
WP_171281013.1|4598719_4598992_+	hypothetical protein	NA	A0A0U5KSG7	unidentified_phage	44.6	2.6e-09
WP_171280854.1|4598991_4599207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281014.1|4599203_4599527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281015.1|4599542_4600163_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	56.9	1.5e-57
WP_042007636.1|4600171_4600534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281016.1|4600523_4600808_+	hypothetical protein	NA	M1PJ71	Vibrio_phage	56.0	4.4e-20
WP_171281017.1|4600800_4601031_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171281018.1|4601030_4601726_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	32.3	2.6e-21
WP_171281019.1|4601834_4602047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281020.1|4602126_4602303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281021.1|4602407_4602659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281022.1|4602634_4602883_+	hypothetical protein	NA	A0A2I7S9D2	Vibrio_phage	70.0	5.4e-14
WP_171281023.1|4602879_4603137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281024.1|4603126_4603654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281025.1|4603643_4604276_+	regulatory protein GemA	NA	A0A2I7S9B8	Vibrio_phage	43.5	6.6e-32
WP_171281026.1|4604299_4604770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281027.1|4604861_4605335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026080369.1|4605455_4606037_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	57.6	7.4e-54
WP_042007617.1|4606038_4606347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281028.1|4606331_4606943_+	hypothetical protein	NA	M1NVP4	Vibrio_phage	48.7	6.8e-34
WP_042007613.1|4606939_4607182_+	TraR/DksA family transcriptional regulator	NA	M4MHG5	Vibrio_phage	59.2	3.1e-14
WP_005301745.1|4607171_4607495_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_171281029.1|4607506_4607803_+	ArsR family transcriptional regulator	NA	A0A2I7S9D8	Vibrio_phage	65.2	1.0e-27
WP_171281030.1|4607820_4608054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281031.1|4608184_4608769_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	66.0	1.2e-56
WP_171281032.1|4608768_4610370_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	71.1	6.9e-203
WP_171281033.1|4610366_4611932_+	DUF935 domain-containing protein	NA	M4M9P3	Vibrio_phage	69.6	2.2e-206
WP_171281034.1|4611924_4612716_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	69.6	1.4e-108
WP_171281035.1|4613084_4614044_+	peptidase	NA	M1Q578	Vibrio_phage	50.2	9.5e-83
WP_171281036.1|4614050_4614950_+|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	64.7	7.0e-112
WP_171281037.1|4615041_4615296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281038.1|4615299_4615812_+	hypothetical protein	NA	A0A1P8L658	Pectobacterium_phage	56.4	1.4e-35
WP_171281039.1|4615846_4616335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171281040.1|4616338_4616773_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	63.2	1.5e-48
WP_171281041.1|4616772_4617330_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	73.3	6.3e-71
WP_171281042.1|4617326_4617944_+	hypothetical protein	NA	M4MHF0	Vibrio_phage	52.7	3.1e-50
WP_171281043.1|4617952_4618132_+	DUF2635 domain-containing protein	NA	A0A2I7S9K4	Vibrio_phage	50.0	2.3e-06
WP_171281044.1|4618134_4619625_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	59.6	7.0e-165
WP_171281045.1|4619635_4619992_+|tail	phage tail tube protein	tail	A0A2I7S9D5	Vibrio_phage	48.3	1.2e-25
WP_171281046.1|4619994_4620357_+|tail	phage tail assembly protein	tail	M1NVT1	Vibrio_phage	56.3	5.6e-28
WP_171281047.1|4620510_4622175_+	tape measure protein	NA	A0A2I7S9D9	Vibrio_phage	51.3	8.9e-137
WP_171281048.1|4622186_4623593_+	DNA circularization N-terminal domain-containing protein	NA	M4M9N2	Vibrio_phage	48.2	3.2e-111
WP_171281049.1|4623585_4624665_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	47.4	3.3e-84
WP_171281050.1|4624658_4625201_+|plate	phage baseplate assembly protein V	plate	M4MCP6	Vibrio_phage	57.5	9.6e-40
WP_171281051.1|4625207_4625660_+	phage GP46 family protein	NA	M4MB61	Vibrio_phage	60.9	7.0e-36
WP_171281052.1|4625649_4626717_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	63.1	2.2e-128
WP_171281053.1|4626701_4627283_+	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	57.6	9.3e-57
WP_171281054.1|4627655_4630022_+	hypothetical protein	NA	A0A193GYB8	Enterobacter_phage	36.2	2.0e-17
WP_171281055.1|4631716_4632313_+	beta-phosphoglucomutase family hydrolase	NA	A0A1D8KPI1	Synechococcus_phage	30.2	3.8e-13
>prophage 9
NZ_CP038513	Aeromonas sp. 2692-1 chromosome, complete genome	5018075	4799337	4806846	5018075	protease	Staphylococcus_phage(50.0%)	8	NA	NA
WP_016351731.1|4799337_4799808_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	3.5e-30
WP_171281125.1|4800005_4801217_+|protease	serine protease	protease	V5LS29	Emiliania_huxleyi_virus	26.9	8.8e-09
WP_016351734.1|4801280_4802390_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	7.9e-65
WP_024944275.1|4802531_4803185_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.4	2.1e-20
WP_171281126.1|4803239_4804349_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	7.2e-50
WP_010675395.1|4804445_4804895_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_171281127.1|4805029_4805509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011707102.1|4805592_4806846_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.5	2.3e-100
