The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	46913	118602	4917765	transposase,tRNA	Acidithiobacillus_phage(22.22%)	53	NA	NA
WP_167402194.1|46913_47645_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_106885353.1|47803_49921_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	36.4	3.0e-12
WP_005307060.1|50056_50332_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_171275148.1|50411_51038_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.3	1.9e-23
WP_171275149.1|51338_52394_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_171277159.1|52534_53248_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_171275150.1|53440_54304_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_106885349.1|54379_55237_-	DMT family transporter	NA	NA	NA	NA	NA
WP_171277160.1|55279_55738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005326376.1|55862_56024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275151.1|56008_56908_-	EamA family transporter	NA	NA	NA	NA	NA
WP_171275152.1|56999_57959_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171275153.1|57937_58951_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025325220.1|59143_59578_-	universal stress protein	NA	NA	NA	NA	NA
WP_171275154.1|59956_61144_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_171277161.1|61158_62934_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.2	2.6e-17
WP_005326403.1|63143_63668_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_171277162.1|63819_65004_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171275155.1|65084_66305_-	MFS transporter	NA	NA	NA	NA	NA
WP_171275156.1|66527_67166_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_162520129.1|67375_69049_+	histidine kinase	NA	NA	NA	NA	NA
WP_171275157.1|69178_69910_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_171275158.1|70019_71216_+	MFS transporter	NA	NA	NA	NA	NA
WP_171275159.1|71287_72412_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_025325239.1|72408_72918_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.0	2.0e-18
WP_163135468.1|73358_75194_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.2	1.7e-08
WP_171275160.1|75309_76098_+	glutamate racemase	NA	NA	NA	NA	NA
WP_025325242.1|76102_76594_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_171275161.1|82474_85048_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_106887833.1|85138_85330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163149163.1|85432_86326_-	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_111913732.1|86550_88032_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_171275162.1|88183_89833_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_163156780.1|90250_91087_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_005323760.1|91492_92089_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_041915434.1|92473_92938_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	49.6	2.0e-30
WP_171275163.1|93243_96528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125730032.1|96534_96858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125730031.1|97116_97725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191341.1|97738_99013_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_005895552.1|99242_99449_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_125730030.1|99863_100991_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	33.7	1.4e-08
WP_125730029.1|101066_101327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005303890.1|101388_101799_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005303889.1|102150_102450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275164.1|102964_103417_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_004576012.1|103862_105281_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_011191341.1|106090_107365_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_080937941.1|108355_109648_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_004576012.1|109798_111217_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_039272515.1|114105_114861_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.6	1.3e-58
WP_011899344.1|114875_116417_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_171275165.1|117570_118602_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	124872	174074	4917765	transposase,integrase	Acidithiobacillus_phage(22.22%)	43	141566:141581	179286:179301
WP_021141311.1|124872_126009_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_171275168.1|126211_127824_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011899344.1|128933_130475_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_039272515.1|130489_131245_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.6	1.3e-58
WP_039026397.1|132246_133068_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_039026396.1|133064_133379_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_125730027.1|133523_134057_-	cupredoxin family protein	NA	NA	NA	NA	NA
WP_005303868.1|134077_134935_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_080989874.1|134946_136905_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_005303860.1|137045_137372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103244016.1|137592_138630_-|transposase	IS630-like element ISAeme16 family transposase	transposase	NA	NA	NA	NA
WP_001310555.1|138892_139909_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_171275169.1|140645_141848_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.5	6.0e-42
141566:141581	attL	TCAGATTGGCGCTGGC	NA	NA	NA	NA
WP_163137454.1|141995_142670_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_005307492.1|142806_143043_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_005323752.1|143054_143222_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_139744769.1|143316_143772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168236059.1|143799_144612_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.5	2.3e-21
WP_171277163.1|144789_145668_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_139744767.1|145738_146221_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.9	6.8e-29
WP_171275170.1|146444_147488_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_171275171.1|147540_148329_-	glycosyltransferase family 2 protein	NA	A0A1C3NFH8	Phage_NCTB	33.0	1.3e-05
WP_163148341.1|148554_149652_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_171275172.1|149653_150931_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_171275173.1|151077_151959_+	DMT family transporter	NA	NA	NA	NA	NA
WP_171275174.1|152436_153741_+	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_171275175.1|154753_155194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141311.1|155854_156991_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_171275176.1|157324_160027_+	CRISPR-associated helicase Cas3'	NA	A0A2R2ZGW0	Clostridioides_phage	23.4	1.2e-05
WP_171275177.1|160041_161574_+	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_171275178.1|161570_162086_+	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_171275179.1|162106_163243_+	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_043153346.1|163244_163892_+	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_171275180.1|163882_164494_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_171277164.1|164490_165408_+	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_171275181.1|165407_165701_+	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_001809438.1|169166_170198_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_171275182.1|170213_170618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275183.1|170793_171387_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_171275184.1|171544_171754_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171275185.1|171770_171986_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_171275186.1|172050_172770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275187.1|172781_174074_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	37.8	1.3e-66
179286:179301	attR	GCCAGCGCCAATCTGA	NA	NA	NA	NA
>prophage 3
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	986964	1031872	4917765	transposase,integrase,tRNA	Bacillus_virus(20.0%)	38	1000290:1000349	1019949:1020014
WP_139436010.1|986964_987678_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_106887723.1|987721_988054_+	YggL family protein	NA	NA	NA	NA	NA
WP_171275538.1|988151_989072_+	glutaminase B	NA	NA	NA	NA	NA
WP_171275539.1|989101_990394_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_171275540.1|990597_990807_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_171275541.1|991487_992123_+	LysE family transporter	NA	NA	NA	NA	NA
WP_171275542.1|992092_992881_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171275543.1|993036_996600_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	23.2	1.6e-10
WP_171275544.1|996700_997978_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_106887714.1|998488_998710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011191341.1|998816_1000091_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
1000290:1000349	attL	GGATTTTCAATCCCCTGCTCTACCGACTGAGCTATCTGGGCAACGGCGCGCATTAAACCC	NA	NA	NA	NA
WP_052815208.1|1001061_1002213_+|integrase	site-specific integrase	integrase	Q4ZCC1	Staphylococcus_virus	24.8	2.0e-10
WP_171275545.1|1002521_1004621_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_029304370.1|1004978_1005158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069785080.1|1005284_1006178_-	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	28.5	6.5e-33
WP_171275546.1|1006477_1008400_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	40.5	3.1e-24
WP_069785079.1|1008870_1010112_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	31.1	3.9e-28
WP_021141311.1|1010710_1011847_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_171275547.1|1012111_1012489_-	DUF2787 family protein	NA	NA	NA	NA	NA
WP_171275548.1|1012485_1013112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069784384.1|1013134_1013437_-	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	38.1	1.3e-06
WP_139127849.1|1013433_1013982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275549.1|1014300_1014684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171275550.1|1014759_1015920_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_171275551.1|1015920_1016370_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_171275552.1|1016350_1019317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106887713.1|1020616_1020952_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
1019949:1020014	attR	GGATTTTCAATCCCCTGCTCTACCGACTGAGCTATCTGGGCAACGGCGCGCATTAAACCCTTTCTG	NA	NA	NA	NA
WP_171275553.1|1021241_1023212_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	23.5	6.7e-06
WP_106887711.1|1023378_1023873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205253.1|1024000_1025338_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_171275554.1|1025461_1025860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025325938.1|1025862_1026126_-	DUF2960 domain-containing protein	NA	NA	NA	NA	NA
WP_171275555.1|1026115_1026388_-	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_168236492.1|1026384_1027257_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_163137417.1|1027299_1028379_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_111912002.1|1028425_1028971_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	38.1	2.5e-27
WP_005327092.1|1030156_1030366_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	57.1	1.4e-15
WP_171275556.1|1030652_1031872_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	29.2	4.0e-17
>prophage 4
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	1140674	1150061	4917765		Staphylococcus_phage(50.0%)	8	NA	NA
WP_171275606.1|1140674_1143503_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	6.8e-44
WP_171275607.1|1143506_1143833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106887638.1|1144266_1145520_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.9	1.6e-101
WP_025326027.1|1145672_1146122_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_171275608.1|1146310_1147420_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.6	3.0e-48
WP_171275609.1|1147474_1148128_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.4	6.0e-20
WP_106887634.1|1148270_1149380_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	38.7	2.6e-63
WP_106887633.1|1149590_1150061_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	1.7e-29
>prophage 5
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	1838201	1956415	4917765	transposase,integrase	Staphylococcus_prophage(13.64%)	100	1866150:1866166	1956432:1956455
WP_001809438.1|1838201_1839233_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_171275895.1|1839664_1841302_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	27.5	6.3e-26
WP_171275896.1|1841291_1842512_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_171275897.1|1842508_1843069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111901678.1|1843070_1843907_+	ATP F0F1 synthase synthase	NA	NA	NA	NA	NA
WP_171275898.1|1844046_1844190_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_004576012.1|1844186_1845605_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_171275899.1|1846578_1847853_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_171275900.1|1847948_1849949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275901.1|1850095_1850647_-	lipoprotein	NA	NA	NA	NA	NA
WP_024945037.1|1852438_1852882_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	3.3e-30
WP_021138010.1|1852998_1853187_+	DUF3283 family protein	NA	NA	NA	NA	NA
WP_043852095.1|1853333_1853780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171275902.1|1853966_1856414_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	36.3	1.1e-74
WP_171275903.1|1856413_1857640_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_171275904.1|1857905_1858559_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_171277217.1|1858555_1859620_+	macro domain-containing protein	NA	A0A2I7QNM6	Vibrio_phage	40.5	2.9e-24
WP_171275905.1|1859694_1862826_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	27.9	1.8e-53
WP_005331303.1|1862825_1863539_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_042862864.1|1864699_1865041_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_021137999.1|1865106_1865421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024945029.1|1865510_1865807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024945028.1|1865837_1866179_-	hypothetical protein	NA	NA	NA	NA	NA
1866150:1866166	attL	GGGCACCTTGATGGTGA	NA	NA	NA	NA
WP_024945027.1|1866180_1866723_-	hypothetical protein	NA	NA	NA	NA	NA
1866150:1866166	attL	GGGCACCTTGATGGTGA	NA	NA	NA	NA
WP_024945026.1|1866802_1867165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043851135.1|1867161_1867377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024945025.1|1867376_1867883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024945024.1|1867999_1868338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024945023.1|1868362_1868554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024945022.1|1868550_1869048_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_042048606.1|1869172_1869448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080706213.1|1869422_1869851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275906.1|1869860_1870286_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_171275907.1|1870347_1870926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171277218.1|1871013_1871430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275908.1|1871472_1872306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128816690.1|1872467_1872818_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171275909.1|1872818_1873787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275910.1|1873783_1874773_-	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	46.7	4.0e-44
WP_024943923.1|1874867_1875818_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	41.3	3.2e-54
WP_029303620.1|1876286_1877639_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	E5AGD0	Erwinia_phage	25.1	4.3e-12
WP_171275165.1|1877899_1878931_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088821966.1|1879905_1880992_+|transposase	IS3-like element ISAs22 family transposase	transposase	NA	NA	NA	NA
WP_017781099.1|1881299_1883039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017781098.1|1883010_1884744_+	dynamin family protein	NA	NA	NA	NA	NA
WP_157835328.1|1884840_1885143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017781097.1|1885523_1886819_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.7	3.1e-12
WP_157835327.1|1887329_1887494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134695860.1|1887506_1887731_-	hypothetical protein	NA	NA	NA	NA	NA
1887545:1887561	attR	TCACCATCAAGGTGCCC	NA	NA	NA	NA
WP_171275911.1|1887795_1889673_-	hypothetical protein	NA	NA	NA	NA	NA
1887545:1887561	attR	TCACCATCAAGGTGCCC	NA	NA	NA	NA
WP_171275912.1|1890860_1892402_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	48.0	1.7e-129
WP_019706001.1|1893713_1894661_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_042046360.1|1894952_1895471_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_156153029.1|1895723_1896740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171277219.1|1896760_1898236_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_171275913.1|1898251_1899142_+	peptidyl-prolyl cis-trans isomerase, EpsD family	NA	NA	NA	NA	NA
WP_171275914.1|1899141_1899909_+	SLBB domain-containing protein	NA	NA	NA	NA	NA
WP_043852042.1|1899917_1901291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043852041.1|1901287_1902154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043852040.1|1902158_1903007_+	exosortase	NA	NA	NA	NA	NA
WP_052449442.1|1903003_1903690_+	EpsI family protein	NA	NA	NA	NA	NA
WP_042046352.1|1903686_1904961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043852046.1|1904956_1906096_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_052497109.1|1906092_1907115_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_052497108.1|1907114_1907852_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_043852038.1|1907848_1909162_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_171275915.1|1909158_1910220_+	acyltransferase	NA	NA	NA	NA	NA
WP_043852036.1|1910222_1911272_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_052497107.1|1911273_1912359_+	acyltransferase	NA	NA	NA	NA	NA
WP_156153046.1|1912395_1913802_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.7	1.7e-51
WP_043852033.1|1913817_1915200_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.0	7.4e-28
WP_171275916.1|1915293_1915638_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_084214699.1|1916045_1917080_+	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_042045324.1|1917103_1919080_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_171275917.1|1919084_1919699_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_042045326.1|1919698_1920028_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_042045327.1|1920044_1920932_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_171275918.1|1921150_1922512_+	MFS transporter	NA	NA	NA	NA	NA
WP_171275919.1|1922636_1923077_+	lysozyme inhibitor	NA	NA	NA	NA	NA
WP_171275920.1|1923510_1924728_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	50.4	1.9e-104
WP_099994264.1|1924947_1925961_+|transposase	IS21-like element ISAeme17 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.8	1.1e-73
WP_171275921.1|1925957_1926728_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	62.1	3.4e-83
WP_139731145.1|1926948_1927329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012112352.1|1927523_1928303_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.2	4.9e-61
WP_083762631.1|1929473_1930013_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_139731146.1|1931754_1933698_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_139731147.1|1933694_1934741_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_139731148.1|1934737_1935373_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139731149.1|1935825_1937313_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_171275922.1|1937327_1938407_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_171275923.1|1938410_1941179_+	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.5	1.1e-19
WP_088137969.1|1941180_1942311_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_171275924.1|1943909_1945997_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	3.0e-33
WP_111900602.1|1945972_1946803_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_171275925.1|1946803_1949392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001809438.1|1949493_1950525_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_111900606.1|1950840_1952049_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	38.4	2.6e-61
WP_171275926.1|1952566_1953781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275927.1|1954421_1955402_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	8.1e-45
WP_012564931.1|1955467_1956415_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
1956432:1956455	attR	GCACTTCGAAGTTGAATTCGCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	2037048	2102621	4917765	integrase,tRNA,terminase,plate,tail,transposase,portal,capsid	Pseudomonas_phage(48.89%)	80	2032978:2032996	2089279:2089297
2032978:2032996	attL	CGGCATCATCCCCATTCAC	NA	NA	NA	NA
WP_171275973.1|2037048_2038236_+|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	44.2	9.0e-83
WP_171275974.1|2038182_2038377_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_171275975.1|2038394_2038865_-	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	64.9	3.6e-51
WP_171275976.1|2038861_2039122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275977.1|2039131_2039551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275978.1|2041238_2041481_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171275979.1|2041477_2042056_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	55.7	5.8e-51
WP_171275980.1|2042052_2042397_-	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	63.6	7.2e-25
WP_171275981.1|2042516_2043434_-	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_171275982.1|2043511_2043838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275983.1|2043863_2044544_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_171275984.1|2044556_2044922_-	hypothetical protein	NA	R9TR46	Vibrio_phage	56.5	3.2e-15
WP_171275985.1|2044975_2045806_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_171275986.1|2045802_2046525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171275987.1|2046620_2047274_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	47.8	2.9e-38
WP_042047491.1|2047371_2047578_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	42.0	6.9e-07
WP_171269986.1|2047639_2048131_+	phage regulatory CII family protein	NA	NA	NA	NA	NA
WP_171277222.1|2048220_2048424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171275988.1|2048413_2048659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171275989.1|2048651_2049773_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	47.4	1.1e-24
WP_103857830.1|2049750_2050245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113724886.1|2050244_2050505_+	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	51.8	1.6e-13
WP_171277223.1|2050504_2050729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102948395.1|2050838_2051540_+	phage antirepressor KilAC domain-containing protein	NA	A0A1I9KFA9	Aeromonas_phage	57.3	1.5e-61
WP_005324004.1|2051536_2051734_+	DUF3283 family protein	NA	NA	NA	NA	NA
WP_171277224.1|2051748_2052723_+	DUF968 domain-containing protein	NA	R9TRM9	Vibrio_phage	34.9	8.1e-29
WP_171275990.1|2052709_2053096_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0H5AUD2	Pseudomonas_phage	51.3	6.9e-24
WP_171275991.1|2053092_2053596_+	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	58.3	2.3e-40
WP_171275992.1|2053586_2053913_+	MFS transporter	NA	V5YTL8	Pseudomonas_phage	58.5	2.1e-29
WP_171275993.1|2053909_2054200_+	hypothetical protein	NA	V5YTR7	Pseudomonas_phage	63.4	1.3e-27
WP_171275994.1|2054205_2054688_+	lysozyme	NA	V5YSX1	Pseudomonas_phage	71.4	1.4e-63
WP_171275995.1|2054684_2055212_+	DUF2514 domain-containing protein	NA	A0A059VF51	Pseudomonas_phage	42.3	1.5e-21
WP_171275996.1|2055350_2055872_+|terminase	terminase small subunit	terminase	V5YUM0	Pseudomonas_phage	53.2	5.4e-40
WP_171275997.1|2055864_2057916_+|terminase	phage terminase large subunit family protein	terminase	V5YTA4	Pseudomonas_phage	74.4	2.9e-278
WP_171275998.1|2058038_2058455_+	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	58.7	6.2e-39
WP_171275999.1|2058454_2060017_+|portal	phage portal protein	portal	V5YTM3	Pseudomonas_phage	73.6	1.4e-216
WP_171277225.1|2060042_2062064_+|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	66.7	1.5e-258
WP_171276000.1|2062125_2062473_+	hypothetical protein	NA	V5YUM4	Pseudomonas_phage	50.5	9.9e-14
WP_171276001.1|2062581_2062830_+	hypothetical protein	NA	V5YTA7	Pseudomonas_phage	72.0	2.1e-26
WP_171276002.1|2062829_2063171_+	hypothetical protein	NA	V5YTH3	Pseudomonas_phage	80.5	6.7e-47
WP_171276003.1|2063157_2063706_+|tail	phage tail protein	tail	D5LGZ7	Escherichia_phage	47.8	1.0e-33
WP_171276004.1|2063702_2064380_+	hypothetical protein	NA	V5YST2	Pseudomonas_phage	67.6	1.1e-64
WP_171276005.1|2064376_2064940_+|plate	phage baseplate assembly protein V	plate	A0A088FQW2	Escherichia_phage	36.4	3.8e-31
WP_139734938.1|2064990_2065416_+	GPW/gp25 family protein	NA	V5YTB2	Pseudomonas_phage	72.3	3.4e-40
WP_171276006.1|2065426_2066917_+	carbohydrate binding domain-containing protein	NA	A0A2R4ALU4	Aeromonas_phage	33.6	1.2e-28
WP_171276007.1|2066913_2067231_+	hypothetical protein	NA	A0A2R4ALX6	Aeromonas_phage	76.7	1.5e-37
WP_171276008.1|2067233_2067932_+|plate	baseplate J/gp47 family protein	plate	A0A193GYM8	Enterobacter_phage	61.0	4.1e-67
WP_001809438.1|2067943_2068975_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_171276009.1|2069137_2069293_+	hypothetical protein	NA	E5FFH3	Burkholderia_phage	58.8	3.6e-08
WP_171276010.1|2069342_2069852_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	37.6	1.1e-21
WP_171276011.1|2069851_2070790_+	hypothetical protein	NA	C7F4C0	Cyanophage	41.1	8.3e-23
WP_171276012.1|2070920_2072354_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	V5YTI0	Pseudomonas_phage	78.5	1.3e-187
WP_171276013.1|2072354_2072861_+|tail	phage major tail tube protein	tail	V5YTN5	Pseudomonas_phage	77.4	5.4e-69
WP_171276014.1|2072912_2073197_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	65.9	1.2e-28
WP_171276015.1|2073320_2075549_+|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	34.3	6.1e-64
WP_171276016.1|2075555_2076464_+|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	57.2	1.2e-45
WP_171277226.1|2076463_2076673_+|tail	tail protein X	tail	A0A088FVH7	Escherichia_phage	60.3	2.3e-18
WP_171277227.1|2076681_2077707_+|tail	phage tail protein	tail	V5YTN9	Pseudomonas_phage	66.3	1.1e-129
WP_171276017.1|2078064_2078778_-	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	60.4	9.6e-80
WP_171276018.1|2079040_2079811_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_171276019.1|2079864_2080680_-	carbon-nitrogen hydrolase family protein	NA	M1I5T1	Acanthocystis_turfacea_Chlorella_virus	28.2	2.2e-11
WP_171276020.1|2080688_2081840_-	methionine aminotransferase	NA	NA	NA	NA	NA
WP_171276021.1|2081953_2082844_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171276022.1|2082955_2084455_-	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_171269746.1|2084470_2085169_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_171276023.1|2085165_2086842_-	ribulokinase	NA	NA	NA	NA	NA
WP_163149068.1|2087203_2088187_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171276024.1|2088253_2089750_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.1e-13
2089279:2089297	attR	CGGCATCATCCCCATTCAC	NA	NA	NA	NA
WP_171276025.1|2089800_2090802_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_106887022.1|2090934_2091846_+	arabinose operon transcriptional regulator AraC	NA	NA	NA	NA	NA
WP_025326720.1|2091914_2092040_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_106887008.1|2092036_2092306_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_025326722.1|2092561_2092816_+	DinI family protein	NA	NA	NA	NA	NA
WP_163156610.1|2092942_2093707_-	DUF2927 domain-containing protein	NA	NA	NA	NA	NA
WP_171276026.1|2093788_2094292_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_171276027.1|2094423_2096067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171276028.1|2096462_2098124_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_139744397.1|2098225_2099578_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_168234941.1|2099899_2100505_+	DUF922 domain-containing protein	NA	NA	NA	NA	NA
WP_171276029.1|2100605_2102621_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	2493731	2504851	4917765	tRNA	Hokovirus(16.67%)	8	NA	NA
WP_171277241.1|2493731_2497655_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	35.2	2.7e-30
WP_005300715.1|2497709_2498006_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	35.6	3.0e-11
WP_171276193.1|2498009_2500397_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.5	1.4e-05
WP_106886730.1|2500409_2501393_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.2	5.3e-36
WP_010674800.1|2501716_2502073_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005315535.1|2502087_2502285_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_041204270.1|2502370_2502919_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.2	1.8e-14
WP_043131783.1|2502922_2504851_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.0	9.7e-127
>prophage 8
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	2617148	2690525	4917765	transposase,integrase	Bacillus_phage(22.22%)	53	2676705:2676756	2696802:2696853
WP_171276251.1|2617148_2618367_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	6.8e-17
WP_025327134.1|2618451_2619102_-	DedA family protein	NA	NA	NA	NA	NA
WP_025327135.1|2619182_2619440_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_171276252.1|2619436_2621449_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_025327138.1|2622429_2624115_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_171276253.1|2624324_2625848_+	lytic transglycosylase F	NA	A0A1P8CWQ1	Bacillus_phage	45.4	1.4e-11
WP_005327879.1|2626052_2627018_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_025327141.1|2627060_2627522_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_041205253.1|2628496_2629834_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_171276254.1|2630566_2631232_-	response regulator	NA	W8CYM9	Bacillus_phage	36.9	9.1e-08
WP_171276255.1|2631232_2632816_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_106886644.1|2632812_2634024_-	ROK family protein	NA	NA	NA	NA	NA
WP_041205651.1|2634128_2635796_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.5	9.8e-43
WP_171276256.1|2635924_2636392_+	YchJ family protein	NA	NA	NA	NA	NA
WP_171276257.1|2636725_2638402_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_171276258.1|2638398_2639676_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_171276259.1|2639915_2641118_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_171277246.1|2641363_2643025_-	type I secretion C-terminal target domain-containing protein	NA	NA	NA	NA	NA
WP_171276260.1|2644283_2644880_+	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_168235212.1|2644876_2645557_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_171276261.1|2645647_2646601_+	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_171276262.1|2647005_2648964_+	heme lyase NrfEFG subunit NrfE	NA	NA	NA	NA	NA
WP_171276263.1|2648960_2649515_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_171276264.1|2649511_2650705_+	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_139744283.1|2651055_2651976_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_163137860.1|2652137_2652278_+	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_171276265.1|2652277_2653798_+	cryptochrome/photolyase family protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	28.5	4.6e-47
WP_171276266.1|2653951_2655205_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_171276267.1|2655274_2655973_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171276268.1|2656156_2658085_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_171276269.1|2658115_2659237_-	HPP family protein	NA	NA	NA	NA	NA
WP_171276270.1|2659447_2660566_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_171276271.1|2660667_2662947_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_042649680.1|2663108_2664044_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171277247.1|2664124_2664874_-	siderophore ferric iron reductase	NA	NA	NA	NA	NA
WP_171276272.1|2664966_2667111_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_171276273.1|2667521_2669042_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_171276274.1|2669086_2670067_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_163147555.1|2670218_2670959_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_163147553.1|2671020_2671923_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171276275.1|2672024_2672663_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171276276.1|2673067_2674096_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_171276277.1|2674222_2675386_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_005326697.1|2675503_2676361_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	32.2	2.3e-27
2676705:2676756	attL	ACGGCCTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_041211539.1|2677114_2678332_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_017787123.1|2680162_2681179_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
WP_158512853.1|2681494_2681662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104453295.1|2681717_2682470_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_010674969.1|2682591_2683836_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	29.1	4.9e-39
WP_021140683.1|2683851_2684061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171276278.1|2684192_2684393_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	36.9	4.3e-06
WP_043133683.1|2684883_2688192_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099369130.1|2688176_2690525_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2696802:2696853	attR	ACGGCCTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 9
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	3006844	3031898	4917765	transposase,integrase	Escherichia_phage(50.0%)	22	3014925:3014981	3032249:3032305
WP_103244016.1|3006844_3007882_-|transposase	IS630-like element ISAeme16 family transposase	transposase	NA	NA	NA	NA
WP_171276395.1|3011648_3012380_+	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_171273605.1|3012357_3013086_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_025327423.1|3013205_3013454_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_171276396.1|3013658_3014282_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_163135033.1|3014522_3014672_+	hypothetical protein	NA	NA	NA	NA	NA
3014925:3014981	attL	TGGTGCCCGAGGCCGGAATCGAACCGGCACGACGCGAACGTCGAGGGATTTTAAATC	NA	NA	NA	NA
WP_021141032.1|3015188_3016196_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.4	3.4e-06
WP_171276397.1|3016473_3017370_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_171276398.1|3017417_3018939_+|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_034524650.1|3018984_3019902_+|transposase	IS5-like element ISAs13 family transposase	transposase	Q9MCT5	Escherichia_phage	55.8	2.0e-93
WP_171276399.1|3021309_3021561_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_021141311.1|3022234_3023371_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_171276400.1|3024117_3024537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|3024847_3025864_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_139723383.1|3026014_3026422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046400722.1|3026511_3027093_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_021139614.1|3027070_3027952_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_128272797.1|3028653_3029073_-	DUF2787 family protein	NA	NA	NA	NA	NA
WP_128272799.1|3029135_3029771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025201450.1|3029893_3030196_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_171276401.1|3030188_3030545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102948587.1|3030692_3031898_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	35.3	1.7e-12
3032249:3032305	attR	TGGTGCCCGAGGCCGGAATCGAACCGGCACGACGCGAACGTCGAGGGATTTTAAATC	NA	NA	NA	NA
>prophage 11
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	3357276	3417291	4917765	transposase,integrase,tRNA	uncultured_Caudovirales_phage(25.0%)	49	3375623:3375643	3389747:3389767
WP_001310555.1|3357276_3358293_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_171276530.1|3358961_3360866_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_171276531.1|3361319_3362726_+	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_168234648.1|3362939_3363245_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_171276532.1|3363245_3364013_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_171276533.1|3364149_3365097_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_171276534.1|3365093_3365570_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_163154137.1|3365888_3366995_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_042653881.1|3367018_3367630_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_171276535.1|3367666_3369037_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.3	1.1e-111
WP_171276536.1|3369189_3370320_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_025327713.1|3370700_3372113_+	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_171276537.1|3372261_3375567_+	mechanosensitive channel MscK	NA	NA	NA	NA	NA
3375623:3375643	attL	GTGTGACCCTAAGCGTGACCC	NA	NA	NA	NA
WP_164882698.1|3375657_3375918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164882699.1|3375903_3376968_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_128273311.1|3377597_3377789_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	1.3e-07
WP_128273313.1|3378000_3378729_+	ash family protein	NA	NA	NA	NA	NA
WP_171276538.1|3378725_3379085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171276539.1|3379081_3379336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171276540.1|3379332_3382137_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	33.5	5.7e-67
WP_042864955.1|3382864_3383089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042016463.1|3383142_3383475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171276541.1|3383486_3384317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171276542.1|3384410_3385646_-	plasmid recombination protein	NA	M1PRU4	Cellulophaga_phage	32.8	4.2e-22
WP_041205253.1|3386283_3387621_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_171276543.1|3388412_3389582_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	28.9	1.7e-09
WP_106886233.1|3390044_3390653_+	LysE family translocator	NA	NA	NA	NA	NA
3389747:3389767	attR	GTGTGACCCTAAGCGTGACCC	NA	NA	NA	NA
WP_171276544.1|3390750_3391761_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_106886231.1|3391833_3392400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171276545.1|3392651_3393392_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_162520060.1|3393682_3394921_-	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_171276546.1|3395216_3396290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171276547.1|3396393_3398103_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_171276548.1|3398371_3399004_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_171276549.1|3399000_3399759_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_163147863.1|3399818_3400895_+	FUSC family protein	NA	NA	NA	NA	NA
WP_171276550.1|3400968_3402342_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_171276551.1|3402429_3402987_-	DUF3332 domain-containing protein	NA	NA	NA	NA	NA
WP_171276552.1|3403148_3404444_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	55.9	3.7e-13
WP_171276553.1|3404637_3405102_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162520145.1|3405164_3405572_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_171276554.1|3405616_3406369_-	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171276555.1|3406361_3407204_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_171276556.1|3407264_3407528_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_171276557.1|3407887_3408247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171276558.1|3408493_3410515_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.9	1.1e-27
WP_041205253.1|3410617_3411955_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_163154175.1|3415067_3416018_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171276559.1|3416340_3417291_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	3659889	3716336	4917765	transposase,integrase,tRNA	Vibrio_phage(22.22%)	58	3676636:3676650	3718075:3718089
WP_005312035.1|3659889_3660630_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_106886065.1|3660700_3661036_-	YqcC family protein	NA	NA	NA	NA	NA
WP_171276672.1|3661247_3662276_+	DUF3549 family protein	NA	NA	NA	NA	NA
WP_041206263.1|3662347_3662644_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_171276673.1|3662710_3662947_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_171276674.1|3663142_3663439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171276675.1|3663448_3664234_+	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_171276676.1|3664327_3664876_-	SecY-interacting protein	NA	NA	NA	NA	NA
WP_171276677.1|3664981_3665830_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HGP3	Vibrio_phage	36.4	2.7e-41
WP_171276678.1|3665944_3668215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139751326.1|3668300_3669896_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	4.3e-19
WP_041206266.1|3670054_3671410_+	LOG family protein	NA	NA	NA	NA	NA
WP_171276679.1|3671542_3672364_+	flap endonuclease Xni	NA	U5PWU8	Bacillus_phage	28.7	6.2e-14
WP_171276680.1|3672402_3673489_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005330735.1|3673696_3674704_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_042649541.1|3674823_3675267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025327941.1|3675349_3676444_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_042649542.1|3676436_3676829_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
3676636:3676650	attL	CCGCACCACCCCAGC	NA	NA	NA	NA
WP_042649543.1|3676863_3677514_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_042649544.1|3677506_3678427_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_171276681.1|3678709_3680845_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.4	9.4e-38
WP_171276682.1|3680911_3681964_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_005330720.1|3682165_3682378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330718.1|3682451_3682676_-	(Na+)-NQR maturation NqrM	NA	NA	NA	NA	NA
WP_139751332.1|3682778_3683822_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_171276683.1|3683825_3685049_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit F	NA	NA	NA	NA	NA
WP_005330713.1|3685066_3685663_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
WP_042654098.1|3685666_3686299_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit D	NA	NA	NA	NA	NA
WP_171276684.1|3686291_3687080_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_005330707.1|3687069_3688299_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit B	NA	NA	NA	NA	NA
WP_171276685.1|3688302_3689646_-	Na(+)-translocating NADH-quinone reductase subunit A	NA	NA	NA	NA	NA
WP_171276680.1|3689986_3691074_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_041204526.1|3691287_3691596_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_139751336.1|3691815_3692949_+	methyltransferase	NA	NA	NA	NA	NA
WP_042649552.1|3692961_3693534_+	YajG family lipoprotein	NA	NA	NA	NA	NA
WP_005330697.1|3693549_3694101_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	30.9	2.0e-08
WP_139751337.1|3694215_3694545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139751338.1|3694630_3696034_+	MFS transporter	NA	NA	NA	NA	NA
WP_139751339.1|3696190_3697033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171276686.1|3697132_3697615_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_171276687.1|3697829_3698777_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_171276688.1|3698813_3699374_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_005342491.1|3699639_3700590_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_139751342.1|3700640_3701039_-	DUF2931 family protein	NA	NA	NA	NA	NA
WP_171276689.1|3701098_3701224_+	tpnC protein	NA	NA	NA	NA	NA
WP_005342491.1|3703106_3704057_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_171277273.1|3704752_3705268_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_171276690.1|3705297_3705729_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.1	2.4e-49
WP_171276691.1|3705731_3706802_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_171276692.1|3706801_3708043_-	organoarsenical effux MFS transporter ArsJ	NA	NA	NA	NA	NA
WP_171276693.1|3708050_3709067_-	ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_171276694.1|3709077_3709593_-	protein phosphatase	NA	NA	NA	NA	NA
WP_005332532.1|3709650_3710019_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171276695.1|3710539_3711748_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	32.3	2.1e-42
WP_171276696.1|3711796_3713404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171276697.1|3713742_3713955_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	46.0	1.4e-07
WP_171276698.1|3714311_3715175_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_171275927.1|3715355_3716336_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	8.1e-45
3718075:3718089	attR	GCTGGGGTGGTGCGG	NA	NA	NA	NA
>prophage 13
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	4033794	4043772	4917765	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_106885841.1|4033794_4035660_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
WP_171276837.1|4035873_4037661_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	1.2e-73
WP_106885839.1|4037750_4038194_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	5.8e-27
WP_005309452.1|4038209_4038425_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_171276838.1|4038604_4039618_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	1.5e-107
WP_043131996.1|4039706_4040690_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.7	4.9e-34
WP_106885838.1|4040736_4041801_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	36.8	2.2e-11
WP_025328241.1|4041810_4042392_-	DedA family protein	NA	NA	NA	NA	NA
WP_005332743.1|4042388_4043006_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	2.4e-34
WP_139745771.1|4043010_4043772_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.4	5.6e-70
>prophage 14
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	4328483	4393412	4917765	transposase,integrase,protease	uncultured_Caudovirales_phage(30.0%)	49	4377899:4377920	4397737:4397758
WP_171276964.1|4328483_4329827_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_025328542.1|4329938_4330463_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_171276965.1|4330542_4333626_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_025328544.1|4333840_4334158_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_171276966.1|4340265_4341459_+	NnrS family protein	NA	NA	NA	NA	NA
WP_111911700.1|4341462_4342032_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171276967.1|4342148_4343300_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_171276968.1|4343447_4344512_+	DUF3103 family protein	NA	NA	NA	NA	NA
WP_025328549.1|4344578_4345475_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_171276969.1|4345802_4346597_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171276970.1|4346674_4348120_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_171276971.1|4348128_4350108_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	2.0e-26
WP_025328553.1|4350308_4350920_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_171276972.1|4351541_4354370_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.4	0.0e+00
WP_025325492.1|4355913_4356165_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_106885152.1|4356327_4357338_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_111910726.1|4357556_4358615_+	porin	NA	NA	NA	NA	NA
WP_171276973.1|4359450_4361493_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_171276974.1|4361555_4362179_+	PepSY-associated TM helix domain-containing protein	NA	NA	NA	NA	NA
WP_171276975.1|4362351_4363389_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_171277286.1|4363545_4364142_-	porin family protein	NA	NA	NA	NA	NA
WP_106885159.1|4364387_4365026_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_171276976.1|4365133_4366024_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.3	4.2e-16
WP_171276977.1|4366187_4366604_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171276978.1|4366725_4367313_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_171276979.1|4367536_4368172_+	Vat family streptogramin A O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	40.7	2.8e-22
WP_171276980.1|4368294_4368834_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171276981.1|4369531_4370752_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_111910738.1|4370784_4371552_-	thiazole synthase	NA	NA	NA	NA	NA
WP_042042049.1|4371553_4371754_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_171276982.1|4371750_4372524_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_171276983.1|4372513_4374088_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_171277287.1|4374084_4376001_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_171276984.1|4376562_4376844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012564931.1|4376934_4377882_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
4377899:4377920	attL	GCACTTCGAAGTTGAATTCGCG	NA	NA	NA	NA
WP_171277288.1|4378189_4379188_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_039026396.1|4379316_4379631_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039026397.1|4379627_4380449_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_171276985.1|4380445_4380910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163135869.1|4380995_4381412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163148074.1|4381502_4382171_+	response regulator	NA	W8CYM9	Bacillus_phage	32.9	3.1e-24
WP_171277289.1|4382200_4383430_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_171276986.1|4383559_4384456_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	37.1	6.5e-41
WP_171276987.1|4384571_4385636_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_171276988.1|4385767_4386184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171276989.1|4386218_4389914_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.3	2.5e-22
WP_106885175.1|4390118_4391396_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.2	2.2e-42
WP_171276990.1|4391848_4392025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096117749.1|4392209_4393412_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	47.1	3.0e-86
4397737:4397758	attR	GCACTTCGAAGTTGAATTCGCG	NA	NA	NA	NA
>prophage 15
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	4602322	4670500	4917765	transposase,tRNA	Bacillus_phage(30.0%)	54	NA	NA
WP_041205253.1|4602322_4603660_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_171277066.1|4603733_4604699_-	DUF4397 domain-containing protein	NA	NA	NA	NA	NA
WP_171277067.1|4604997_4605285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106885291.1|4605309_4605729_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_163148960.1|4605756_4605915_-	DUF3309 family protein	NA	NA	NA	NA	NA
WP_171277068.1|4606172_4606958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171277069.1|4607246_4608140_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171277291.1|4608462_4608933_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_163148884.1|4609426_4610773_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	42.6	4.6e-99
WP_010676219.1|4611820_4612918_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011191341.1|4613208_4614483_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_171277070.1|4614479_4615391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171277071.1|4615572_4615710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171277072.1|4616147_4618319_-	DNA helicase II	NA	A7KV33	Bacillus_phage	35.3	6.2e-114
WP_171277073.1|4618387_4618819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171277074.1|4618853_4620773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163137084.1|4621363_4622362_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_111913265.1|4622459_4624025_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	1.3e-20
WP_041206642.1|4624024_4625143_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025325295.1|4625369_4626335_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025325293.1|4626393_4627299_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025325292.1|4627418_4628546_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	31.0	7.1e-37
WP_163148969.1|4628598_4629453_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_171277075.1|4629531_4630038_+	DinB family protein	NA	NA	NA	NA	NA
WP_171277076.1|4630114_4630837_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_171277077.1|4631171_4633322_+	5-histidylcysteine sulfoxide synthase	NA	NA	NA	NA	NA
WP_168236169.1|4633660_4634584_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171277078.1|4634586_4634802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139744687.1|4634870_4635200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139744688.1|4635192_4635651_-	DMT family transporter	NA	NA	NA	NA	NA
WP_139744689.1|4635641_4636091_-	DMT family transporter	NA	NA	NA	NA	NA
WP_171277079.1|4636478_4637429_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_171277080.1|4637699_4639142_-	amino acid permease	NA	NA	NA	NA	NA
WP_171277081.1|4639309_4639648_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_139707787.1|4639743_4641189_-	amino acid permease	NA	NA	NA	NA	NA
WP_171277082.1|4641292_4641748_-	beta-galactosidase subunit beta	NA	NA	NA	NA	NA
WP_171277083.1|4641744_4644813_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	3.5e-155
WP_163148977.1|4645132_4646098_-	transcriptional regulator EbgR	NA	C6ZCU4	Enterobacteria_phage	25.5	1.7e-15
WP_106885312.1|4652213_4652753_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_171277084.1|4652836_4655593_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.5	6.8e-73
WP_171277085.1|4655993_4656644_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_025325277.1|4656716_4656926_-	cell division protein ZapB	NA	NA	NA	NA	NA
WP_171277086.1|4657160_4658441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025325275.1|4658462_4659242_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_111913694.1|4659250_4660162_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_139745863.1|4660247_4660940_+	response regulator	NA	W8CYM9	Bacillus_phage	38.4	1.7e-33
WP_111913692.1|4660936_4662292_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.6	2.3e-18
WP_171277087.1|4662373_4662838_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_171277292.1|4662888_4664247_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_139745887.1|4664275_4664902_-	SCO family protein	NA	NA	NA	NA	NA
WP_106885322.1|4665116_4665413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025325267.1|4665787_4666414_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	37.3	9.8e-12
WP_171277088.1|4666618_4669042_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_041205253.1|4669162_4670500_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	4694888	4751718	4917765	transposase,tRNA,protease	Pandoravirus(14.29%)	48	NA	NA
WP_171277105.1|4694888_4695746_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	34.4	4.0e-16
WP_025328783.1|4701982_4702507_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_171277106.1|4702514_4703972_-	potassium transporter	NA	NA	NA	NA	NA
WP_171277107.1|4704008_4704626_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.9	4.2e-23
WP_171277108.1|4704625_4705948_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_171277109.1|4706145_4708083_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_171277110.1|4708287_4710435_+	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_171277111.1|4710456_4711620_+	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_025328790.1|4711904_4712627_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_106885438.1|4712678_4714124_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_171277112.1|4714391_4715648_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025328793.1|4715693_4715885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106885436.1|4716166_4716412_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	72.2	2.8e-07
WP_163149960.1|4716433_4716778_+	RidA family protein	NA	NA	NA	NA	NA
WP_106885434.1|4716855_4717512_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_005323913.1|4717678_4717921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106885433.1|4718041_4718284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106885432.1|4718459_4718714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171277113.1|4718999_4719560_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_171277114.1|4719621_4720203_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005320598.1|4720424_4721348_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_171277115.1|4721357_4723427_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_111913549.1|4723597_4724161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163148884.1|4725026_4726373_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	42.6	4.6e-99
WP_171277116.1|4727329_4728280_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171277117.1|4728756_4728984_+	lipoprotein	NA	NA	NA	NA	NA
WP_171277118.1|4729161_4729842_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171277119.1|4729866_4730247_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_171277120.1|4730396_4731614_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_111913051.1|4731852_4733067_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171277121.1|4733137_4734604_-	tryptophanase	NA	NA	NA	NA	NA
WP_139743934.1|4734806_4734914_-	tryptophanase leader peptide	NA	NA	NA	NA	NA
WP_171277122.1|4735023_4736241_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_171277123.1|4736383_4736722_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_171277124.1|4736773_4737940_-	NADH:flavorubredoxin reductase NorW	NA	NA	NA	NA	NA
WP_171277125.1|4737936_4739418_-	anaerobic nitric oxide reductase flavorubredoxin	NA	NA	NA	NA	NA
WP_171277126.1|4739589_4741113_+	nitric oxide reductase transcriptional regulator NorR	NA	NA	NA	NA	NA
WP_041205253.1|4741168_4742506_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_106885418.1|4742627_4743632_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	32.2	6.1e-32
WP_162520030.1|4744067_4745189_+	high-affinity branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106885416.1|4745255_4746182_+	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_162627384.1|4746181_4747450_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_111913035.1|4747446_4748232_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A285PWH2	Cedratvirus	26.8	3.2e-12
WP_106885413.1|4748242_4748944_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.1	3.0e-17
WP_171277127.1|4748946_4749792_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_025328821.1|4749770_4750364_-	LysE family translocator	NA	NA	NA	NA	NA
WP_025328822.1|4750531_4750855_+	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_171277294.1|4750884_4751718_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
>prophage 17
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	4796067	4822552	4917765	transposase,integrase	Staphylococcus_prophage(50.0%)	17	4805770:4805787	4828214:4828231
WP_039026397.1|4796067_4796889_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_039026396.1|4796885_4797200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_101618233.1|4797488_4798133_+	fructose-6-phosphate aldolase	NA	A0A0E3F5V4	Synechococcus_phage	27.9	1.1e-13
WP_101618231.1|4798193_4799843_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_171277295.1|4800170_4800701_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_012564931.1|4800754_4801702_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_171275927.1|4801767_4802748_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	8.1e-45
WP_104451977.1|4803468_4804386_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.4e-99
WP_158656238.1|4804484_4804643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104452074.1|4804746_4806450_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
4805770:4805787	attL	CTGGAGCAGGGGGGCTAC	NA	NA	NA	NA
WP_104452073.1|4809096_4810413_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_158656237.1|4810417_4812682_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_104452071.1|4812844_4814752_-	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_104452070.1|4815690_4817289_-	transcriptional antiterminator	NA	NA	NA	NA	NA
WP_158656236.1|4817288_4818794_-	TniQ family protein	NA	NA	NA	NA	NA
WP_104452069.1|4818796_4820467_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_104452068.1|4820467_4822552_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
4828214:4828231	attR	CTGGAGCAGGGGGGCTAC	NA	NA	NA	NA
>prophage 18
NZ_CP038441	Aeromonas media strain T0.1-19 chromosome, complete genome	4917765	4841811	4897936	4917765	transposase,tRNA	Salmonella_phage(18.18%)	46	NA	NA
WP_106885383.1|4841811_4843701_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_025328874.1|4844209_4844659_-	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_171277148.1|4845044_4847153_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_171277149.1|4847214_4848861_+	multidrug ABC transporter permease/ATP-binding protein	NA	NA	NA	NA	NA
WP_171277150.1|4848979_4849744_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	27.4	1.6e-11
WP_171277296.1|4849718_4850675_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_171277151.1|4850671_4852654_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_171277152.1|4852920_4854240_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_042047685.1|4854239_4854494_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042878565.1|4855032_4855656_+	recombinase family protein	NA	NA	NA	NA	NA
WP_103243989.1|4856423_4858889_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	24.6	2.5e-10
WP_103243988.1|4859009_4860497_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	27.8	3.6e-36
WP_103243987.1|4860496_4862284_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_103243986.1|4862381_4864265_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001809438.1|4865149_4866181_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_103243956.1|4866733_4867516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103243955.1|4867536_4868139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103243954.1|4868401_4868737_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080937910.1|4868744_4869596_+	AAA family ATPase	NA	A0A0E3GMB2	Rhodoferax_phage	29.3	4.3e-18
WP_103243953.1|4869582_4870422_+	replication protein C	NA	NA	NA	NA	NA
WP_161646994.1|4870634_4871912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161646995.1|4872099_4872993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161647038.1|4873947_4874397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022542389.1|4874615_4875620_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|4875698_4876256_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|4876249_4876621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|4876617_4877118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|4877114_4877441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|4877695_4878052_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100872.1|4878288_4878675_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|4878671_4878962_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100881.1|4879120_4882087_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_022542389.1|4882165_4883170_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_171277297.1|4883344_4884097_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	28.6	1.5e-11
WP_045892401.1|4884093_4885368_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_004099020.1|4885524_4885896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011191342.1|4886213_4887482_+|transposase	IS4-like element ISApu1 family transposase	transposase	NA	NA	NA	NA
WP_171269953.1|4887859_4888468_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_161647011.1|4888552_4889677_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_012564931.1|4889855_4890803_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_161647010.1|4891417_4892683_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	55.6	4.6e-125
WP_161647009.1|4892684_4893107_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.0	8.0e-34
WP_161647008.1|4893542_4893842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161647007.1|4894309_4896283_+	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	24.9	2.3e-30
WP_171277153.1|4896279_4897077_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_005342491.1|4896985_4897936_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
