The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053245	Escherichia coli strain SCU-485 chromosome, complete genome	4675501	167870	177315	4675501		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|167870_169007_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001337891.1|169003_171007_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001296231.1|171131_171593_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|171633_172104_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|172150_172870_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_170969189.1|172866_174552_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	97.0	4.7e-303
WP_001240394.1|174773_175505_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|175564_175672_+	protein YohO	NA	NA	NA	NA	NA
WP_170969190.1|175652_176384_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569375.1|176388_177315_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	3.3e-08
>prophage 2
NZ_CP053245	Escherichia coli strain SCU-485 chromosome, complete genome	4675501	751495	758635	4675501		Escherichia_phage(83.33%)	6	NA	NA
WP_000103861.1|751495_754057_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	6.0e-31
WP_001141292.1|754162_754819_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	2.5e-50
WP_001296319.1|754869_755637_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847999.1|755832_756741_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	3.3e-117
WP_000590417.1|756737_758000_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|757996_758635_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 3
NZ_CP053245	Escherichia coli strain SCU-485 chromosome, complete genome	4675501	1763441	1770711	4675501		Enterobacteria_phage(85.71%)	8	NA	NA
WP_001283021.1|1763441_1764176_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149152.1|1764728_1764995_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	2.4e-44
WP_000980257.1|1764991_1765591_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	1.3e-50
WP_001244665.1|1765583_1765871_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459309.1|1765863_1766319_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	4.7e-64
WP_000856725.1|1766454_1766775_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783672.1|1766789_1769123_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_001280585.1|1769673_1770711_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	5.7e-73
>prophage 4
NZ_CP053245	Escherichia coli strain SCU-485 chromosome, complete genome	4675501	3454678	3531514	4675501	lysis,head,tail,portal,capsid,plate,protease,integrase,terminase	Salmonella_phage(66.67%)	85	3454578:3454604	3488936:3488962
3454578:3454604	attL	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_001372563.1|3454678_3455731_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
WP_170969237.1|3456792_3457662_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_000188448.1|3457807_3458029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032236495.1|3458061_3458571_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	7.5e-87
WP_023150404.1|3458578_3458779_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	3.5e-32
WP_000963472.1|3458742_3459084_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244165.1|3459151_3459385_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000752613.1|3459384_3459612_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_023150402.1|3459608_3460466_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
WP_042115142.1|3460462_3462877_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.4	0.0e+00
WP_001154434.1|3463028_3463217_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217568.1|3463228_3463462_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_000094764.1|3463732_3463948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021556032.1|3463947_3464790_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.1	1.1e-58
WP_170969238.1|3465150_3465669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170969222.1|3465593_3465791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170969223.1|3465864_3466050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658058.1|3466100_3467123_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.8	3.5e-168
WP_001098431.1|3467122_3468889_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216257.1|3469031_3469865_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_021556030.1|3469881_3470940_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	6.4e-181
WP_021556029.1|3470943_3471594_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.9e-111
WP_000673520.1|3471689_3472154_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000868175.1|3472153_3472357_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|3472360_3472576_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069896.1|3472556_3473069_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	1.2e-87
WP_021556028.1|3473070_3473448_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	38.4	1.3e-14
WP_001348125.1|3473444_3473873_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	1.7e-47
WP_001039953.1|3473968_3474400_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	3.8e-71
WP_000829125.1|3474392_3474839_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	82.4	1.3e-61
WP_021556027.1|3475836_3476415_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	3.6e-93
WP_001522712.1|3476411_3476771_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	88.2	5.0e-53
WP_021556026.1|3476757_3477666_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	1.2e-143
WP_001086820.1|3477658_3478264_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_137490145.1|3478260_3479847_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.1	9.2e-208
WP_021556048.1|3479846_3480452_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.9	8.4e-93
WP_021542924.1|3480420_3480618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071779871.1|3480604_3480985_-	hypothetical protein	NA	I3PGW0	Xanthomonas_phage	31.8	3.0e-08
WP_021542925.1|3481015_3481582_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	8.4e-87
WP_000046142.1|3481724_3482897_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207660.1|3482906_3483422_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281016.1|3483476_3483779_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_000763311.1|3483793_3483913_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_021556024.1|3483905_3486983_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.2	0.0e+00
WP_021542927.1|3486979_3487465_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.4e-66
WP_021556023.1|3487461_3488562_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	8.4e-176
WP_000972391.1|3488652_3488871_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|3489107_3490793_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3488936:3488962	attR	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681104.1|3491062_3491440_+	membrane protein	NA	NA	NA	NA	NA
WP_001195231.1|3491469_3491727_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201570.1|3491886_3492174_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189176.1|3492157_3492880_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|3492940_3493843_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|3493930_3494407_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|3494756_3495869_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|3495963_3497097_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105433.1|3497106_3498060_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|3498056_3498902_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|3498961_3499450_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149695.1|3499490_3500618_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	7.9e-28
WP_001295905.1|3500646_3501378_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|3501602_3502271_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001692.1|3502270_3502987_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|3502993_3503725_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|3503742_3504471_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001295906.1|3504688_3505204_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|3505329_3505653_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255186.1|3505649_3506480_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001305933.1|3506476_3507490_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136518.1|3507588_3509019_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566390.1|3509029_3510031_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815373.1|3510067_3511786_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000178694.1|3511918_3512887_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458803.1|3512898_3514551_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|3514694_3515594_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|3515914_3516610_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599811.1|3517035_3518694_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|3518690_3519647_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746478.1|3519797_3520913_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188147.1|3520909_3522856_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|3522930_3523155_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|3523477_3523798_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|3523828_3526105_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097880.1|3527300_3528284_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	5.8e-43
WP_001580554.1|3528280_3531514_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	5.9e-84
>prophage 5
NZ_CP053245	Escherichia coli strain SCU-485 chromosome, complete genome	4675501	3616588	3690423	4675501	lysis,head,tail,portal,capsid,plate,protease,integrase,holin,terminase	Enterobacteria_phage(35.09%)	91	3625533:3625550	3684159:3684176
WP_000156498.1|3616588_3618349_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877153.1|3618534_3618987_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001441917.1|3619064_3620105_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288694.1|3620460_3620970_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839136.1|3621188_3621818_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875041.1|3621780_3623943_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261236.1|3623952_3624399_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001580558.1|3624521_3626576_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
3625533:3625550	attL	CCAGAAGGTAATTTCTGG	NA	NA	NA	NA
WP_001295939.1|3626607_3627066_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|3627161_3627824_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|3627996_3628410_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|3628454_3628772_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116316.1|3628829_3630020_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048230.1|3630114_3630393_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904439.1|3630389_3630719_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|3630810_3631470_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001058323.1|3632192_3633311_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107398.1|3633307_3635101_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|3635119_3635827_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003641.1|3635823_3636411_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063989.1|3636407_3636806_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004936.1|3636802_3637660_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263563.1|3637793_3639338_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460803.1|3639349_3640486_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|3640498_3640591_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001580561.1|3640670_3641981_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000087763.1|3641968_3642181_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|3642466_3642679_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|3642689_3642878_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001313723.1|3642852_3643083_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|3643072_3643246_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818454.1|3643294_3644368_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054716.1|3644450_3647183_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	5.4e-38
WP_000533661.1|3647277_3648351_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.3	2.2e-197
WP_001337487.1|3648328_3648547_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	1.1e-34
WP_001277770.1|3648660_3648840_-	Eag protein	NA	K7PL40	Enterobacteria_phage	98.3	7.3e-29
WP_000103023.1|3648936_3649590_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	48.5	4.8e-62
WP_001289872.1|3649586_3649958_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	91.4	9.2e-34
WP_001580565.1|3650734_3650917_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	2.4e-27
WP_170969224.1|3651531_3652377_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	96.5	6.5e-144
WP_000389051.1|3654292_3655042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000858975.1|3655164_3655854_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|3655958_3656189_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_021556020.1|3656258_3656798_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	3.4e-61
WP_170969225.1|3656794_3657814_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	3.3e-110
WP_001580570.1|3657810_3658512_+	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	96.6	1.3e-126
WP_000338263.1|3658715_3659735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122138.1|3659737_3660349_+	NADAR family protein	NA	A0A1X7BZM3	Faustovirus	31.6	9.0e-10
WP_000151203.1|3660623_3660827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077695386.1|3660926_3661028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053042.1|3661024_3661480_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
WP_000224907.1|3661479_3661650_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774495.1|3661642_3661933_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099699.1|3661929_3662292_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	2.5e-60
WP_000971054.1|3662288_3662429_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097220.1|3662425_3663115_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000136427.1|3663336_3664140_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	48.6	8.6e-69
WP_000544528.1|3664368_3664674_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180488.1|3664660_3665137_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	1.1e-84
WP_001228695.1|3665353_3665536_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|3665626_3665920_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001140097.1|3666445_3666796_+	HNH endonuclease	NA	Q8SBD7	Shigella_phage	93.1	2.2e-61
WP_000929183.1|3666921_3667416_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.9e-87
WP_137472634.1|3667649_3669146_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.4e-298
WP_000605602.1|3669157_3669340_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	95.0	3.2e-24
WP_001407096.1|3669339_3670581_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.0e-241
WP_001193635.1|3670558_3671209_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.6	2.4e-117
WP_000257518.1|3671223_3672429_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	4.1e-224
WP_000601363.1|3672478_3672679_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_000927711.1|3672681_3673005_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|3673001_3673412_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000213498.1|3673386_3673893_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	98.2	7.2e-90
WP_000497751.1|3674458_3674629_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155729.1|3674612_3676109_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	1.9e-271
WP_000090993.1|3676108_3676465_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|3676464_3676734_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807220.1|3676875_3678711_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	3.5e-307
WP_001580576.1|3678771_3680100_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.3	4.2e-246
WP_000999515.1|3680096_3681176_+	hypothetical protein	NA	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_001259079.1|3681175_3681724_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	100.0	2.3e-97
WP_000424734.1|3681723_3682149_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	5.2e-81
WP_000785333.1|3682135_3683194_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.0	2.3e-199
WP_001580577.1|3683184_3683769_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	4.1e-113
WP_000554672.1|3683772_3684417_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	66.8	4.9e-67
3684159:3684176	attR	CCAGAAATTACCTTCTGG	NA	NA	NA	NA
WP_000371169.1|3684419_3684863_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	59.9	1.9e-46
WP_001580578.1|3684834_3685140_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	78.4	1.0e-22
WP_001100056.1|3685384_3687034_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	33.3	4.5e-64
WP_000703646.1|3687020_3687950_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	91.4	1.5e-157
WP_000915532.1|3687949_3688312_-	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	90.0	4.1e-55
WP_001264953.1|3688729_3689758_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|3689730_3690423_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
>prophage 6
NZ_CP053245	Escherichia coli strain SCU-485 chromosome, complete genome	4675501	3820289	3868052	4675501	head,tail,portal,capsid,tRNA,integrase,terminase	Enterobacteria_phage(60.98%)	51	3812926:3812941	3875856:3875871
3812926:3812941	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_001441929.1|3820289_3821396_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|3821449_3821911_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248662.1|3821920_3822574_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|3822745_3823996_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|3824109_3825252_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|3825241_3825478_-	excisionase	NA	NA	NA	NA	NA
WP_000488403.1|3825617_3825857_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	6.7e-38
WP_000149539.1|3826685_3826868_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	6.3e-28
WP_000712396.1|3830884_3831577_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000184665.1|3831687_3831915_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182882.1|3831945_3832485_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000147914.1|3832481_3833501_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	2.7e-112
WP_000788877.1|3833497_3834199_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145918.1|3834195_3834498_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	93.5	1.3e-41
WP_001070442.1|3834565_3834898_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_014640128.1|3834946_3835096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700203.1|3837035_3838079_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072093903.1|3838428_3838530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053004.1|3838526_3838982_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_000224907.1|3838981_3839152_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774475.1|3839144_3839435_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099697.1|3839431_3839794_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971095.1|3839790_3839931_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_021556015.1|3840016_3840400_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	81.7	1.1e-53
WP_000737271.1|3840588_3841671_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_170969226.1|3842792_3843032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3844967_3845294_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|3845500_3845683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453580.1|3846246_3846792_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027282.1|3846766_3848692_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|3848688_3848895_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001337540.1|3848891_3850493_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000123325.1|3850473_3851805_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	96.8	3.0e-228
WP_000201478.1|3851814_3852147_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_000118193.1|3852202_3853228_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_000158881.1|3853269_3853665_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.6e-55
WP_000752960.1|3853676_3854030_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000985127.1|3854041_3854620_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_000683157.1|3854616_3855012_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	1.2e-68
WP_001524522.1|3855019_3855760_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	1.1e-131
WP_000479173.1|3855775_3856198_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.2e-68
WP_000459452.1|3856179_3856614_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000840357.1|3856606_3859168_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.0	0.0e+00
WP_000847379.1|3859164_3859494_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152626.1|3859493_3860192_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_001337536.1|3860196_3860940_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_000090899.1|3860876_3861509_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	95.7	4.2e-95
WP_000515311.1|3861569_3864983_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_001230375.1|3865052_3865652_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_001350275.1|3865716_3867777_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	5.7e-125
WP_000654168.1|3867773_3868052_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
3875856:3875871	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 7
NZ_CP053245	Escherichia coli strain SCU-485 chromosome, complete genome	4675501	4599559	4674330	4675501	transposase,integrase	Bacillus_phage(25.0%)	46	4604132:4604146	4673502:4673516
WP_001124532.1|4599559_4600822_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.8	1.5e-80
WP_000592084.1|4602087_4603551_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_000243502.1|4603603_4604161_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
4604132:4604146	attL	GCTCTTTCTTTTGTT	NA	NA	NA	NA
WP_000964095.1|4605515_4607036_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_000429747.1|4608137_4608413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000722537.1|4608423_4608954_-	lipoprotein	NA	NA	NA	NA	NA
WP_000451985.1|4609324_4609666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170969240.1|4611303_4611519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000539659.1|4618342_4618738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564590.1|4618787_4619030_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001091322.1|4619103_4619400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170969234.1|4619452_4619746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001580717.1|4619827_4620046_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000830399.1|4620261_4621098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311896.1|4621559_4622357_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|4622694_4623957_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
WP_000703040.1|4624150_4625455_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286283.1|4625482_4626763_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_001295637.1|4626755_4628558_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001327262.1|4628544_4630257_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.8e-31
WP_000970688.1|4630513_4631473_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623047.1|4631663_4637771_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000982871.1|4647340_4648441_+	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_160342141.1|4648503_4649241_+	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_001088832.1|4649244_4650822_+	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_000784543.1|4650953_4652975_+	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_001337596.1|4653668_4654379_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000646568.1|4654511_4655774_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001337597.1|4655822_4656470_+	invasin	NA	NA	NA	NA	NA
WP_000480520.1|4656597_4657650_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378563.1|4657964_4659281_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060226.1|4659382_4660837_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532923.1|4661167_4661884_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015912519.1|4662520_4664164_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011024.1|4664281_4665232_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011478.1|4665333_4666251_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000055690.1|4666815_4668078_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.8	2.1e-77
WP_000526101.1|4668216_4668675_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	2.1e-11
WP_000511773.1|4669626_4670505_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_001147230.1|4670949_4671306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373724.1|4671352_4671685_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_000288812.1|4671685_4671943_-	antitoxin	NA	NA	NA	NA	NA
WP_077561361.1|4672040_4672232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000983730.1|4672290_4672497_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	65.7	3.3e-17
WP_000201267.1|4672493_4672961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001580729.1|4673193_4674330_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
4673502:4673516	attR	GCTCTTTCTTTTGTT	NA	NA	NA	NA
