The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053231	Escherichia coli strain SCU-306 chromosome, complete genome	5029448	727759	790360	5029448	capsid,holin,tail,protease,terminase,integrase,portal,head	Escherichia_phage(37.78%)	68	732483:732498	797726:797741
WP_000422062.1|727759_728809_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559260.1|729028_729787_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_001278741.1|729783_730374_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|730413_731289_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001350892.1|731501_733397_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
732483:732498	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
WP_001295575.1|733424_734045_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285667.1|734041_734923_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|735060_735105_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194639.1|735196_736759_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|736758_738354_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001195306.1|738357_739716_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000209529.1|739727_740921_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443098.1|740920_741727_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000134814.1|742107_742287_+	general stress protein	NA	NA	NA	NA	NA
WP_001056507.1|742372_742873_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079492.1|742918_743425_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000251936.1|743912_744083_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000937495.1|744197_744467_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|744523_745192_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885580.1|745246_745831_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_016230679.1|745830_748806_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	85.3	2.1e-48
WP_001233195.1|748957_749557_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_170969038.1|753591_754182_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	81.7	1.7e-66
WP_000847402.1|755558_755888_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_000082348.1|755884_758458_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000533402.1|758438_758852_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|758878_759310_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235110.1|759323_760076_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|760083_760479_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|760475_761009_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|761024_761378_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201495.1|761370_761754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522591.1|761805_762834_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|762891_763239_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253963.1|763275_764781_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_000831818.1|764770_766363_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_000259002.1|766359_766566_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_170969039.1|766549_766855_-|terminase	phage terminase large subunit family protein	terminase	A0A2I6TC92	Escherichia_phage	60.9	2.1e-20
WP_000867575.1|768442_768991_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000057035.1|769662_770073_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_000992052.1|771140_771674_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
WP_001351274.1|771779_772052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193259.1|772017_772362_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_000372595.1|772366_772582_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001331709.1|772850_773078_-	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000935515.1|774352_775402_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_000917749.1|775552_775750_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000762880.1|775974_776796_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904114.1|776792_777167_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001265108.1|777179_778226_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_011478175.1|778227_778506_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_000813256.1|778673_778829_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_122083109.1|778930_779038_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000354966.1|779446_780448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639476.1|780463_781426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151216.1|781617_782040_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_001262357.1|782080_783151_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693867.1|783222_783648_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|783631_783874_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001362937.1|784265_784604_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000379589.1|784896_785052_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171970.1|785211_785433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|785433_785598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|785998_786187_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090203.1|786183_786375_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048435.1|786467_788939_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_000113189.1|789003_789252_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|789229_790360_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
797726:797741	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
>prophage 2
NZ_CP053231	Escherichia coli strain SCU-306 chromosome, complete genome	5029448	845100	943706	5029448	capsid,tRNA,tail,transposase,protease,terminase,integrase,portal,head	Enterobacteria_phage(44.64%)	110	869412:869427	945675:945690
WP_000152933.1|845100_845685_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505872.1|845801_846893_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001362932.1|847082_847259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350856.1|847296_849216_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733693.1|849443_850514_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001298093.1|850524_851157_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001331726.1|851167_852586_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000841739.1|852904_854602_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000060148.1|854937_855960_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001261263.1|855959_856940_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173308.1|856936_857695_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-14
WP_000904011.1|857704_858517_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000576827.1|858513_859368_+	ModD protein	NA	NA	NA	NA	NA
WP_001331731.1|859393_861364_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|861413_861668_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020122.1|861868_862603_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295994.1|862604_863216_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051575.1|863315_864230_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|864324_866061_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197868.1|866117_867188_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266907.1|867197_868496_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|868825_870358_+	SpoVR family protein	NA	NA	NA	NA	NA
869412:869427	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|870520_871240_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406401.1|871461_873003_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943452.1|873148_873679_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457594.1|873723_874992_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.0	5.3e-206
WP_000897380.1|874991_875411_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	2.6e-37
WP_000807627.1|876204_876666_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|876742_877402_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|877473_877767_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000693755.1|878008_878410_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056851.1|878529_878898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|879417_880113_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|880136_880949_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|880952_881219_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131456.1|881969_882089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331738.1|882049_882235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128542949.1|882351_882525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304448.1|882586_882871_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000979977.1|882874_883210_+	YmgD family protein	NA	NA	NA	NA	NA
WP_001065862.1|885184_885403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065750.1|886725_886974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888771.1|887086_887353_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858013.1|887381_887654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000554153.1|887696_887933_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001298110.1|888246_889458_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332310.1|889662_890394_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	9.3e-54
WP_000373104.1|890614_891019_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_001445545.1|891071_891197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|891280_891433_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_170969040.1|896888_897182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000654167.1|897194_897473_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_170969026.1|902005_903079_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.0	5.1e-194
WP_000847405.1|905146_905476_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_000840267.1|905472_908034_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.4	0.0e+00
WP_000459474.1|908026_908461_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000479129.1|908442_908865_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_001351266.1|908880_909621_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000683145.1|909628_910024_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_000975062.1|910020_910599_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_001204540.1|910610_910964_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|910956_911331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128542972.1|911382_912411_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256840.1|912468_912816_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253914.1|912852_914358_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000831761.1|914347_915940_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000258997.1|915936_916143_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_170969041.1|916126_918055_-|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	66.7	1.1e-258
WP_000867574.1|918026_918575_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000881610.1|919137_919320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|919526_919853_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|920333_920627_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000737271.1|922415_923498_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|923686_924070_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971053.1|924155_924296_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001099712.1|924292_924655_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000386643.1|924861_925203_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254243.1|925205_925382_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000153286.1|925378_925906_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|925902_926343_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_136952279.1|926626_927840_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_170969042.1|927891_928020_-	MarR family transcriptional regulator	NA	A0A1I9LJP5	Stx_converting_phage	100.0	1.1e-15
WP_000788872.1|928016_928718_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000185431.1|928714_929614_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000442609.1|929646_929943_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|930084_930300_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|930375_931071_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|931110_931668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|931664_932417_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|932693_932876_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088199.1|932853_933126_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066170.1|933142_933724_-	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000213979.1|933937_934138_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|934320_934689_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|934761_934926_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|934894_935038_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995434.1|935113_935410_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000100847.1|935415_936201_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|936197_936878_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|936874_937057_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|937029_937221_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000763374.1|937607_937829_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|937828_938155_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|938138_938378_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|938517_938754_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|938743_939886_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|939999_941250_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248695.1|941421_942075_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|942084_942546_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|942599_943706_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
945675:945690	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
>prophage 3
NZ_CP053231	Escherichia coli strain SCU-306 chromosome, complete genome	5029448	1171324	1285355	5029448	capsid,tRNA,tail,protease,lysis,transposase,terminase,integrase,portal,plate,head	Salmonella_phage(54.69%)	112	1192144:1192159	1266901:1266916
WP_000886683.1|1171324_1172617_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067797.1|1172707_1174051_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|1174061_1174673_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_128542923.1|1174831_1178875_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1179009_1179504_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|1180047_1181013_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043638.1|1181135_1182902_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_001202198.1|1182902_1184624_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241673.1|1184665_1185370_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1185654_1185873_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000350182.1|1186734_1187289_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001029748.1|1187299_1188301_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000415806.1|1189231_1190539_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001101565.1|1190868_1194102_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
1192144:1192159	attL	TTTTTCATCAAACCAG	NA	NA	NA	NA
WP_000097886.1|1194098_1195082_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_000934041.1|1195974_1198251_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1198281_1198602_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1198924_1199149_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188147.1|1199221_1201168_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746477.1|1201164_1202280_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001351020.1|1202430_1203387_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599804.1|1203383_1205042_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_128542922.1|1205467_1206163_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491135.1|1206483_1207383_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|1207526_1209179_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178694.1|1209190_1210159_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815373.1|1210291_1212010_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000566391.1|1212046_1213048_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136572.1|1213058_1214489_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|1214587_1215601_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255187.1|1215597_1216428_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001160737.1|1216424_1216748_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001298306.1|1216873_1217389_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1217606_1218335_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|1218352_1219084_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001692.1|1219090_1219807_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|1219806_1220475_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|1220700_1221432_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149763.1|1221460_1222588_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
WP_000389260.1|1222628_1223117_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061669.1|1223176_1224022_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105433.1|1224018_1224972_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|1224981_1226115_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126095.1|1226209_1227322_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1227671_1228148_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1228235_1229138_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189165.1|1229198_1229921_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201575.1|1229904_1230192_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195230.1|1230351_1230609_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_000681104.1|1230638_1231016_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|1231285_1232971_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|1233206_1233425_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_164538573.1|1233515_1234616_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.8	1.2e-177
WP_000980384.1|1234612_1235098_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.8e-66
WP_170969043.1|1235094_1238175_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.3	4.0e-311
WP_001513105.1|1238167_1238287_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.2e-13
WP_001281016.1|1238301_1238604_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001504081.1|1238658_1239174_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_103488340.1|1239183_1240356_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.0e-203
WP_103488341.1|1240498_1241065_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	8.4e-87
WP_170969044.1|1241092_1241548_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	60.6	4.1e-52
WP_170969045.1|1241547_1242156_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	1.3e-96
WP_074014618.1|1242121_1242325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170969046.1|1242299_1243982_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.8	2.4e-153
WP_001086820.1|1243978_1244584_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_170969047.1|1244576_1245485_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
WP_001583421.1|1245471_1245831_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	1.5e-52
WP_039516405.1|1245827_1246406_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	3.6e-93
WP_023135313.1|1246474_1246921_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_001595569.1|1246913_1247345_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
WP_023135316.1|1247440_1247869_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_000727851.1|1247865_1248243_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_001069905.1|1248244_1248757_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|1248737_1248953_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|1248956_1249160_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|1249159_1249624_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_025790323.1|1249719_1250370_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	3.3e-111
WP_170969048.1|1250373_1251432_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_001459608.1|1251448_1252282_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	3.1e-122
WP_001098411.1|1252424_1254191_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_039516393.1|1254190_1255219_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	4.0e-172
WP_170969049.1|1255266_1256184_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_039516388.1|1256146_1257349_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	36.2	2.9e-60
WP_001217575.1|1257674_1257908_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|1257918_1258107_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_170969050.1|1258260_1260675_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_032176111.1|1260671_1261529_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	1.3e-160
WP_000752613.1|1261525_1261753_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244212.1|1261752_1261986_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_000996718.1|1262053_1262395_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	92.9	6.9e-52
WP_000956192.1|1262512_1262809_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460893.1|1262816_1263326_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188450.1|1263390_1263594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170969085.1|1263739_1264309_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	1.9e-38
WP_000900883.1|1264324_1264516_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001544402.1|1264704_1265757_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	6.1e-107
WP_170969051.1|1265823_1266252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357141.1|1266653_1266866_+	colibactin biosynthesis LuxR family transcriptional regulator ClbR	NA	NA	NA	NA	NA
WP_001217110.1|1266866_1267601_+	colibactin biosynthesis phosphopantetheinyl transferase ClbA	NA	NA	NA	NA	NA
1266901:1266916	attR	TTTTTCATCAAACCAG	NA	NA	NA	NA
WP_001327752.1|1269345_1269573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986344.1|1269621_1270557_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001166163.1|1270618_1271698_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001296197.1|1271709_1272453_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973199.1|1272449_1272995_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_000966628.1|1274666_1276814_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000502870.1|1277184_1277829_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_001362826.1|1277813_1279037_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	1.5e-61
WP_024174324.1|1280075_1280738_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_059340539.1|1280751_1281948_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000582572.1|1281982_1282507_+	acetyltransferase	NA	NA	NA	NA	NA
WP_001534252.1|1282508_1283282_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000555401.1|1284221_1285355_-|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP053231	Escherichia coli strain SCU-306 chromosome, complete genome	5029448	1347524	1353833	5029448		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100791.1|1347524_1348073_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_000857549.1|1348077_1348956_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023627.1|1349013_1349913_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000699418.1|1349912_1350998_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_000183060.1|1351370_1352264_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115981.1|1352438_1353833_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
>prophage 5
NZ_CP053231	Escherichia coli strain SCU-306 chromosome, complete genome	5029448	1450583	1458895	5029448		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001332210.1|1450583_1452587_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|1452711_1453173_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1453213_1453684_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1453730_1454450_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1454446_1456132_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|1456353_1457085_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|1457144_1457252_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|1457232_1457964_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|1457968_1458895_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 6
NZ_CP053231	Escherichia coli strain SCU-306 chromosome, complete genome	5029448	1913542	2002181	5029448	capsid,holin,tRNA,tail,transposase,protease,lysis,terminase,portal,plate,head	Shigella_phage(42.86%)	95	NA	NA
WP_000083664.1|1913542_1914280_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1914411_1915746_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|1915778_1916660_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|1916762_1917350_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1917405_1917789_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|1918093_1918783_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|1918830_1919868_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1920074_1920494_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|1920562_1921261_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|1921292_1923953_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1924066_1925422_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_136952279.1|1925678_1926892_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_170969057.1|1926951_1927104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298619.1|1927100_1928399_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001350770.1|1936865_1939439_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|1939568_1940300_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079096.1|1940296_1941277_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1941411_1942149_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1942418_1942760_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|1942863_1942911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|1943009_1944170_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|1944212_1945334_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|1945344_1946415_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|1946624_1946990_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|1947138_1947657_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|1947646_1948873_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|1948888_1949371_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1949447_1949795_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1949836_1950604_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1950634_1951183_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1951201_1951450_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1951586_1952948_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1953114_1953906_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|1953926_1955213_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|1955267_1955861_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|1955983_1956862_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|1956947_1958609_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1958757_1959099_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|1959160_1959451_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|1959440_1959917_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1960048_1960531_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000183405.1|1961687_1962476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174562.1|1962563_1962857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|1963067_1963841_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|1964892_1966782_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|1967035_1967527_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|1967529_1967973_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|1967944_1968547_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554717.1|1968546_1969290_-|tail	tail fiber protein	tail	O22004	Shigella_phage	91.7	1.1e-49
WP_000539246.1|1969293_1969878_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785328.1|1969868_1970927_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|1970913_1971339_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|1971338_1971887_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|1971886_1972966_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|1972962_1974291_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|1974351_1976187_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|1976328_1976598_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|1976597_1976954_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|1976953_1978450_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|1978433_1978604_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|1978612_1979173_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|1979169_1979676_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|1979650_1980061_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|1980057_1980381_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|1980383_1980584_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|1980633_1981839_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|1981853_1982504_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466267.1|1982481_1983723_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|1983722_1983905_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|1983916_1985413_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|1985646_1986141_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|1986266_1986617_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000026993.1|1986719_1987160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332386.1|1987266_1987518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|1987588_1988026_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|1988022_1988499_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|1988485_1988791_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|1988942_1989278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|1989463_1990216_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001351089.1|1990229_1991219_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	1.1e-190
WP_170969058.1|1991226_1992024_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	8.3e-149
WP_000767115.1|1992043_1992433_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_000210172.1|1992429_1992756_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001332383.1|1992752_1993406_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_001332382.1|1993405_1993900_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|1993896_1994838_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|1994827_1995007_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|1995182_1995734_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|1995777_1995978_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|1996068_1996743_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|1996945_1997458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170969059.1|1997926_1998289_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	97.5	3.6e-59
WP_170969060.1|1998354_1999179_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.9e-149
WP_001331174.1|2000841_2001048_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_128542944.1|2001008_2002181_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.7	5.1e-147
>prophage 7
NZ_CP053231	Escherichia coli strain SCU-306 chromosome, complete genome	5029448	2077701	2084841	5029448		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|2077701_2080263_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|2080368_2081025_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|2081075_2081843_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|2082038_2082947_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|2082943_2084206_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|2084202_2084841_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 8
NZ_CP053231	Escherichia coli strain SCU-306 chromosome, complete genome	5029448	3146703	3155446	5029448	integrase	Morganella_phage(50.0%)	12	3146583:3146595	3149061:3149073
3146583:3146595	attL	TCATGAGCTATCA	NA	NA	NA	NA
WP_001351217.1|3146703_3147972_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.3	5.1e-193
WP_001059729.1|3147968_3148619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001363069.1|3149090_3149309_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
3149061:3149073	attR	TCATGAGCTATCA	NA	NA	NA	NA
WP_000412532.1|3149308_3149740_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
WP_001019373.1|3149752_3150586_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	9.0e-21
WP_000042975.1|3150578_3150758_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000613400.1|3150754_3151822_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	8.6e-16
WP_001065741.1|3151814_3152009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024678.1|3152005_3152269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|3152265_3152487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058741.1|3152479_3153082_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	33.3	2.6e-22
WP_001332287.1|3153094_3155446_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	48.2	1.7e-72
>prophage 9
NZ_CP053231	Escherichia coli strain SCU-306 chromosome, complete genome	5029448	4138690	4144057	5029448	tail	Enterobacteria_phage(66.67%)	7	NA	NA
WP_170969071.1|4138690_4139005_+	hypothetical protein	NA	A5LH35	Enterobacteria_phage	65.1	4.1e-27
WP_170969072.1|4139004_4139322_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	64.3	3.4e-21
WP_170969073.1|4141190_4141397_+	hypothetical protein	NA	A5LH38	Enterobacteria_phage	78.9	2.0e-14
WP_170969074.1|4141865_4142192_+	hypothetical protein	NA	A5LH38	Enterobacteria_phage	58.2	1.7e-15
WP_170969075.1|4142163_4142382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170969076.1|4142938_4143055_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	90.3	6.0e-08
WP_170969077.1|4143871_4144057_+	hypothetical protein	NA	A5LH40	Enterobacteria_phage	70.2	1.2e-10
>prophage 10
NZ_CP053231	Escherichia coli strain SCU-306 chromosome, complete genome	5029448	4466468	4536379	5029448	transposase,holin,integrase	Enterobacteria_phage(28.57%)	59	4478123:4478159	4544652:4544688
WP_000006241.1|4466468_4466966_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_014639450.1|4467048_4467207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331867.1|4467285_4469025_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207544.1|4468969_4469755_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|4469825_4470881_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|4470932_4471226_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|4471228_4471627_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|4471636_4472089_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001331869.1|4472266_4473418_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
WP_000602123.1|4473414_4474029_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|4474085_4475543_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291988.1|4475803_4476262_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189577.1|4476353_4477598_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|4477655_4478057_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
4478123:4478159	attL	TCGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_000749902.1|4478166_4479222_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|4479510_4480614_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|4480625_4481879_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
WP_000772638.1|4482223_4482562_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	49.5	4.3e-22
WP_001298126.1|4482996_4483521_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001034008.1|4483646_4487777_-	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.6	3.3e-281
WP_000146243.1|4489486_4489672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019923.1|4489886_4490501_+	YagU family protein	NA	NA	NA	NA	NA
WP_001295797.1|4490749_4491079_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001295798.1|4491385_4492096_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001265640.1|4492064_4493708_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131109.1|4493697_4496223_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716404.1|4496248_4496917_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730982.1|4496973_4497561_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|4497634_4498177_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000866436.1|4499260_4499401_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|4499400_4499664_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000739809.1|4500028_4500130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170969078.1|4500603_4501746_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000860032.1|4501917_4502838_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_128542956.1|4502994_4503921_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000910711.1|4504120_4505014_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001172280.1|4505044_4506034_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001174452.1|4506060_4506912_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
WP_000092542.1|4507477_4511728_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000620995.1|4511852_4512710_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295799.1|4512957_4513827_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_001298546.1|4513986_4514580_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474088.1|4514591_4514828_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_128542957.1|4514936_4516262_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	5.0e-114
WP_170969079.1|4516488_4517343_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102123.1|4517869_4518589_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023913.1|4518599_4520027_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001298555.1|4520019_4520715_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001005272.1|4520957_4521626_-	membrane protein	NA	NA	NA	NA	NA
WP_136952279.1|4521943_4523157_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_170969089.1|4523182_4524082_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_136952279.1|4524139_4525353_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_001213047.1|4526774_4527536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304859.1|4527689_4528484_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001295805.1|4528813_4529377_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001159135.1|4530441_4532130_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
WP_001350625.1|4532143_4533616_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001314510.1|4533629_4534217_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131041.1|4534345_4536379_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
4544652:4544688	attR	TGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACGA	NA	NA	NA	NA
>prophage 1
NZ_CP053232	Escherichia coli strain SCU-306 plasmid pSCU-306-1, complete sequence	128584	7944	84477	128584	transposase,integrase	Escherichia_phage(26.32%)	54	76860:76919	92809:93628
WP_170969091.1|7944_8649_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.3	3.8e-137
WP_071602693.1|9866_10487_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	41.7	1.0e-40
WP_000544830.1|13997_14795_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
WP_000493532.1|15079_15304_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	43.2	1.1e-05
WP_000673985.1|15300_15687_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	50.4	2.5e-26
WP_170969095.1|16464_18171_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.6	1.6e-19
WP_001554926.1|21224_21572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021573051.1|21682_22030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001554928.1|22047_22644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001554929.1|22631_22901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813630.1|23495_23714_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|23715_24021_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016968.1|24021_24828_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.4	3.7e-56
WP_016238649.1|25507_26209_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	32.2	1.7e-25
WP_001442122.1|26859_28065_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.2	9.5e-205
WP_001233385.1|28061_29033_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.9	1.5e-112
WP_000549075.1|30377_31376_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001442123.1|31372_32284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696651.1|32360_33584_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000361610.1|36386_37364_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_170969092.1|39819_40008_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_001072359.1|40369_41539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106378881.1|42419_43648_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.9e-168
WP_001298664.1|43929_45900_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|45906_46698_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_024192676.1|51177_51387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023144239.1|51930_52278_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001529697.1|52438_54097_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001224623.1|56355_57231_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_000981091.1|57238_58015_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_001100763.1|58183_60445_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001020413.1|60513_61689_+	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001336919.1|63754_64324_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.2	6.4e-26
WP_000874189.1|66307_66793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001554949.1|66817_67303_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|67289_67985_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001554947.1|67989_69120_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|69109_70393_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|70395_71775_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|71878_72406_-	iron transporter	NA	NA	NA	NA	NA
WP_001332815.1|72446_74333_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|74679_75495_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949451.1|75677_76184_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|76173_76332_-	DsbA family protein	NA	NA	NA	NA	NA
76860:76919	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|76911_77616_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|77824_79030_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|79185_79389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|79516_80356_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|80349_80697_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|80860_81652_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|81657_81948_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|82059_82557_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|82701_83715_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_170969093.1|83781_84477_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.8e-131
92809:93628	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGACCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAAGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 1
NZ_CP053233	Escherichia coli strain SCU-306 plasmid pSCU-306-2, complete sequence	112229	0	108097	112229	integrase,portal,terminase,tail,transposase,tRNA	Salmonella_phage(86.14%)	115	14678:14697	24547:24566
WP_001293471.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	91.0	5.4e-172
WP_001229345.1|1545_1758_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_000644408.1|1757_2093_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_001755515.1|2308_2584_-	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	2.0e-33
WP_023145172.1|2639_3065_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	75.4	5.0e-60
WP_000715581.1|3156_3987_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_021533191.1|3990_4191_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_170969101.1|4283_6623_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_000920224.1|6625_6892_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_001755518.1|6891_7836_-	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
WP_000047684.1|7896_8925_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_001351984.1|9042_9447_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	85.1	4.8e-60
WP_001240351.1|10012_10576_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	67.7	1.3e-66
WP_024175973.1|10905_11121_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	75.7	3.8e-24
WP_023145129.1|11424_14943_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.0	0.0e+00
14678:14697	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
WP_021520134.1|15123_16359_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	81.0	6.7e-198
WP_023145131.1|16454_18563_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	67.0	2.5e-229
WP_001098353.1|18661_18874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282576.1|19125_19512_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000797845.1|19506_20610_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_000156433.1|20821_21067_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
WP_000067985.1|24125_24416_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
WP_000636536.1|24561_24777_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
24547:24566	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
WP_170969096.1|24773_26096_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	6.9e-241
WP_001718054.1|26092_26350_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	60.2	3.9e-15
WP_023145136.1|26630_27407_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	1.4e-52
WP_024175975.1|27485_28598_-	hypothetical protein	NA	J9Q720	Salmonella_phage	93.8	2.6e-209
WP_000137333.1|28745_30086_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	3.4e-235
WP_001755535.1|30129_30870_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	3.7e-127
WP_160378290.1|32795_33149_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_001755537.1|33154_33823_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	3.7e-110
WP_001755538.1|33999_34752_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.1	7.9e-16
WP_000931257.1|34736_35120_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.3e-11
WP_001717322.1|35492_35744_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.9e-27
WP_000856758.1|35745_36438_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
WP_000064175.1|36451_36775_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
WP_170969097.1|36977_39644_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	49.0	7.8e-66
WP_123002991.1|40002_40464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170969102.1|41099_44204_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	66.3	5.8e-222
WP_001293195.1|47154_47748_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
WP_001405045.1|47735_48533_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	94.0	1.3e-154
WP_000511446.1|48525_49224_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	97.0	5.1e-134
WP_000442112.1|49306_49642_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	87.3	8.0e-53
WP_024175976.1|49684_54262_-	tape measure protein	NA	J9Q712	Salmonella_phage	80.8	0.0e+00
WP_136952279.1|54397_55611_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_170969098.1|55616_55808_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.9	4.0e-17
WP_000163861.1|55933_56251_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_000072377.1|56306_57053_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	93.5	2.8e-122
WP_000469440.1|57127_57511_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_000523628.1|57512_57986_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001027663.1|57976_58321_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000057118.1|58400_59234_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
WP_000801187.1|59233_59668_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
WP_001755483.1|59712_60633_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	80.2	2.4e-123
WP_001130339.1|60706_61582_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	4.2e-154
WP_001055285.1|61607_62495_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	89.3	7.1e-133
WP_001717193.1|62516_64091_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	2.2e-286
WP_001007299.1|64117_65374_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_000215413.1|65373_66006_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_000176292.1|66201_66468_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000129633.1|66477_67368_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_023145142.1|67364_68030_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	8.3e-110
WP_000161986.1|68026_68695_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_000382660.1|68694_69375_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_023145144.1|69457_71017_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.3	4.9e-278
WP_001291061.1|71019_71298_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_023145145.1|71330_71930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170969099.1|72315_72645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170969100.1|72653_73079_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	32.1	4.2e-06
WP_023145147.1|73215_73737_+	repressor of phase-1 flagellin	NA	J9Q6L0	Salmonella_phage	79.7	1.2e-66
WP_023145149.1|74727_74958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063502071.1|75574_76057_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.2	3.6e-62
WP_000129290.1|76261_76543_-	hypothetical protein	NA	J9Q753	Salmonella_phage	79.6	1.6e-38
WP_024175979.1|76878_77253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216800.1|77370_77766_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	3.1e-32
WP_000749407.1|77892_78204_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_063502073.1|78358_78688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160384357.1|78826_79042_-	hypothetical protein	NA	J9Q804	Salmonella_phage	90.1	1.4e-31
WP_000449893.1|80630_81191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000910476.1|81352_81538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021520099.1|81574_81874_-	hypothetical protein	NA	J9Q750	Salmonella_phage	46.7	1.0e-22
WP_001755492.1|82035_84069_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_000004356.1|84226_85327_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_063502070.1|85364_85754_-	hypothetical protein	NA	A0A077SK24	Escherichia_phage	91.5	7.3e-66
WP_063502072.1|85853_86204_-	hypothetical protein	NA	J9Q6E9	Salmonella_phage	63.6	4.3e-33
WP_053272003.1|86229_86481_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	95.2	3.0e-36
WP_032145427.1|86483_86684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053272002.1|86795_87554_-	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	63.0	2.9e-58
WP_053272001.1|87553_87739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053272000.1|87713_88280_-	ead/Ea22-like family protein	NA	A0A222YWM9	Escherichia_phage	59.5	1.7e-42
WP_053271999.1|88276_88732_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	60.2	1.2e-19
WP_053271998.1|88870_89251_-	hypothetical protein	NA	J9Q801	Salmonella_phage	69.8	5.9e-28
WP_063502069.1|89250_89955_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	77.4	1.9e-88
WP_001090447.1|90015_91701_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.3	0.0e+00
WP_063502068.1|91804_92419_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.4	2.7e-99
WP_063502067.1|92758_93328_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	60.3	6.7e-52
WP_014962273.1|93467_93626_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_021533179.1|93625_94051_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.0	2.8e-58
WP_021533180.1|94144_94342_-	hypothetical protein	NA	J9Q800	Salmonella_phage	56.9	2.6e-11
WP_021533181.1|94351_94846_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	55.4	8.8e-24
WP_053271996.1|94991_95585_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	1.7e-93
WP_032203380.1|96173_96404_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	2.0e-31
WP_000559568.1|96589_97183_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
WP_053902537.1|97366_98176_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	1.3e-64
WP_063502066.1|98334_98892_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	82.5	4.8e-87
WP_001718079.1|98901_99321_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_000386469.1|99382_100027_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
WP_160378288.1|100026_100497_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.4	2.8e-80
WP_000289389.1|100499_100901_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	87.2	5.1e-62
WP_024175984.1|100914_102018_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.5	8.4e-192
WP_001011861.1|102189_103059_-	hypothetical protein	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
WP_000122502.1|103136_104279_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_000623683.1|104385_106701_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.3	0.0e+00
WP_000037962.1|106774_107344_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_000008655.1|107353_108097_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	2.0e-51
