The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053102	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4316079	700244	708610	4316079		Synechococcus_phage(50.0%)	8	NA	NA
WP_003233955.1|700244_701540_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
WP_003242871.1|701613_702339_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	7.0e-46
WP_003219409.1|702331_702586_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003243954.1|702582_703266_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003244429.1|703249_705478_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-159
WP_003233947.1|705453_706884_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_003242485.1|706985_708026_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.7	1.1e-63
WP_003244322.1|708022_708610_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.4	7.0e-28
>prophage 2
NZ_CP053102	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4316079	1207842	1251615	4316079	tRNA,coat	Planktothrix_phage(25.0%)	48	NA	NA
WP_003232972.1|1207842_1208082_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|1208246_1209185_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|1209207_1210449_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003232967.1|1210524_1211310_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|1211501_1212488_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_003232964.1|1212484_1213474_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_003245828.1|1215267_1216218_+	oligopeptide ABC transporter permease AppB	NA	NA	NA	NA	NA
WP_003232961.1|1216234_1217146_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_003239298.1|1217350_1218103_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_003245134.1|1218137_1219130_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003232957.1|1219873_1221511_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_003245554.1|1221618_1222554_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|1222557_1223475_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_010886477.1|1223479_1224556_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|1224557_1225475_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_010886478.1|1225581_1226799_+	MFS transporter	NA	NA	NA	NA	NA
WP_003244921.1|1226962_1227541_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003245483.1|1227721_1228117_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003232944.1|1228159_1228816_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_119122854.1|1228985_1229126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245194.1|1229092_1229749_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003245684.1|1229743_1229866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245839.1|1229909_1231061_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_003245178.1|1231290_1233120_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|1233157_1233325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|1233638_1234538_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|1234534_1234933_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_010886480.1|1235187_1235733_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	60.4	4.8e-39
WP_003232924.1|1235936_1236509_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003232922.1|1236633_1237002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|1237030_1237666_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|1237684_1238485_+	NAD kinase	NA	NA	NA	NA	NA
WP_003244860.1|1238499_1239399_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003244765.1|1239411_1240146_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	25.0	3.2e-06
WP_003232910.1|1240380_1242225_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003232909.1|1242473_1243184_+	thiaminase II	NA	NA	NA	NA	NA
WP_003232908.1|1243158_1243776_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_003245044.1|1243759_1244869_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_010886482.1|1244868_1245069_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_010886483.1|1245065_1245836_+	thiazole synthase	NA	NA	NA	NA	NA
WP_003245868.1|1245832_1246843_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_003245050.1|1246861_1247677_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|1247812_1248589_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010886484.1|1248689_1249373_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_003244982.1|1249466_1249913_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_003239243.1|1250040_1250529_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_003244668.1|1250680_1251199_-|coat	spore coat protein CotX	coat	NA	NA	NA	NA
WP_003245818.1|1251297_1251615_-|coat	spore coat protein CotW	coat	NA	NA	NA	NA
>prophage 3
NZ_CP053102	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4316079	1314477	1348210	4316079	terminase,plate,holin,tail,portal	uncultured_Caudovirales_phage(29.41%)	46	NA	NA
WP_003245490.1|1314477_1315749_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_010886491.1|1315893_1317030_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	8.3e-94
WP_003245487.1|1317019_1317154_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_003232731.1|1317184_1317442_-	YciI family protein	NA	NA	NA	NA	NA
WP_003244876.1|1317562_1318516_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	74.1	7.3e-67
WP_003245254.1|1318555_1318933_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	6.1e-17
WP_003244789.1|1319038_1319641_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_003245071.1|1319717_1320554_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_003232721.1|1320597_1321194_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|1321356_1321698_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|1321875_1322055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245799.1|1322041_1322878_+	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
WP_010886492.1|1322777_1323578_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_003245588.1|1323577_1323745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245290.1|1323829_1324180_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_003244900.1|1324176_1324383_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.6e-11
WP_003245797.1|1324498_1325008_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.9e-21
WP_003244697.1|1325123_1325921_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_003245584.1|1325917_1327219_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.2	2.4e-153
WP_003245427.1|1327222_1328710_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003245836.1|1328729_1329557_+	phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
WP_003232690.1|1329582_1330518_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_003245011.1|1330539_1330923_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.2	1.9e-13
WP_009967053.1|1330919_1331276_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003245226.1|1331272_1331758_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_003232680.1|1331770_1332211_+	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_003232679.1|1332214_1332433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245369.1|1332429_1333830_+	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232677.1|1333831_1334275_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003232676.1|1334366_1334813_+	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
WP_003239113.1|1334842_1334992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010886493.1|1334993_1338992_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	44.9	2.1e-43
WP_003232674.1|1338984_1339644_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	3.7e-25
WP_003245730.1|1339659_1340637_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_003244812.1|1340636_1340903_+	DUF2577 family protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_003232671.1|1340959_1341385_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	7.8e-13
WP_009967060.1|1341377_1342424_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	4.4e-73
WP_003244743.1|1342407_1342986_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.0e-15
WP_003232665.1|1342982_1343255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003244681.1|1343257_1345321_+	phage-like element PBSX protein XkdV	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	37.4	4.8e-31
WP_003232660.1|1345332_1345662_+	phage-like element PBSX protein XkdW	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	41.3	1.7e-15
WP_003232658.1|1345658_1345823_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	66.0	3.2e-15
WP_003245597.1|1345866_1346706_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_003232655.1|1346758_1347028_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	6.2e-24
WP_003232653.1|1347040_1347304_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
WP_003245230.1|1347316_1348210_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
>prophage 4
NZ_CP053102	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4316079	1868649	1875204	4316079		Bacillus_phage(50.0%)	6	NA	NA
WP_003231758.1|1868649_1869042_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_003245700.1|1869001_1871104_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	87.0	0.0e+00
WP_003231754.1|1871121_1872111_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|1872160_1872781_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_003244862.1|1872844_1873612_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	9.1e-52
WP_003231746.1|1874235_1875204_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
>prophage 5
NZ_CP053102	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4316079	2140182	2267640	4316079	integrase,tail,transposase,holin	Bacillus_phage(100.0%)	174	2158941:2158963	2280317:2280339
WP_169507098.1|2140182_2140935_+	hypothetical protein	NA	A0A1P8CX59	Bacillus_phage	100.0	1.3e-146
WP_169507097.1|2141169_2141757_-	Holliday junction resolvase RecU	NA	A0A1P8CX67	Bacillus_phage	100.0	3.3e-110
WP_041336530.1|2141831_2142074_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	100.0	1.5e-40
WP_169507103.1|2142075_2142261_-	hypothetical protein	NA	O64193	Bacillus_phage	88.5	2.1e-23
WP_169507096.1|2142313_2142643_-	hypothetical protein	NA	A0A1P8CX80	Bacillus_phage	100.0	1.4e-57
WP_169507095.1|2142725_2143175_-	hypothetical protein	NA	A0A1P8CX70	Bacillus_phage	100.0	1.0e-79
WP_004399562.1|2143242_2143605_-	hypothetical protein	NA	A0A1P8CX73	Bacillus_phage	100.0	1.1e-63
WP_010886534.1|2143601_2143775_-	hypothetical protein	NA	O64190	Bacillus_phage	100.0	3.4e-23
WP_010886535.1|2143790_2144108_-	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	100.0	2.1e-55
WP_010886536.1|2144120_2144198_-	hypothetical protein	NA	A0A1P8CX55	Bacillus_phage	100.0	7.4e-07
WP_009967447.1|2144229_2144376_-	hypothetical protein	NA	A0A1P8CX49	Bacillus_phage	100.0	1.0e-17
WP_009967449.1|2144411_2144543_-	rubrerythrin family protein	NA	A0A1P8CX61	Bacillus_phage	100.0	2.6e-20
WP_004399249.1|2144582_2144774_-	hypothetical protein	NA	A0A1P8CX54	Bacillus_phage	100.0	1.0e-33
WP_042976081.1|2145040_2145253_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	100.0	4.1e-31
WP_109962699.1|2145333_2145522_-	hypothetical protein	NA	A0A1P8CX75	Bacillus_phage	100.0	1.2e-26
WP_169507094.1|2146086_2146806_-	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	100.0	2.8e-135
WP_169507093.1|2146818_2147172_-	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	100.0	9.6e-57
WP_169507092.1|2147444_2148284_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	100.0	6.0e-166
WP_153912230.1|2148340_2148685_-	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	99.1	2.3e-55
WP_032721835.1|2148799_2149015_-	hypothetical protein	NA	A0A1P8CX47	Bacillus_phage	100.0	3.7e-35
WP_169507091.1|2148998_2149304_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	100.0	6.4e-49
WP_169507090.1|2149308_2149476_-	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	100.0	4.6e-25
WP_009967458.1|2149631_2149877_+	hypothetical protein	NA	A0A1P8CX50	Bacillus_phage	100.0	1.6e-31
WP_004399409.1|2149916_2150366_-	SPBc2 prophage-derived transcriptional regulator YosT	NA	A0A1P8CX48	Bacillus_phage	100.0	2.0e-83
WP_004399492.1|2150460_2150889_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	100.0	5.4e-78
WP_004399328.1|2150934_2151177_-	thioredoxin family protein	NA	A0A1P8CX24	Bacillus_phage	100.0	1.4e-38
WP_004399561.1|2151757_2152279_-	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	100.0	7.4e-98
WP_169507089.1|2153300_2156555_-	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	100.0	0.0e+00
WP_017697102.1|2156517_2156913_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	100.0	6.1e-68
WP_014471944.1|2156912_2157266_-	hypothetical protein	NA	A0A1P8CX44	Bacillus_phage	100.0	3.8e-61
WP_170272653.1|2157267_2157987_-	HNH endonuclease	NA	A0A1P8CX45	Bacillus_phage	100.0	3.0e-137
WP_169507087.1|2158012_2158279_-	hypothetical protein	NA	A0A1P8CX38	Bacillus_phage	100.0	4.3e-41
WP_169507086.1|2158295_2158508_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	100.0	7.3e-36
2158941:2158963	attL	TTAAAATAAAACTTTTATTTAGA	NA	NA	NA	NA
WP_169507085.1|2158966_2159389_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	100.0	1.0e-76
WP_041056324.1|2159401_2159722_-	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	100.0	8.7e-57
WP_170272654.1|2159881_2160058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697090.1|2160134_2160308_-	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	100.0	2.1e-25
WP_041056330.1|2160822_2161050_-	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	100.0	2.7e-36
WP_169507084.1|2161089_2161455_-	hypothetical protein	NA	A0A1P8CX18	Bacillus_phage	100.0	1.4e-63
WP_041352027.1|2161457_2161676_-	hypothetical protein	NA	A0A1P8CX26	Bacillus_phage	100.0	2.5e-31
WP_004399270.1|2161727_2163059_-	DNA (cytosine-5-)-methyltransferase	NA	Q77YW9	Bacillus_phage	100.0	1.5e-256
WP_169507083.1|2163141_2164122_-	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	100.0	5.0e-196
WP_169507082.1|2164182_2164701_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	97.1	3.8e-94
WP_169507081.1|2164709_2165207_-	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	95.8	4.0e-85
WP_041338484.1|2165206_2165362_-	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	94.1	5.7e-22
WP_064814903.1|2165354_2165570_-	YorP family protein	NA	O64150	Bacillus_phage	97.2	3.9e-37
WP_052471015.1|2165581_2166232_-	hypothetical protein	NA	A0A1P8CX16	Bacillus_phage	48.5	1.2e-20
WP_169507080.1|2166306_2170224_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	99.6	0.0e+00
WP_169507079.1|2170236_2171967_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	100.0	0.0e+00
WP_009967477.1|2171966_2173103_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	100.0	1.2e-225
WP_004399302.1|2173118_2174633_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	100.0	3.6e-286
WP_009967478.1|2174647_2175118_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	100.0	1.4e-87
WP_004399537.1|2175160_2176132_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
WP_169507078.1|2176214_2177129_-	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	100.0	1.0e-171
WP_041338755.1|2177147_2177516_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	99.2	5.5e-63
WP_041338506.1|2178571_2178952_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	100.0	2.9e-67
WP_157680842.1|2179014_2179164_-	hypothetical protein	NA	A0A1P8CX03	Bacillus_phage	100.0	3.9e-20
WP_014721243.1|2179169_2179316_-	hypothetical protein	NA	A0A1P8CWZ9	Bacillus_phage	100.0	1.7e-12
WP_169507077.1|2179318_2179591_-	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	100.0	2.2e-45
WP_169507076.1|2179580_2180468_-	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	100.0	2.3e-168
WP_032721740.1|2180516_2180738_-	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	100.0	2.9e-35
WP_169507075.1|2180970_2181192_-	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	100.0	3.1e-37
WP_169507074.1|2181781_2182594_+	ATP-dependent DNA ligase	NA	A0A1P8CWY5	Bacillus_phage	100.0	7.4e-153
WP_169507073.1|2182659_2183073_-	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	100.0	5.2e-78
WP_003231052.1|2183236_2184076_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	100.0	2.3e-157
WP_169507072.1|2184222_2184375_+	hypothetical protein	NA	A0A1P8CWZ1	Bacillus_phage	100.0	1.2e-21
WP_003231051.1|2184461_2184752_-	hypothetical protein	NA	A0A1P8CWY9	Bacillus_phage	100.0	4.2e-50
WP_009967489.1|2184865_2185240_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	100.0	3.4e-60
WP_169507071.1|2185256_2185478_-	hypothetical protein	NA	O64123	Bacillus_phage	98.6	7.9e-33
WP_169507102.1|2185622_2186315_-	HNH endonuclease	NA	A0A1P8CWZ4	Bacillus_phage	100.0	2.3e-131
WP_147797696.1|2186354_2186558_-	hypothetical protein	NA	O64120	Bacillus_phage	98.5	2.5e-33
WP_169507070.1|2186577_2187252_-	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	100.0	8.6e-131
WP_169507101.1|2187269_2187530_-	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	100.0	7.6e-43
WP_169507069.1|2187549_2187807_-	hypothetical protein	NA	A0A1P8CWY1	Bacillus_phage	100.0	2.3e-44
WP_169507056.1|2187834_2188149_-	hypothetical protein	NA	A0A1P8CWY4	Bacillus_phage	100.0	4.0e-54
WP_004399389.1|2188205_2188961_-	SPBc2 prophage-derived antirepressor protein YoqD	NA	A0A1P8CWY0	Bacillus_phage	100.0	1.1e-137
WP_004399569.1|2189001_2189409_-	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	100.0	2.6e-74
WP_004399388.1|2189415_2189754_-	hypothetical protein	NA	O64111	Bacillus_phage	100.0	8.9e-52
WP_014906374.1|2189750_2190101_-	hypothetical protein	NA	A0A1P8CWX8	Bacillus_phage	100.0	8.3e-61
WP_009967502.1|2190113_2190317_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	100.0	5.7e-30
WP_004399424.1|2190330_2190609_-	hypothetical protein	NA	A0A1P8CWX5	Bacillus_phage	100.0	9.2e-47
WP_004399266.1|2190605_2191010_-	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	100.0	2.9e-73
WP_004399316.1|2191006_2191342_-	hypothetical protein	NA	A0A1P8CWX6	Bacillus_phage	100.0	3.2e-46
WP_169507068.1|2191377_2191617_-	hypothetical protein	NA	A0A1P8CWW8	Bacillus_phage	100.0	7.4e-37
WP_099043105.1|2191735_2191975_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	100.0	3.3e-37
WP_086352552.1|2192047_2192347_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	100.0	1.5e-47
WP_041338568.1|2192514_2192736_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	100.0	1.1e-34
WP_041338571.1|2192966_2193938_-|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	100.0	2.2e-180
WP_041338574.1|2193956_2195303_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	100.0	2.6e-251
WP_061187763.1|2195387_2196449_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	99.7	1.9e-201
WP_061187761.1|2196653_2196899_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	100.0	3.9e-41
WP_041338583.1|2196915_2197122_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	100.0	1.4e-31
WP_169507067.1|2197272_2197428_-	hypothetical protein	NA	A0A1P8CWW2	Bacillus_phage	100.0	9.1e-20
WP_134982144.1|2197560_2197692_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_086352547.1|2197722_2198874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059293806.1|2199018_2199357_-	hypothetical protein	NA	A0A1P8CWV8	Bacillus_phage	100.0	7.0e-57
WP_121572587.1|2199405_2200101_-	hypothetical protein	NA	A0A1P8CWW4	Bacillus_phage	100.0	1.5e-125
WP_121572586.1|2200090_2200804_-	hypothetical protein	NA	A0A1P8CWW3	Bacillus_phage	100.0	4.0e-134
WP_116315613.1|2200862_2200994_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	100.0	2.9e-19
WP_134982148.1|2201004_2201220_-	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	100.0	2.9e-32
WP_004399430.1|2201223_2201475_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	100.0	1.6e-37
WP_019712287.1|2201545_2201725_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	98.3	1.2e-28
WP_041338596.1|2201762_2202398_-	hypothetical protein	NA	A0A1P8CWV5	Bacillus_phage	100.0	4.8e-115
WP_019712282.1|2202495_2202729_-	hypothetical protein	NA	A0A1P8CWU8	Bacillus_phage	100.0	6.6e-38
WP_032721663.1|2202801_2203023_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	98.6	1.9e-34
WP_041352094.1|2203305_2204226_-	restriction endonuclease	NA	A0A1P8CWV0	Bacillus_phage	100.0	2.3e-171
WP_169507066.1|2204344_2204548_-	hypothetical protein	NA	A0A1P8CWV3	Bacillus_phage	100.0	2.3e-31
WP_124048603.1|2204566_2204746_-	hypothetical protein	NA	A0A1P8CWU9	Bacillus_phage	100.0	8.9e-27
WP_059293796.1|2204773_2205049_-	hypothetical protein	NA	A0A1P8CWV2	Bacillus_phage	100.0	1.7e-45
WP_169507065.1|2205080_2205284_-	hypothetical protein	NA	A0A1P8CWV4	Bacillus_phage	100.0	3.0e-31
WP_169507064.1|2205328_2207125_-	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	100.0	0.0e+00
WP_014472015.1|2207126_2207729_-	hypothetical protein	NA	A0A1P8CWV1	Bacillus_phage	100.0	3.9e-106
WP_169507063.1|2207730_2208651_-	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	100.0	5.2e-163
WP_169507062.1|2208656_2209511_-	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	100.0	7.3e-151
WP_121572580.1|2209870_2211088_-	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	100.0	2.9e-233
WP_169507061.1|2211175_2211334_-	hypothetical protein	NA	A0A1P8CWU3	Bacillus_phage	100.0	9.3e-20
WP_120028257.1|2211378_2211594_-	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	100.0	2.5e-31
WP_121591845.1|2212833_2213154_-	hypothetical protein	NA	A0A1P8CWU7	Bacillus_phage	100.0	1.3e-57
WP_162985140.1|2213337_2213505_-	hypothetical protein	NA	A0A1P8CWU0	Bacillus_phage	100.0	5.0e-24
WP_064814709.1|2213707_2213887_+	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	100.0	3.1e-27
WP_041352104.1|2213931_2215809_+	hypothetical protein	NA	A0A1P8CWS8	Bacillus_phage	100.0	0.0e+00
WP_169507060.1|2216224_2216839_+	hypothetical protein	NA	A0A1P8CWS4	Bacillus_phage	100.0	2.5e-113
WP_169507059.1|2217101_2217377_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	100.0	1.5e-41
WP_010328101.1|2219100_2219292_+	YonK family protein	NA	A0A1P8CWT3	Bacillus_phage	100.0	1.9e-27
WP_169507058.1|2219308_2220526_+	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	100.0	3.0e-230
WP_004399334.1|2220559_2220970_-	hypothetical protein	NA	A0A1P8CWT0	Bacillus_phage	100.0	8.8e-70
WP_004399264.1|2221188_2221689_+	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	100.0	3.6e-89
WP_004399257.1|2221791_2222712_+	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	100.0	5.4e-176
WP_004399591.1|2222698_2224468_+	hypothetical protein	NA	O64069	Bacillus_phage	100.0	0.0e+00
WP_004399314.1|2224485_2226006_+	hypothetical protein	NA	O64068	Bacillus_phage	100.0	1.4e-282
WP_004399245.1|2226036_2227473_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	100.0	2.7e-267
WP_004399581.1|2227497_2228034_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	100.0	3.6e-95
WP_004399434.1|2228072_2229089_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	100.0	1.3e-186
WP_004399413.1|2229124_2229595_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	100.0	6.7e-82
WP_004399452.1|2229609_2230005_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	100.0	2.5e-69
WP_009967519.1|2230001_2230256_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	100.0	2.2e-39
WP_003230958.1|2230239_2230890_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	100.0	3.2e-122
WP_004399477.1|2230886_2231393_+	hypothetical protein	NA	O64060	Bacillus_phage	100.0	5.9e-92
WP_003230954.1|2231389_2232100_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	100.0	1.8e-131
WP_004399252.1|2232142_2232940_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	100.0	2.1e-91
WP_010886547.1|2232957_2233569_+	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	100.0	3.3e-65
WP_009967521.1|2233568_2233796_+	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
WP_009967523.1|2233859_2234216_+	hypothetical protein	NA	O64055	Bacillus_phage	100.0	1.4e-58
WP_004399226.1|2234217_2235435_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	100.0	2.5e-173
WP_004399254.1|2235445_2235796_+	hypothetical protein	NA	O64053	Bacillus_phage	100.0	5.4e-60
WP_004399574.1|2235792_2235984_+	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	100.0	3.5e-29
WP_004399471.1|2236033_2236534_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	100.0	5.7e-87
WP_004399281.1|2236517_2236937_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	100.0	4.8e-71
WP_009969431.1|2236950_2237952_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	100.0	4.8e-194
WP_004399258.1|2237954_2238284_-	hypothetical protein	NA	A0A1P8CWQ2	Bacillus_phage	99.1	1.2e-61
WP_095045976.1|2238579_2239729_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	99.6	8.9e-152
WP_170272655.1|2240160_2247045_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	100.0	0.0e+00
WP_019712885.1|2247085_2247847_+|tail	phage tail family protein	tail	A0A1P8CWP8	Bacillus_phage	99.6	1.8e-132
WP_019712884.1|2247859_2250502_+	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	100.0	0.0e+00
WP_026009860.1|2250517_2251339_+	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	99.3	3.5e-134
WP_019712883.1|2251375_2253310_+	phosphodiester glycosidase family protein	NA	A0A1P8CWN9	Bacillus_phage	100.0	0.0e+00
WP_004398829.1|2253479_2254304_+	hypothetical protein	NA	A0A1P8CWP0	Bacillus_phage	100.0	1.5e-164
WP_004399160.1|2254293_2254512_+	hypothetical protein	NA	A0A1P8CWN7	Bacillus_phage	100.0	1.7e-35
WP_170272656.1|2254531_2255635_+	N-acetylmuramoyl-L-alanine amidase BlyA	NA	A0A1P8CWN6	Bacillus_phage	100.0	2.4e-186
WP_017696898.1|2255750_2256143_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	100.0	2.2e-62
WP_061891069.1|2256164_2256416_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	100.0	1.4e-38
WP_017696900.1|2256543_2257680_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	99.7	1.9e-215
WP_017696901.1|2257669_2257846_+	hypothetical protein	NA	A0A1P8CWP3	Bacillus_phage	100.0	1.8e-24
WP_170272657.1|2257887_2259138_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	97.1	9.1e-235
WP_109962767.1|2259130_2259463_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	100.0	1.3e-55
WP_041054825.1|2259636_2259972_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	100.0	4.2e-54
WP_041338710.1|2260015_2260375_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	100.0	3.5e-62
WP_009967548.1|2260635_2260752_+	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_086352808.1|2260978_2261437_-	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	100.0	1.0e-82
WP_086352807.1|2261541_2262105_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	100.0	1.2e-104
WP_170272658.1|2262106_2263861_-	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	100.0	0.0e+00
WP_170272659.1|2264275_2265160_+	endonuclease YokF	NA	A0A1P8CWK6	Bacillus_phage	99.7	2.9e-118
WP_170272660.1|2265283_2265817_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	100.0	1.0e-94
WP_087961589.1|2266065_2267640_-	recombinase family protein	NA	A0A1P8CWN4	Bacillus_phage	100.0	4.9e-286
2280317:2280339	attR	TTAAAATAAAACTTTTATTTAGA	NA	NA	NA	NA
>prophage 6
NZ_CP053102	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4316079	2277253	2399412	4316079	holin,tail,bacteriocin,transposase,integrase	Bacillus_phage(98.01%)	167	2370299:2370314	2403687:2403702
WP_170272663.1|2277253_2277925_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	87.1	5.8e-103
WP_004399275.1|2278327_2278681_-	hypothetical protein	NA	O64171	Bacillus_phage	100.0	1.1e-60
WP_009967463.1|2278768_2278969_-	hypothetical protein	NA	O64170	Bacillus_phage	100.0	2.1e-32
WP_004399476.1|2279228_2279363_-	hypothetical protein	NA	O64168	Bacillus_phage	100.0	2.5e-18
WP_004399307.1|2280330_2280456_-	hypothetical protein	NA	O64165	Bacillus_phage	100.0	3.5e-14
WP_009967464.1|2280832_2281228_-	hypothetical protein	NA	O64163	Bacillus_phage	100.0	4.1e-72
WP_009967465.1|2281266_2281809_-	hypothetical protein	NA	O64162	Bacillus_phage	100.0	1.4e-99
WP_004399458.1|2281853_2282033_-	hypothetical protein	NA	O64161	Bacillus_phage	100.0	6.8e-27
WP_004399362.1|2282164_2282284_+	YhzE/YjcZ family sporulation protein YosA	NA	NA	NA	NA	NA
WP_009969822.1|2282387_2282600_-	hypothetical protein	NA	O64159	Bacillus_phage	100.0	1.2e-35
WP_010886541.1|2282666_2282849_-	hypothetical protein	NA	O64158	Bacillus_phage	100.0	1.5e-26
WP_004399541.1|2282861_2283089_-	hypothetical protein	NA	O64157	Bacillus_phage	100.0	9.2e-37
WP_004399530.1|2283128_2283494_-	hypothetical protein	NA	O64156	Bacillus_phage	100.0	4.9e-64
WP_004399346.1|2283496_2283715_-	hypothetical protein	NA	O64155	Bacillus_phage	100.0	4.3e-31
WP_004399507.1|2285139_2285259_-	hypothetical protein	NA	O64154	Bacillus_phage	100.0	1.7e-13
WP_004399368.1|2285290_2285809_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	100.0	2.2e-97
WP_004399428.1|2285817_2286315_-	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	100.0	1.0e-88
WP_004399305.1|2286314_2286470_-	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	100.0	2.0e-22
WP_009967472.1|2286462_2286678_-	YorP family protein	NA	O64150	Bacillus_phage	100.0	7.9e-38
WP_009967473.1|2286710_2286908_-	hypothetical protein	NA	O64149	Bacillus_phage	100.0	1.9e-30
WP_004399415.1|2286943_2287093_-	hypothetical protein	NA	O64148	Bacillus_phage	100.0	7.9e-21
WP_010886542.1|2287210_2287927_-	3D domain-containing protein	NA	O64147	Bacillus_phage	100.0	2.1e-127
WP_009967475.1|2287954_2291872_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	96.9	0.0e+00
WP_004399433.1|2291884_2293615_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	98.3	0.0e+00
WP_009967477.1|2293614_2294751_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	100.0	1.2e-225
WP_004399302.1|2294766_2296281_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	100.0	3.6e-286
WP_009967478.1|2296295_2296766_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	100.0	1.4e-87
WP_004399537.1|2296808_2297780_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
WP_004399276.1|2297862_2298777_-	hypothetical protein	NA	O64140	Bacillus_phage	100.0	3.0e-171
WP_004399457.1|2298798_2299170_-	hypothetical protein	NA	O64139	Bacillus_phage	100.0	2.6e-65
WP_004399509.1|2299343_2299658_-	SPBc2 prophage-derived stress response protein SCP1	NA	NA	NA	NA	NA
WP_004399313.1|2299734_2300115_-	hypothetical protein	NA	O64137	Bacillus_phage	100.0	3.8e-67
WP_004399516.1|2300177_2300474_-	hypothetical protein	NA	O64136	Bacillus_phage	100.0	8.1e-49
WP_009967482.1|2300562_2302323_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	100.0	0.0e+00
WP_004399555.1|2302319_2303144_-	gamma-polyglutamate hydrolase PghZ	NA	O64134	Bacillus_phage	100.0	7.8e-150
WP_004399280.1|2303242_2303638_-	hypothetical protein	NA	O64133	Bacillus_phage	100.0	7.7e-71
WP_004399584.1|2303692_2303914_-	hypothetical protein	NA	O64132	Bacillus_phage	100.0	5.8e-36
WP_004399300.1|2303984_2304659_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	98.6	5.9e-79
WP_004399261.1|2304728_2305541_+	SPBc2 prophage-derived DNA ligase-like protein LigB	NA	O64130	Bacillus_phage	100.0	2.5e-156
WP_004399463.1|2305606_2306020_-	hypothetical protein	NA	O64129	Bacillus_phage	100.0	1.8e-78
WP_004399538.1|2306185_2306335_+	hypothetical protein	NA	O64128	Bacillus_phage	100.0	2.7e-21
WP_004399296.1|2306411_2306759_-	hypothetical protein	NA	O64127	Bacillus_phage	100.0	1.1e-60
WP_009967487.1|2306760_2307117_-	hypothetical protein	NA	O64126	Bacillus_phage	100.0	1.6e-51
WP_004399557.1|2307076_2307418_-	hypothetical protein	NA	O64125	Bacillus_phage	100.0	8.1e-61
WP_009967489.1|2307531_2307906_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	100.0	3.4e-60
WP_004399461.1|2307922_2308141_-	hypothetical protein	NA	O64123	Bacillus_phage	100.0	2.7e-33
WP_009967493.1|2308344_2308623_+	hypothetical protein	NA	O64122	Bacillus_phage	100.0	2.3e-45
WP_010886543.1|2308747_2309440_-	HNH endonuclease	NA	O64121	Bacillus_phage	100.0	7.2e-133
WP_010886544.1|2309479_2309683_-	hypothetical protein	NA	O64120	Bacillus_phage	100.0	8.5e-34
WP_009967495.1|2309702_2310329_-	DUF1273 domain-containing protein	NA	A0A1P8CWY2	Bacillus_phage	89.8	5.6e-108
WP_004399432.1|2310428_2310623_-	hypothetical protein	NA	O64118	Bacillus_phage	100.0	3.2e-30
WP_009967496.1|2310671_2311124_-	hypothetical protein	NA	O64117	Bacillus_phage	100.0	6.7e-79
WP_004399295.1|2311206_2311464_-	hypothetical protein	NA	O64116	Bacillus_phage	100.0	3.0e-44
WP_009967498.1|2311508_2311712_-	hypothetical protein	NA	O64115	Bacillus_phage	100.0	1.3e-34
WP_004399423.1|2311720_2311885_-	hypothetical protein	NA	O64114	Bacillus_phage	100.0	1.7e-24
WP_004399389.1|2311938_2312694_-	SPBc2 prophage-derived antirepressor protein YoqD	NA	A0A1P8CWY0	Bacillus_phage	100.0	1.1e-137
WP_004399569.1|2312734_2313142_-	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	100.0	2.6e-74
WP_004399388.1|2313148_2313487_-	hypothetical protein	NA	O64111	Bacillus_phage	100.0	8.9e-52
WP_010886545.1|2313483_2313834_-	hypothetical protein	NA	O64110	Bacillus_phage	100.0	3.7e-61
WP_009967502.1|2313846_2314050_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	100.0	5.7e-30
WP_004399424.1|2314063_2314342_-	hypothetical protein	NA	A0A1P8CWX5	Bacillus_phage	100.0	9.2e-47
WP_004399266.1|2314338_2314743_-	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	100.0	2.9e-73
WP_004399316.1|2314739_2315075_-	hypothetical protein	NA	A0A1P8CWX6	Bacillus_phage	100.0	3.2e-46
WP_003231036.1|2315163_2315358_-	hypothetical protein	NA	O64105	Bacillus_phage	100.0	1.9e-27
WP_009967504.1|2315469_2315667_-	hypothetical protein	NA	O64104	Bacillus_phage	100.0	3.6e-29
WP_003231034.1|2315736_2315955_-	YopT family protein	NA	O64103	Bacillus_phage	100.0	6.6e-32
WP_004399410.1|2316137_2316362_+	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
WP_003231032.1|2316550_2317528_-	hypothetical protein	NA	O64101	Bacillus_phage	99.7	4.0e-177
WP_004399247.1|2317551_2318934_-	hypothetical protein	NA	O64100	Bacillus_phage	100.0	1.3e-263
WP_004399272.1|2319040_2320117_-|integrase	site-specific integrase	integrase	O64099	Bacillus_phage	100.0	1.5e-198
WP_004399407.1|2320106_2320319_-	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	100.0	8.6e-29
WP_009967507.1|2320366_2320684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399418.1|2320686_2320887_-	hypothetical protein	NA	O64096	Bacillus_phage	100.0	9.0e-28
WP_009967508.1|2321213_2321339_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_009968986.1|2321352_2322513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399583.1|2322689_2323106_-	hypothetical protein	NA	O64093	Bacillus_phage	100.0	1.2e-71
WP_009967509.1|2323107_2323641_-	hypothetical protein	NA	O64092	Bacillus_phage	100.0	9.3e-88
WP_004399323.1|2323667_2324204_-	super-infection exclusion protein B	NA	O64091	Bacillus_phage	100.0	2.2e-97
WP_004399255.1|2324242_2324374_-	hypothetical protein	NA	O64090	Bacillus_phage	100.0	1.7e-19
WP_004399349.1|2324384_2324600_-	hypothetical protein	NA	O64089	Bacillus_phage	100.0	5.0e-32
WP_004399430.1|2324603_2324855_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	100.0	1.6e-37
WP_003231000.1|2324925_2325105_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	96.6	3.6e-28
WP_009967511.1|2325206_2325437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967512.1|2325441_2325837_-	UPF0715 family protein	NA	O64087	Bacillus_phage	100.0	1.0e-62
WP_004399370.1|2325894_2327223_-	RES domain-containing protein	NA	O64086	Bacillus_phage	100.0	8.7e-260
WP_004399298.1|2327330_2327558_-	helix-turn-helix transcriptional regulator	NA	O64085	Bacillus_phage	100.0	1.0e-35
WP_004399369.1|2327818_2329135_-	hypothetical protein	NA	O64084	Bacillus_phage	100.0	1.1e-257
WP_004399486.1|2329491_2329998_-	hypothetical protein	NA	O64083	Bacillus_phage	100.0	4.9e-70
WP_004399445.1|2330325_2331558_-	hypothetical protein	NA	O64082	Bacillus_phage	100.0	1.7e-238
WP_004399547.1|2331639_2331828_-	hypothetical protein	NA	O64081	Bacillus_phage	100.0	1.5e-24
WP_010886546.1|2331872_2332124_-	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	94.4	1.6e-29
WP_009967515.1|2332142_2332319_-	hypothetical protein	NA	O64080	Bacillus_phage	100.0	6.7e-11
WP_009967516.1|2332693_2333305_-	lipoprotein	NA	O64079	Bacillus_phage	100.0	5.0e-85
WP_009967517.1|2333419_2333746_-	helix-turn-helix transcriptional regulator	NA	O64078	Bacillus_phage	100.0	9.8e-56
WP_004399291.1|2334698_2334893_+	hypothetical protein	NA	O64077	Bacillus_phage	100.0	2.7e-29
WP_004399271.1|2334932_2337452_+	hypothetical protein	NA	O64076	Bacillus_phage	100.0	0.0e+00
WP_004399274.1|2337695_2337974_+	HU-related DNA-binding protein HupN	NA	A0A1P8CWT5	Bacillus_phage	76.9	1.2e-30
WP_119123066.1|2338534_2338705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004399317.1|2339655_2339847_+	YonK family protein	NA	O64074	Bacillus_phage	100.0	1.5e-27
WP_004399278.1|2339863_2341081_+	hypothetical protein	NA	O64073	Bacillus_phage	99.8	1.3e-230
WP_004399334.1|2341114_2341525_-	hypothetical protein	NA	A0A1P8CWT0	Bacillus_phage	100.0	8.8e-70
WP_004399264.1|2341743_2342244_+	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	100.0	3.6e-89
WP_004399257.1|2342346_2343267_+	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	100.0	5.4e-176
WP_004399591.1|2343253_2345023_+	hypothetical protein	NA	O64069	Bacillus_phage	100.0	0.0e+00
WP_004399314.1|2345040_2346561_+	hypothetical protein	NA	O64068	Bacillus_phage	100.0	1.4e-282
WP_004399245.1|2346591_2348028_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	100.0	2.7e-267
WP_004399581.1|2348052_2348589_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	100.0	3.6e-95
WP_004399434.1|2348627_2349644_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	100.0	1.3e-186
WP_004399413.1|2349679_2350150_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	100.0	6.7e-82
WP_004399452.1|2350164_2350560_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	100.0	2.5e-69
WP_009967519.1|2350556_2350811_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	100.0	2.2e-39
WP_003230958.1|2350794_2351445_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	100.0	3.2e-122
WP_004399477.1|2351441_2351948_+	hypothetical protein	NA	O64060	Bacillus_phage	100.0	5.9e-92
WP_003230954.1|2351944_2352655_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	100.0	1.8e-131
WP_004399252.1|2352697_2353495_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	100.0	2.1e-91
WP_010886547.1|2353512_2354124_+	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	100.0	3.3e-65
WP_009967521.1|2354123_2354351_+	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
WP_009967523.1|2354414_2354771_+	hypothetical protein	NA	O64055	Bacillus_phage	100.0	1.4e-58
WP_004399226.1|2354772_2355990_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	100.0	2.5e-173
WP_004399254.1|2356000_2356351_+	hypothetical protein	NA	O64053	Bacillus_phage	100.0	5.4e-60
WP_004399574.1|2356347_2356539_+	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	100.0	3.5e-29
WP_004399471.1|2356588_2357089_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	100.0	5.7e-87
WP_004399281.1|2357072_2357492_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	100.0	4.8e-71
WP_009969431.1|2357505_2358507_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	100.0	4.8e-194
WP_004399258.1|2358509_2358839_-	hypothetical protein	NA	A0A1P8CWQ2	Bacillus_phage	99.1	1.2e-61
WP_009967529.1|2359014_2359701_-	hypothetical protein	NA	O64048	Bacillus_phage	100.0	2.2e-126
WP_009966645.1|2359725_2359902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967530.1|2360247_2360694_+	hypothetical protein	NA	O64047	Bacillus_phage	100.0	8.1e-77
WP_003246141.1|2360775_2361459_+	hypothetical protein	NA	Q37974	Bacillus_phage	100.0	2.1e-116
WP_004398858.1|2361512_2368370_+	transglycosylase CwlP	NA	A0A1P8CWQ1	Bacillus_phage	67.7	0.0e+00
WP_004398627.1|2368420_2369179_+|tail	phage tail family protein	tail	O64045	Bacillus_phage	100.0	1.4e-145
WP_004398800.1|2369190_2371818_+	hypothetical protein	NA	O64044	Bacillus_phage	100.0	0.0e+00
2370299:2370314	attL	TAGAAAAACTAAAAGA	NA	NA	NA	NA
WP_010886548.1|2371833_2372655_+	hypothetical protein	NA	O64043	Bacillus_phage	100.0	1.2e-134
WP_003246098.1|2372691_2374626_+	phosphodiester glycosidase family protein	NA	O64042	Bacillus_phage	100.0	0.0e+00
WP_004398829.1|2374795_2375620_+	hypothetical protein	NA	A0A1P8CWP0	Bacillus_phage	100.0	1.5e-164
WP_004399160.1|2375609_2375828_+	hypothetical protein	NA	A0A1P8CWN7	Bacillus_phage	100.0	1.7e-35
WP_004399108.1|2375847_2376951_+	N-acetylmuramoyl-L-alanine amidase BlyA	NA	O64040	Bacillus_phage	100.0	2.8e-187
WP_003246119.1|2377038_2377251_+	SPBc2 prophage-derived protein BhlA	NA	A0A290GDY2	Caldibacillus_phage	59.7	4.2e-15
WP_004399099.1|2377261_2377528_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	50.0	1.1e-15
WP_009967541.1|2377583_2378030_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_004399050.1|2378026_2379295_-	SunS family peptide S-glycosyltransferase	NA	NA	NA	NA	NA
WP_003230920.1|2379294_2379708_-	disulfide bond formation protein BdbA	NA	NA	NA	NA	NA
WP_003246186.1|2379704_2381822_-	sublancin transporter SunT	NA	W8CYL7	Bacillus_phage	26.1	6.9e-25
WP_009967544.1|2381879_2382050_-|bacteriocin	bacteriocin sublancin-168	bacteriocin	NA	NA	NA	NA
WP_009967545.1|2382346_2382664_-	sublancin immunity protein SunI	NA	NA	NA	NA	NA
WP_004398504.1|2382765_2384016_-	UV-damage repair protein uvrX	NA	O64031	Bacillus_phage	100.0	4.2e-240
WP_004398710.1|2384008_2384341_-	YolD-like family protein	NA	O64030	Bacillus_phage	100.0	1.3e-55
WP_004399073.1|2384514_2384850_+	hypothetical protein	NA	O64029	Bacillus_phage	100.0	2.1e-53
WP_004398595.1|2384892_2385249_-	hypothetical protein	NA	O64028	Bacillus_phage	100.0	5.0e-61
WP_003246138.1|2385254_2385722_-	YolA family protein	NA	O64027	Bacillus_phage	100.0	5.1e-82
WP_009967548.1|2385952_2386069_+	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_004399156.1|2386347_2386881_-	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	100.0	6.2e-100
WP_004399123.1|2386916_2387495_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	100.0	9.4e-110
WP_003246188.1|2387558_2388056_-	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	100.0	1.9e-95
WP_004398855.1|2388064_2389780_-	ribonuclease YeeF family protein	NA	O64023	Bacillus_phage	99.8	1.4e-302
WP_003246042.1|2389879_2390437_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	100.0	3.6e-106
WP_003245951.1|2390520_2390706_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004399120.1|2390960_2392034_-	SPBc2 prophage-derived pesticidal crystal protein-like YokG	NA	O64021	Bacillus_phage	100.0	9.3e-204
WP_004399048.1|2392335_2393226_+	endonuclease YokF	NA	O64020	Bacillus_phage	100.0	3.3e-114
WP_004398883.1|2393239_2393722_+	PH domain-containing protein	NA	O64019	Bacillus_phage	100.0	2.5e-84
WP_004399070.1|2394025_2394844_+	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	100.0	1.9e-156
WP_004398929.1|2394863_2394998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003246211.1|2395159_2395315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398503.1|2395494_2396010_-	hypothetical protein	NA	O64017	Bacillus_phage	100.0	2.0e-95
WP_004398623.1|2396216_2396927_-	lipoprotein	NA	O64016	Bacillus_phage	100.0	3.7e-108
WP_004399105.1|2397129_2398767_+|integrase	serine-type integrase SprA	integrase	O64015	Bacillus_phage	100.0	2.8e-308
WP_004399080.1|2398821_2399412_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	28.6	4.9e-13
2403687:2403702	attR	TCTTTTAGTTTTTCTA	NA	NA	NA	NA
>prophage 7
NZ_CP053102	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4316079	2537610	2543706	4316079		Staphylococcus_phage(66.67%)	8	NA	NA
WP_003223904.1|2537610_2538204_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
WP_003246108.1|2538193_2538949_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_003230498.1|2539229_2539754_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2539767_2540142_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|2540254_2540719_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_004398484.1|2540751_2541948_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	6.9e-115
WP_004398505.1|2541962_2542610_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	5.0e-43
WP_004398763.1|2542620_2543706_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
>prophage 8
NZ_CP053102	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4316079	2774109	2812251	4316079	terminase,plate,holin,tail,capsid,portal	uncultured_Caudovirales_phage(30.3%)	55	NA	NA
WP_004399034.1|2774109_2775705_+	type II toxin-antitoxin system toxin ribonuclease YqcG	NA	A0A1P8CWI7	Bacillus_phage	61.3	6.9e-78
WP_009967790.1|2775719_2776298_+	type II toxin-antitoxin system antitoxin YqcF	NA	NA	NA	NA	NA
WP_009967791.1|2776415_2776562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229947.1|2776558_2776921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399085.1|2776936_2777416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229946.1|2777580_2778399_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	74.4	1.0e-64
WP_003246208.1|2778443_2778866_-|holin	holin family protein	holin	D6R405	Bacillus_phage	73.7	3.3e-48
WP_003246010.1|2778910_2779804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229944.1|2779891_2780056_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
WP_009967793.1|2780052_2780388_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003229943.1|2780397_2781498_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_003229942.1|2781500_2781773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229941.1|2781769_2782348_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.5e-14
WP_003229940.1|2782331_2783378_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	8.3e-72
WP_004398572.1|2783370_2783796_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	36.4	1.5e-11
WP_003229938.1|2783808_2784072_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_004398524.1|2784068_2785049_-	hypothetical protein	NA	H7BV96	unidentified_phage	32.0	2.1e-40
WP_004398548.1|2785061_2785721_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	4.8e-25
WP_003246092.1|2785713_2790471_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.3e-44
WP_003229934.1|2790473_2790611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229933.1|2790652_2791102_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	41.1	2.7e-11
WP_004398662.1|2791247_2791427_+	type I toxin-antitoxin system toxin TxpA	NA	NA	NA	NA	NA
WP_075058862.1|2791806_2791896_+	type I toxin-antitoxin system toxin BsrH	NA	NA	NA	NA	NA
WP_003229930.1|2792149_2792593_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	3.2e-25
WP_003229929.1|2792595_2793996_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5MNC1	Brevibacillus_phage	39.1	4.1e-74
WP_010886574.1|2793996_2794188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229927.1|2794184_2794622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003246050.1|2794634_2795138_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	8.3e-38
WP_003229925.1|2795134_2795497_-	YqbH/XkdH family protein	NA	A0A249XXE9	Clostridium_phage	39.3	6.9e-10
WP_004398566.1|2795493_2795889_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003229923.1|2795892_2796204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229922.1|2796214_2797150_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	65.0	8.6e-105
WP_003229921.1|2797168_2798137_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.3	7.4e-59
WP_003229920.1|2798169_2798823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398748.1|2798863_2799781_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	2.4e-51
WP_004398894.1|2799777_2801310_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.9	4.7e-148
WP_003229917.1|2801313_2802609_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.4	1.1e-155
WP_003229916.1|2802601_2803321_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	55.9	1.7e-55
WP_004398685.1|2803388_2803853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398775.1|2803996_2804452_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	74.8	2.4e-60
WP_003229913.1|2804649_2805579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229912.1|2805652_2805859_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	71.6	5.5e-20
WP_009967809.1|2805940_2806369_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	5.6e-43
WP_003229910.1|2806464_2806614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075058863.1|2806604_2807546_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	8.0e-58
WP_010886575.1|2807427_2808105_-	DNA-binding protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	31.8	1.1e-05
WP_003229907.1|2808180_2809035_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	79.0	7.1e-122
WP_004398673.1|2809037_2809997_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	72.9	2.2e-135
WP_003229905.1|2810102_2810297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119123069.1|2810256_2810430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245994.1|2810426_2810684_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
WP_004398626.1|2810680_2811250_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
WP_003229902.1|2811323_2811464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398958.1|2811493_2811724_-	helix-turn-helix transcriptional regulator	NA	A8ATK0	Listeria_phage	53.4	1.1e-08
WP_004398704.1|2811900_2812251_+	transcriptional regulator SknR	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	30.6	2.0e-06
>prophage 9
NZ_CP053102	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4316079	2957683	3011133	4316079	protease,tRNA,coat	Faustovirus(14.29%)	50	NA	NA
WP_003229695.1|2957683_2958847_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_003229691.1|2958963_2960070_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_003229689.1|2960056_2960926_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003229687.1|2960879_2962475_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_004398844.1|2962577_2963765_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.1	8.6e-33
WP_004398582.1|2963724_2964267_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_004398512.1|2964291_2965149_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|2965165_2965609_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003246161.1|2965669_2966956_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_004399131.1|2966989_2967568_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|2967645_2967768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2967888_2968173_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|2968185_2968524_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|2968526_2968835_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_004398649.1|2968981_2969848_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_004398684.1|2969840_2970635_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_004398624.1|2970784_2971591_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|2971592_2972273_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|2972325_2972844_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_009967915.1|2972840_2973713_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|2973743_2974757_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_003246034.1|2974848_2975544_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_004398496.1|2975580_2976150_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_004398782.1|2976302_2977301_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_010886586.1|2977434_2978181_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003229640.1|2978320_2979613_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_004398606.1|2979672_2982315_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003222590.1|2982762_2982954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003246083.1|2984031_2985759_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_004398699.1|2985889_2987182_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003229631.1|2987211_2988186_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_003229629.1|2988182_2988971_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_010886587.1|2988960_2989905_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|2989937_2990768_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_004399038.1|2990775_2992143_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003229624.1|2992372_2992870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|2992891_2993479_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003229618.1|2993475_2995800_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	3.4e-182
WP_004398923.1|2995980_2997639_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|2997790_2999053_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
WP_003229611.1|2999324_3000599_-	trigger factor	NA	NA	NA	NA	NA
WP_003229609.1|3000826_3001831_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003229606.1|3001949_3002549_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003229604.1|3002561_3003980_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004399139.1|3004029_3005127_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_009967929.1|3005147_3006704_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
WP_003222549.1|3006690_3007719_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_004399096.1|3007742_3008261_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_004398643.1|3008257_3009982_-	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.4	8.3e-61
WP_004398743.1|3010797_3011133_+|coat	inner spore coat protein CotQ	coat	NA	NA	NA	NA
>prophage 10
NZ_CP053102	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4316079	3572821	3584018	4316079	holin	Organic_Lake_phycodnavirus(50.0%)	14	NA	NA
WP_003228374.1|3572821_3573502_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_003228372.1|3573518_3574439_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|3574450_3575104_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_003242811.1|3575120_3576266_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_003243347.1|3576549_3577083_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009968174.1|3577304_3577781_+	sporulation-delaying system protein SdpA	NA	NA	NA	NA	NA
WP_003228363.1|3577777_3578749_+	sporulation-delaying protein SdpB	NA	NA	NA	NA	NA
WP_003243360.1|3578791_3579403_+	sporulation delaying protein SdpC	NA	NA	NA	NA	NA
WP_003228357.1|3579449_3580073_-	immunity protein SdpI	NA	NA	NA	NA	NA
WP_003243541.1|3580069_3580342_-	sporulation delaying system autorepressor SdpR	NA	NA	NA	NA	NA
WP_003244403.1|3580561_3581251_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_003228350.1|3581268_3582180_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228349.1|3582199_3582853_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003243370.1|3582875_3584018_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
>prophage 11
NZ_CP053102	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4316079	3934120	4010735	4316079	protease,bacteriocin,tRNA,coat	Bacillus_phage(26.67%)	77	NA	NA
WP_003227570.1|3934120_3935791_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243604.1|3935787_3936216_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3936528_3936660_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|3936616_3936769_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_003242599.1|3936793_3938140_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|3938152_3938314_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_003227564.1|3938310_3939030_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.3e-19
WP_003243158.1|3939022_3940333_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_010886633.1|3940322_3941483_+	insulinase family protein	NA	NA	NA	NA	NA
WP_003242974.1|3941487_3942768_+	insulinase family protein	NA	NA	NA	NA	NA
WP_003243391.1|3942764_3943466_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_003244415.1|3943471_3944848_-	YncE family protein	NA	NA	NA	NA	NA
WP_003227552.1|3944886_3946242_-	YncE family protein	NA	NA	NA	NA	NA
WP_003227549.1|3946471_3947617_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
WP_009968329.1|3947600_3947720_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_003227547.1|3947818_3948292_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_003227545.1|3948323_3949196_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|3949256_3950087_-	spermidine synthase	NA	NA	NA	NA	NA
WP_003227540.1|3950288_3952364_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003244446.1|3952656_3953175_-	YwhD family protein	NA	NA	NA	NA	NA
WP_003243167.1|3953188_3953848_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3953956_3954145_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003242889.1|3954187_3954607_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003243399.1|3954726_3956643_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.2	6.2e-142
WP_003243441.1|3957487_3958888_-	MFS transporter	NA	NA	NA	NA	NA
WP_003243988.1|3958887_3959358_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|3959469_3959970_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003243873.1|3960005_3961307_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|3961468_3961693_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003243464.1|3961907_3962684_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_003242581.1|3962827_3963718_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003227511.1|3963885_3964731_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_003243173.1|3964779_3965679_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003243393.1|3965825_3966797_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003242896.1|3967066_3967831_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003244095.1|3967963_3968743_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_003242568.1|3968757_3969957_-	transaminase BacF	NA	NA	NA	NA	NA
WP_003244502.1|3969957_3971142_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_003242921.1|3971138_3972557_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_003243359.1|3972575_3973337_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003244300.1|3973339_3974047_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|3974036_3974651_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_003242790.1|3974802_3976041_-	MFS transporter	NA	NA	NA	NA	NA
WP_003244348.1|3976250_3977663_-	amino acid permease	NA	NA	NA	NA	NA
WP_003227487.1|3977662_3979363_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003243454.1|3979436_3980984_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227482.1|3981210_3982485_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003242493.1|3982661_3983126_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_003242881.1|3983449_3983905_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_003242585.1|3983897_3984749_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.5	4.1e-37
WP_003244201.1|3984762_3985710_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_003243368.1|3985709_3986450_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	2.6e-48
WP_003244190.1|3986474_3987494_-|coat	spore coat polysaccharide biosynthesis protein SpsG	coat	NA	NA	NA	NA
WP_003243421.1|3987496_3988219_-|coat	spore coat polysaccharide biosynthesis protein SpsF	coat	NA	NA	NA	NA
WP_003243135.1|3988211_3989333_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_003243179.1|3989332_3990202_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003243878.1|3990202_3991372_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	26.6	5.5e-16
WP_003243510.1|3991392_3992817_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_003244383.1|3992821_3993592_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_003227448.1|3993911_3994457_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|3994500_3994872_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_010886635.1|3994933_3996256_-	purine/pyrimidine permease	NA	NA	NA	NA	NA
WP_003243806.1|3996275_3996593_-	YwdI family protein	NA	NA	NA	NA	NA
WP_003227441.1|3996760_3998131_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003242965.1|3998155_3998833_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
WP_003242519.1|3998846_3999653_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009968358.1|3999742_4000276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227434.1|4000323_4000959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227432.1|4000951_4001290_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003242645.1|4001433_4002249_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|4002338_4002587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886636.1|4002680_4004120_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	26.5	1.8e-21
WP_003227426.1|4004116_4005502_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003243563.1|4005803_4006574_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003243088.1|4006612_4007443_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|4007482_4007785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227419.1|4008314_4010735_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	36.8	6.9e-21
