The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053109	Streptomyces sp. Z423-1 chromosome	9460473	25180	60516	9460473	transposase,integrase	Gordonia_phage(25.0%)	28	31446:31462	44406:44422
WP_171116290.1|25180_27265_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_171110551.1|27988_28636_+	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_171117725.1|30050_30365_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
31446:31462	attL	CTCGTCGGCCCGGCGGG	NA	NA	NA	NA
WP_171117728.1|31543_32962_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_171117730.1|34030_34342_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	53.3	2.2e-17
WP_171117732.1|34338_34752_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_171133957.1|34846_35128_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171133947.1|35631_36027_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	41.8	2.3e-14
WP_171118606.1|36044_36536_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171112835.1|36539_37424_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_171112837.1|37633_38128_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	56.5	2.6e-44
WP_171112839.1|38559_39291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171112841.1|39489_40188_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_171112842.1|41785_42463_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171112844.1|42560_43865_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	49.7	5.3e-92
WP_171112846.1|43861_45082_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
44406:44422	attR	CCCGCCGGGCCGACGAG	NA	NA	NA	NA
WP_171112848.1|45092_45389_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_171112850.1|45385_48250_+	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_171112852.1|48242_48878_+	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_171112854.1|49129_51454_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_171112856.1|51821_52901_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_171112858.1|52921_54640_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_171112860.1|54653_55514_-	amidohydrolase	NA	NA	NA	NA	NA
WP_171112862.1|55671_56889_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_171112864.1|56931_58380_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_171112866.1|58611_58899_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_171133958.1|59446_59989_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171133959.1|59913_60516_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP053109	Streptomyces sp. Z423-1 chromosome	9460473	868420	880096	9460473	capsid,portal	Mycobacterium_phage(37.5%)	16	NA	NA
WP_171110631.1|868420_868597_-	hypothetical protein	NA	A0A2P1CJ82	Mycobacterium_phage	54.9	8.2e-09
WP_171110630.1|868654_869296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110629.1|869273_870254_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_171110628.1|870250_870754_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_171110627.1|870756_871008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171107100.1|871019_872540_-	hypothetical protein	NA	A0A166Y926	Gordonia_phage	49.7	8.1e-36
WP_171110626.1|872603_873575_-|capsid	phage major capsid protein	capsid	I3NL99	Bifidobacterium_phage	41.8	2.8e-66
WP_171110625.1|873652_874222_-	DUF4355 domain-containing protein	NA	A0A088FQ73	Mycobacterium_phage	43.2	3.3e-14
WP_171110624.1|874327_874642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110623.1|874647_875361_-	hypothetical protein	NA	A0A2I2MPD0	Mycobacterium_phage	30.5	4.7e-10
WP_171110622.1|875365_876763_-|portal	phage portal protein	portal	A0A1C9LXM1	Streptomyces_phage	37.2	1.7e-72
WP_171110621.1|876767_878483_-	Terminase	NA	A0A1B3AY92	Gordonia_phage	40.7	4.0e-108
WP_171110620.1|878472_878655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110619.1|878668_879205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110618.1|879244_879490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110617.1|879502_880096_-	DNA primase	NA	Q6VY59	Streptomyces_phage	50.9	1.1e-36
>prophage 3
NZ_CP053109	Streptomyces sp. Z423-1 chromosome	9460473	1302167	1320385	9460473	protease,integrase,transposase	Enterobacteria_phage(20.0%)	15	1319718:1319735	1323090:1323107
WP_171109377.1|1302167_1304702_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	41.1	5.0e-131
WP_171133992.1|1304731_1306534_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_171109376.1|1306649_1307402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171109375.1|1307527_1309096_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_171109374.1|1309224_1309632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171109373.1|1309813_1311574_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_171109372.1|1311605_1312385_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_171109371.1|1312435_1313068_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_171109370.1|1313102_1314401_-	4-carboxymuconolactone decarboxylase	NA	A0A1C9LYC8	Mycobacterium_phage	30.1	5.5e-09
WP_171111513.1|1314582_1315776_-|integrase	site-specific integrase	integrase	A0A160DFA7	Gordonia_phage	25.4	3.2e-19
WP_171109369.1|1317323_1317797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171109368.1|1317865_1318699_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171133957.1|1319203_1319485_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171133993.1|1319498_1320077_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	28.6	2.7e-08
1319718:1319735	attL	GAACTGCGACGCCTGGGG	NA	NA	NA	NA
WP_171133994.1|1320073_1320385_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	41.8	5.2e-14
WP_171133994.1|1320073_1320385_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	41.8	5.2e-14
1323090:1323107	attR	CCCCAGGCGTCGCAGTTC	NA	NA	NA	NA
>prophage 4
NZ_CP053109	Streptomyces sp. Z423-1 chromosome	9460473	4321565	4356978	9460473	tail,transposase,plate	Saccharomonospora_phage(25.0%)	31	NA	NA
WP_171109587.1|4321565_4322105_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171109588.1|4322451_4323513_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_171111573.1|4323648_4325016_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_171109589.1|4325023_4326028_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_171109590.1|4326024_4326903_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_171109591.1|4326951_4328424_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_171109592.1|4328613_4330407_+	coagulation factor 5/8 type domain-containing protein	NA	NA	NA	NA	NA
WP_171109593.1|4330439_4330604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171115766.1|4333680_4334343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171118937.1|4335772_4336099_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171115768.1|4336455_4337097_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171115770.1|4337204_4337510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171115772.1|4337545_4337686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171115774.1|4338518_4339094_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	70.9	1.4e-76
WP_171115776.1|4339127_4339625_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_171115778.1|4339766_4340768_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_171115780.1|4340976_4341318_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_171118939.1|4341511_4342231_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_171134047.1|4342305_4343055_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_171117318.1|4344118_4344682_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_171117316.1|4344783_4346745_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_171117314.1|4346744_4347167_-	GPW/gp25 family protein	NA	A0A1D8KT65	Synechococcus_phage	32.3	5.8e-08
WP_171117312.1|4347449_4347791_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_171117310.1|4347825_4349649_-	VgrG-related protein	NA	NA	NA	NA	NA
WP_171117308.1|4349645_4350368_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171117306.1|4350420_4350846_-|tail	phage tail protein	tail	A0A059XEM3	uncultured_phage	28.3	6.0e-05
WP_171117305.1|4350875_4354259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171117303.1|4354263_4354422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171117302.1|4354418_4354913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171117300.1|4354909_4355350_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_171117298.1|4355409_4356978_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.1	3.7e-68
>prophage 5
NZ_CP053109	Streptomyces sp. Z423-1 chromosome	9460473	6741488	6789059	9460473	transposase,integrase	uncultured_virus(12.5%)	47	6754011:6754031	6786161:6786181
WP_171111782.1|6741488_6743123_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_171110553.1|6743455_6743737_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_171110554.1|6743764_6746026_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.6	4.8e-85
WP_171110555.1|6746106_6746382_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_171110556.1|6746556_6747522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171111784.1|6748389_6748728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171110557.1|6748869_6750012_+	PLP-dependent cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	30.4	3.1e-32
WP_171110558.1|6750008_6751310_+	MFS transporter	NA	NA	NA	NA	NA
WP_171110559.1|6751392_6752613_+	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
6754011:6754031	attL	GGTCGCCCGGCACTACGGCAC	NA	NA	NA	NA
WP_171110560.1|6754919_6755711_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.2	1.8e-26
WP_171110561.1|6755735_6756407_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_171110562.1|6756493_6756865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171134092.1|6757237_6758164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110564.1|6758379_6758820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110565.1|6759230_6761129_+	copper resistance protein CopC/CopD	NA	NA	NA	NA	NA
WP_171110566.1|6761301_6761940_+	DUF3105 domain-containing protein	NA	NA	NA	NA	NA
WP_171110567.1|6762025_6762619_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_171110568.1|6762885_6763107_+	CbtB-domain containing protein	NA	NA	NA	NA	NA
WP_171110569.1|6763123_6763888_+	CbtA family protein	NA	NA	NA	NA	NA
WP_171110570.1|6764182_6764401_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_171111786.1|6764568_6764901_+	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_171110571.1|6764891_6766325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171110572.1|6766317_6767259_+	NADH-quinone oxidoreductase subunit H	NA	NA	NA	NA	NA
WP_171110573.1|6767266_6767836_+	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_171110574.1|6767832_6768138_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_171110575.1|6768134_6769985_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_171111788.1|6769990_6771499_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_171111790.1|6771504_6772926_+	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_171133996.1|6773379_6774198_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_171111883.1|6774262_6775291_-	C40 family peptidase	NA	A0A222YZ81	Streptomyces_phage	37.2	9.4e-12
WP_171111881.1|6775437_6776352_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_171111879.1|6776348_6776717_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_171111869.1|6777023_6777194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171111877.1|6777376_6777697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171111875.1|6777896_6779273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171111873.1|6779269_6779836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171111871.1|6779832_6781764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171133994.1|6782084_6782396_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	41.8	5.2e-14
WP_171133993.1|6782392_6782971_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	28.6	2.7e-08
WP_171134068.1|6782967_6783267_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	36.2	4.2e-05
WP_171111164.1|6783336_6783492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171111166.1|6783615_6783912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171111167.1|6783908_6784352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171111169.1|6784348_6785062_-	ParA family protein	NA	NA	NA	NA	NA
WP_171111172.1|6785251_6785839_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_171111174.1|6785820_6787140_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
6786161:6786181	attR	GTGCCGTAGTGCCGGGCGACC	NA	NA	NA	NA
WP_171111855.1|6787808_6789059_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	35.2	6.7e-28
>prophage 6
NZ_CP053109	Streptomyces sp. Z423-1 chromosome	9460473	7599206	7668930	9460473	tail,protease,plate	Bacillus_phage(14.29%)	49	NA	NA
WP_171113324.1|7599206_7601075_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	36.4	1.6e-46
WP_141309194.1|7601115_7601640_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_171113326.1|7601662_7602385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171134102.1|7602377_7603139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171113328.1|7603203_7604031_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_171118649.1|7604064_7606068_+	AAA family ATPase	NA	A0A109WUE1	Acidianus_tailed_spindle_virus	34.8	1.9e-08
WP_171113330.1|7606058_7606331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171113334.1|7612950_7614174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171113335.1|7614194_7614878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171113337.1|7614886_7615264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171113339.1|7615256_7616396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171113341.1|7616418_7616955_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_171113343.1|7616978_7617323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171113345.1|7617309_7617489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171134152.1|7617596_7618013_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_171134103.1|7618009_7621102_+|plate	putative baseplate assembly protein	plate	A0A1Q1PVP2	Phage_DP-2017a	23.8	6.3e-11
WP_171113347.1|7621098_7624839_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_171113349.1|7624838_7626992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171113351.1|7627077_7628607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171113353.1|7628606_7629503_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A142K646	Streptomyces_phage	60.2	1.7e-94
WP_171113355.1|7629610_7630630_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_171113357.1|7630747_7631338_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171118654.1|7631349_7632720_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	23.4	1.6e-14
WP_171113359.1|7632779_7636646_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.8	3.4e-38
WP_171113361.1|7637169_7638495_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_141309216.1|7638652_7638886_+	DUF320 domain-containing protein	NA	NA	NA	NA	NA
WP_171113363.1|7638997_7639816_+	DUF320 domain-containing protein	NA	NA	NA	NA	NA
WP_171113365.1|7639906_7640095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171113366.1|7640142_7640862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171113368.1|7640935_7643155_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171113370.1|7643151_7644138_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_171113372.1|7644263_7645319_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171113374.1|7645546_7646335_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_171113376.1|7646466_7647153_+	MSMEG_4193 family putative phosphomutase	NA	NA	NA	NA	NA
WP_171113378.1|7647274_7647865_+	DUF3090 domain-containing protein	NA	NA	NA	NA	NA
WP_171113380.1|7647828_7648647_+	SCO1664 family protein	NA	NA	NA	NA	NA
WP_171113382.1|7648780_7650010_+	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	NA	NA	NA	NA
WP_171113384.1|7650065_7651040_-	PAC2 family protein	NA	NA	NA	NA	NA
WP_171113385.1|7651358_7652975_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_171113387.1|7653024_7654566_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_171113389.1|7654647_7655442_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	30.7	1.9e-23
WP_171113391.1|7655792_7656557_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171113393.1|7656904_7660417_+	methionine synthase	NA	NA	NA	NA	NA
WP_171113395.1|7660546_7661239_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_171113396.1|7661668_7663270_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_171113398.1|7663341_7664922_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_141309237.1|7665000_7665672_-	response regulator	NA	NA	NA	NA	NA
WP_171113400.1|7665908_7666967_-	RecB family exonuclease	NA	NA	NA	NA	NA
WP_171113401.1|7667142_7668930_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP053109	Streptomyces sp. Z423-1 chromosome	9460473	7900400	7911765	9460473		Gordonia_phage(25.0%)	16	NA	NA
WP_171117891.1|7900400_7901237_+	phage antirepressor	NA	A0A1L6BZH6	Pasteurella_phage	37.9	4.5e-44
WP_171117889.1|7901233_7901479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171117887.1|7901475_7901730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171117884.1|7901726_7902464_+	hypothetical protein	NA	A0A249XTW9	Mycobacterium_phage	30.5	8.3e-18
WP_171117882.1|7902400_7902796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171117880.1|7902779_7903232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171117878.1|7903228_7903603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171117876.1|7903766_7904114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171117875.1|7904110_7904935_+	hypothetical protein	NA	A0A0R8VB90	Thermobifida_phage	42.7	1.6e-54
WP_171117873.1|7904946_7905714_+	AAA family ATPase	NA	A0A160DER9	Gordonia_phage	44.7	7.7e-51
WP_171117871.1|7905775_7906150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171117869.1|7906274_7907114_+	hypothetical protein	NA	A0A2P1A0S7	Gordonia_phage	30.7	1.0e-11
WP_171117867.1|7907113_7908832_+	DNA cytosine methyltransferase	NA	A0A0K1LMQ3	Caulobacter_phage	28.0	5.1e-10
WP_171117865.1|7908918_7909803_+	hypothetical protein	NA	A0A1J0MCP9	Streptomyces_phage	54.4	5.6e-21
WP_171117863.1|7909783_7910404_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_171119201.1|7910418_7911765_+	AAA family ATPase	NA	C7BGG1	Burkholderia_phage	33.4	3.3e-49
>prophage 8
NZ_CP053109	Streptomyces sp. Z423-1 chromosome	9460473	8056280	8130106	9460473	protease,transposase	Burkholderia_phage(13.33%)	71	NA	NA
WP_171107251.1|8056280_8057081_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_171107253.1|8057088_8057898_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_171107254.1|8058083_8058722_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171107256.1|8058789_8059218_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_171107258.1|8059543_8060089_+	peptidase	NA	NA	NA	NA	NA
WP_171107260.1|8060166_8061168_+	EamA family transporter	NA	NA	NA	NA	NA
WP_171111315.1|8061475_8062474_+	EamA family transporter	NA	NA	NA	NA	NA
WP_171111316.1|8062534_8063239_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_171107262.1|8063296_8064619_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_171107264.1|8064664_8064997_+	VOC family protein	NA	NA	NA	NA	NA
WP_171107266.1|8065097_8066039_-	DMT family transporter	NA	NA	NA	NA	NA
WP_171107268.1|8066102_8067005_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171107269.1|8067012_8067480_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_171107272.1|8067610_8068252_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_171107274.1|8068255_8068717_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_171107276.1|8068844_8069600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171111318.1|8069605_8070022_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_171107278.1|8070157_8070919_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_171107280.1|8070930_8071692_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_171107283.1|8071920_8073501_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_171107285.1|8073582_8074275_+	uracil-DNA glycosylase	NA	V5NWU7	Chelonid_alphaherpesvirus	42.5	3.9e-46
WP_171107287.1|8074391_8074913_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_171107289.1|8074939_8075416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171107291.1|8075528_8076041_-	DinB family protein	NA	NA	NA	NA	NA
WP_171107294.1|8076082_8076700_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171107296.1|8076785_8077979_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_171107298.1|8077989_8078904_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_171107300.1|8078818_8080378_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_171107302.1|8080485_8080965_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_171111320.1|8081094_8081727_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_171107304.1|8081723_8082464_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_171107306.1|8082471_8082957_-	chloramphenicol phosphotransferase	NA	NA	NA	NA	NA
WP_171107308.1|8082956_8083136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171134068.1|8083787_8084087_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	36.2	4.2e-05
WP_171134108.1|8084083_8084971_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.4	6.4e-33
WP_171107243.1|8085664_8086243_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_171107241.1|8086239_8087712_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5E1	Streptococcus_phage	27.8	1.1e-08
WP_171114532.1|8089810_8090362_+	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_171134109.1|8090438_8091572_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_171114534.1|8091670_8092465_+	FkbM family methyltransferase	NA	A0A291AUV0	Sinorhizobium_phage	29.0	1.1e-10
WP_171114535.1|8092650_8093658_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	31.4	8.6e-26
WP_171114536.1|8093673_8094426_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_171114537.1|8094472_8095660_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_171114538.1|8095660_8096404_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_171114539.1|8096581_8097721_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_171114540.1|8097717_8098416_-	WbqC family protein	NA	NA	NA	NA	NA
WP_171118827.1|8098412_8099063_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_171114541.1|8099080_8099575_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171114542.1|8099821_8101180_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_171134110.1|8101173_8102382_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_171114544.1|8102378_8103326_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	33.0	7.3e-27
WP_171114545.1|8103354_8104830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171118831.1|8104856_8106119_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	27.2	4.7e-21
WP_171114546.1|8106399_8107473_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	33.3	1.8e-29
WP_171114547.1|8107469_8108669_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_171114548.1|8108741_8109887_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_171114549.1|8109932_8111507_-	DUF4012 domain-containing protein	NA	NA	NA	NA	NA
WP_171118832.1|8112768_8113884_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_171072378.1|8114866_8115175_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	51.0	2.9e-17
WP_171114550.1|8115171_8115777_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	38.5	4.5e-22
WP_171114551.1|8115773_8116091_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	44.6	2.5e-11
WP_171134111.1|8116157_8116700_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171134112.1|8116624_8117227_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171117373.1|8117362_8118739_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	53.8	7.0e-119
WP_171119119.1|8119113_8120208_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_171134113.1|8123370_8124258_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.4	6.4e-33
WP_171134068.1|8124254_8124554_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	36.2	4.2e-05
WP_171134114.1|8124577_8124739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171107312.1|8124859_8126254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171134153.1|8126330_8126852_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_171113162.1|8129356_8130106_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP053109	Streptomyces sp. Z423-1 chromosome	9460473	8215709	8233632	9460473	tail,capsid,portal	Streptomyces_phage(78.57%)	22	NA	NA
WP_171113031.1|8215709_8216714_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1J0MCQ0	Streptomyces_phage	37.2	3.3e-41
WP_171113029.1|8216713_8217019_-	hypothetical protein	NA	A0A142K8R1	Gordonia_phage	59.8	1.3e-25
WP_171134116.1|8217083_8218850_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A1B1PAA2	Streptomyces_phage	31.8	2.3e-29
WP_171134117.1|8218851_8219784_-	hypothetical protein	NA	A0A291LI15	Streptomyces_phage	31.0	3.7e-15
WP_171110605.1|8219787_8220942_-	hypothetical protein	NA	A0A0K1Y9X6	Streptomyces_phage	27.8	1.0e-22
WP_171110604.1|8220957_8221935_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_171134118.1|8221949_8224481_-|tail	phage tail tape measure protein	tail	A0A2H5BLS1	Streptomyces_phage	45.6	3.3e-58
WP_171111795.1|8224541_8224751_-	hypothetical protein	NA	A0A2K9VH90	Gordonia_phage	54.7	2.1e-11
WP_171110602.1|8224747_8225281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110601.1|8225280_8225754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110600.1|8225763_8226207_-	hypothetical protein	NA	A0A1J0MBT6	Streptomyces_phage	36.1	6.1e-08
WP_171111793.1|8226203_8226503_-	hypothetical protein	NA	A0A1V0E617	Streptomyces_phage	57.1	5.0e-22
WP_171110599.1|8226566_8226887_-	hypothetical protein	NA	K4I2V6	Streptomyces_phage	40.2	2.0e-13
WP_171110598.1|8226886_8227552_-	hypothetical protein	NA	A0A1J0MC98	Streptomyces_phage	48.3	1.1e-16
WP_171110597.1|8227638_8228148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110596.1|8228147_8228450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110595.1|8228465_8228819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110594.1|8228902_8229817_-	hypothetical protein	NA	A0A222ZRM6	Mycobacterium_phage	26.7	3.2e-19
WP_171110593.1|8229834_8230653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171110592.1|8230750_8231002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171110591.1|8230998_8232102_-|capsid	capsid protein	capsid	A0A1J0MC53	Streptomyces_phage	53.3	5.4e-90
WP_171110590.1|8232117_8233632_-|portal	phage portal protein	portal	A0A1J0MCC3	Streptomyces_phage	43.9	1.4e-104
>prophage 10
NZ_CP053109	Streptomyces sp. Z423-1 chromosome	9460473	8244045	8257579	9460473		Streptomyces_phage(36.36%)	21	NA	NA
WP_171108625.1|8244045_8244612_-	3'-5' exoribonuclease	NA	A0A0M5M6E2	Streptomyces_phage	52.9	6.7e-44
WP_171108627.1|8244739_8244946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171108629.1|8245052_8245295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171108631.1|8245291_8246461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171108633.1|8246537_8246969_-	DUF4326 domain-containing protein	NA	A0A142K9N0	Gordonia_phage	48.3	2.3e-28
WP_171108635.1|8246965_8247337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171108637.1|8247392_8247590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171108639.1|8247593_8249375_-	AAA family ATPase	NA	Q1WDH9	Streptomyces_phage	48.1	8.4e-133
WP_171108641.1|8249386_8249695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171108643.1|8249694_8250513_-	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	36.2	1.5e-28
WP_171108645.1|8250515_8250884_-	hypothetical protein	NA	A0A142K8T9	Gordonia_phage	40.2	1.8e-10
WP_171108647.1|8251022_8251490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171108649.1|8251489_8251690_-	transcription factor WhiB	NA	NA	NA	NA	NA
WP_171108650.1|8251689_8252340_-	hypothetical protein	NA	A0A0R8VCP1	Thermobifida_phage	38.8	1.9e-18
WP_171111438.1|8252336_8253659_-	DNA cytosine methyltransferase	NA	A0A142KCP3	Gordonia_phage	40.8	3.4e-62
WP_171111440.1|8253658_8254282_-	hypothetical protein	NA	Q1WDI4	Streptomyces_phage	47.1	3.3e-36
WP_171108652.1|8254293_8254575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171108654.1|8254571_8255015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171108656.1|8255014_8255767_-	DNA polymerase III subunit epsilon	NA	Q1WDI5	Streptomyces_phage	43.2	5.2e-44
WP_171108658.1|8255763_8256537_-	ERF family protein	NA	A0A0M4RQK0	Mycobacterium_phage	44.2	1.1e-31
WP_171134121.1|8256538_8257579_-	YqaJ viral recombinase family protein	NA	A0A142K7H9	Mycobacterium_phage	30.2	4.4e-17
>prophage 11
NZ_CP053109	Streptomyces sp. Z423-1 chromosome	9460473	9410388	9437773	9460473	transposase	Burkholderia_phage(50.0%)	26	NA	NA
WP_171118531.1|9410388_9411597_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_171134068.1|9411689_9411989_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	36.2	4.2e-05
WP_171134108.1|9411985_9412873_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.4	6.4e-33
WP_171117736.1|9412924_9415153_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_171117738.1|9416159_9416411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171117740.1|9416437_9416884_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_171119181.1|9417274_9417511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171117743.1|9417802_9418339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171134108.1|9419509_9420397_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.4	6.4e-33
WP_171134068.1|9420393_9420693_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	36.2	4.2e-05
WP_171134134.1|9420744_9421422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171109924.1|9421469_9421697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171109923.1|9422317_9422785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171109922.1|9422825_9423434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171109921.1|9423478_9423712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171109920.1|9423949_9424723_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171109919.1|9424754_9426458_-	amidohydrolase	NA	NA	NA	NA	NA
WP_171109918.1|9426962_9427520_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_171107095.1|9427802_9428201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171111642.1|9429487_9430606_+	beta-lactamase family protein	NA	A0A1D8EXR7	Mycobacterium_phage	31.2	6.9e-24
WP_171109917.1|9431567_9431840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171109916.1|9432403_9433945_+	von Willebrand factor type A domain-containing protein	NA	NA	NA	NA	NA
WP_171109915.1|9434613_9435066_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171109914.1|9435179_9436007_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171109913.1|9437040_9437367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171134068.1|9437473_9437773_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	36.2	4.2e-05
