The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053080	Escherichia coli strain HB37 chromosome HB37, complete sequence	5307814	76770	159719	5307814	integrase,transposase	Stx2-converting_phage(35.71%)	53	92938:92955	165866:165883
WP_001608690.1|76770_78303_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.1	6.3e-44
WP_000839179.1|79721_80126_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|80122_80470_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_170171920.1|80518_82057_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	97.9	6.5e-291
WP_077632959.1|83174_83408_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	58.7	4.4e-18
WP_001608734.1|83643_84078_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001608731.1|85374_87480_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001608730.1|87506_88715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019841493.1|90291_91509_-	RhtX/FptX family siderophore transporter	NA	NA	NA	NA	NA
WP_001608727.1|91486_92926_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
92938:92955	attL	CATCATTAAAAAAAGCGG	NA	NA	NA	NA
WP_001608724.1|93173_95303_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_001608722.1|95414_96287_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_170171921.1|98904_100293_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_001608713.1|102168_102849_+	hydrolase	NA	NA	NA	NA	NA
WP_001608711.1|102913_103192_+	XapX domain-containing protein	NA	NA	NA	NA	NA
WP_001608710.1|103188_105084_+	amidohydrolase	NA	NA	NA	NA	NA
WP_032150403.1|105700_106297_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001608707.1|107484_108387_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001608706.1|108753_109110_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_001608705.1|109156_109462_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_001608704.1|109745_110825_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_170171922.1|110821_113377_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001608701.1|113382_114105_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001608700.1|114173_114725_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001608695.1|115871_117104_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	1.7e-60
WP_001608692.1|117088_117733_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_001608690.1|117885_119418_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.1	6.3e-44
WP_001608744.1|120119_120809_+	pirin family protein	NA	NA	NA	NA	NA
WP_001608745.1|120994_121705_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_001608746.1|121806_122151_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001608747.1|122325_123327_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_019841839.1|123594_123774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042041060.1|123893_124226_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.2	5.7e-11
WP_001608750.1|124222_124570_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	94.8	1.3e-58
WP_001609451.1|126653_127691_+	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	78.2	6.1e-27
WP_001609456.1|127772_128246_+	hypothetical protein	NA	Q9LA59	Enterobacterial_phage	47.7	2.7e-38
WP_001609457.1|128609_128846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609460.1|129889_131143_+	TolC family protein	NA	NA	NA	NA	NA
WP_021552670.1|131167_133315_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	27.5	4.5e-24
WP_019841570.1|133377_134625_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001609576.1|142080_142455_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000555401.1|143247_144381_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_001609588.1|147746_149081_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_153274989.1|149681_149840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001609589.1|150028_150469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609593.1|150587_150887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001609595.1|150844_153166_-	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_001609597.1|153162_153633_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_164965851.1|154821_154971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609440.1|155276_155690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609439.1|155686_156070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609437.1|156329_156899_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_019841340.1|158537_159719_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.2	1.3e-161
165866:165883	attR	CCGCTTTTTTTAATGATG	NA	NA	NA	NA
>prophage 2
NZ_CP053080	Escherichia coli strain HB37 chromosome HB37, complete sequence	5307814	190759	211486	5307814	integrase	Morganella_phage(26.67%)	26	193937:193952	204953:204968
WP_170171923.1|190759_192181_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.0	2.8e-123
WP_000909175.1|192180_192858_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_000420674.1|192851_193313_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001018524.1|193329_193491_-	hypothetical protein	NA	NA	NA	NA	NA
193937:193952	attL	TGTGTTGGTTCAAAAT	NA	NA	NA	NA
WP_047668300.1|194075_196832_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	5.2e-299
WP_001208878.1|196818_197190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628967.1|197182_197524_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_032153477.1|197534_198137_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	4.4e-25
WP_000181940.1|198129_198351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|198347_198611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|198607_198802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047668298.1|198794_199862_-	ash family protein	NA	NA	NA	NA	NA
WP_000042976.1|199858_200038_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047668296.1|200030_200864_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_163428320.1|200876_201308_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
WP_001363069.1|201307_201526_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001705540.1|201631_202513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053271010.1|202606_203866_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.9	4.9e-196
WP_097763231.1|204541_204829_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_097763232.1|205088_205544_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	65.7	6.4e-45
204953:204968	attR	ATTTTGAACCAACACA	NA	NA	NA	NA
WP_097763233.1|205623_205845_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	40.0	5.3e-05
WP_170171916.1|206069_206339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016231257.1|206328_206766_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_016238273.1|206825_208931_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	36.2	2.0e-88
WP_170171923.1|208930_210352_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.0	2.8e-123
WP_000420674.1|211024_211486_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
>prophage 3
NZ_CP053080	Escherichia coli strain HB37 chromosome HB37, complete sequence	5307814	1620732	1654323	5307814	tail,terminase,integrase	Escherichia_phage(45.95%)	39	1613785:1613802	1644490:1644507
1613785:1613802	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_001296289.1|1620732_1622199_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|1622267_1623845_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_097739252.1|1624037_1625288_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	2.3e-238
WP_023909811.1|1625291_1625486_-	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	98.4	5.7e-27
WP_000163455.1|1625482_1626133_-	hypothetical protein	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	98.6	7.3e-127
WP_021535144.1|1626125_1626377_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	8.9e-41
WP_000675390.1|1626534_1626783_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_000064070.1|1626832_1627750_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	49.7	1.2e-69
WP_021529279.1|1627746_1628568_-	hypothetical protein	NA	G9L6A3	Escherichia_phage	98.2	3.4e-161
WP_024237619.1|1628564_1628864_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	99.0	7.6e-47
WP_000836293.1|1629172_1629757_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
WP_001282459.1|1629911_1630142_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_071666380.1|1630483_1631314_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	96.4	7.6e-153
WP_001561060.1|1631285_1632062_+	hypothetical protein	NA	G9L6A9	Escherichia_phage	99.6	3.0e-151
WP_001231263.1|1632179_1632527_+	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.3	3.1e-60
WP_023152116.1|1632588_1633242_+	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	58.4	2.7e-57
WP_170171952.1|1633238_1633910_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	70.2	4.0e-80
WP_000212745.1|1633911_1634199_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	98.9	3.5e-49
WP_071788142.1|1634286_1634922_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	98.6	6.0e-118
WP_023152113.1|1634914_1635196_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	5.0e-48
WP_001129694.1|1635188_1635527_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	1.4e-57
WP_001124395.1|1635544_1635757_+	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_064262073.1|1635753_1636428_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	98.7	2.2e-118
WP_097739249.1|1636424_1637900_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	99.6	4.4e-297
WP_059217177.1|1637911_1638211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335899.1|1638967_1639174_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_170171953.1|1639188_1640868_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	1.4e-302
WP_000133160.1|1640864_1641161_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_097739247.1|1641163_1641859_+	peptidase	NA	G9L6C4	Escherichia_phage	95.2	2.9e-89
WP_000268715.1|1641873_1642860_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_000627071.1|1642911_1643349_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	99.3	6.3e-74
WP_000012377.1|1643359_1643695_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_097739246.1|1643745_1644069_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	97.2	7.7e-53
WP_023152107.1|1644068_1644674_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	8.1e-112
1644490:1644507	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
WP_097739245.1|1644673_1647145_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.9	0.0e+00
WP_000568027.1|1647144_1647609_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
WP_021524920.1|1647608_1648187_+	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	80.8	1.1e-57
WP_170171954.1|1648186_1650934_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.7	2.4e-118
WP_170171955.1|1650933_1654323_+	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.9	1.4e-184
>prophage 4
NZ_CP053080	Escherichia coli strain HB37 chromosome HB37, complete sequence	5307814	1661489	1665243	5307814	holin	Escherichia_phage(87.5%)	8	NA	NA
WP_001275999.1|1661489_1661894_+	membrane protein	NA	G9L6E6	Escherichia_phage	97.0	2.7e-63
WP_000256100.1|1661880_1662189_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	92.2	1.0e-46
WP_023151943.1|1662178_1662808_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	2.6e-113
WP_023151942.1|1662804_1663302_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	65.8	2.6e-47
WP_000755178.1|1663497_1664037_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_001311989.1|1664052_1664571_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000076001.1|1664881_1665073_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017553.1|1665090_1665243_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
>prophage 5
NZ_CP053080	Escherichia coli strain HB37 chromosome HB37, complete sequence	5307814	3089907	3135008	5307814	head,capsid,portal,terminase,lysis,integrase,tail,tRNA	Enterobacteria_phage(56.0%)	58	3082716:3082731	3142359:3142374
3082716:3082731	attL	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
WP_023152094.1|3089907_3090489_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.6e-101
WP_024179053.1|3090488_3093329_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	2.5e-54
WP_023152091.1|3093393_3093993_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.3e-111
WP_052991286.1|3094059_3097458_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
WP_000090917.1|3097518_3098151_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_044869897.1|3098087_3098831_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	7.7e-149
WP_016230622.1|3098835_3099534_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
WP_000847349.1|3099533_3099863_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	2.8e-58
WP_000459487.1|3102412_3102847_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	6.5e-63
WP_000479163.1|3102828_3103251_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_001577918.1|3103266_3104007_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000683149.1|3104014_3104410_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.0e-70
WP_001007375.1|3104406_3104985_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
WP_001204540.1|3104996_3105350_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|3105342_3105717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170171986.1|3105768_3106797_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	4.5e-115
WP_000256813.1|3106854_3107202_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_001253894.1|3107238_3108744_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.2	1.3e-99
WP_000831760.1|3108733_3110326_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_023151962.1|3110322_3110529_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000867568.1|3112411_3112960_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000881607.1|3113523_3113706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3113912_3114239_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|3114719_3115013_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|3115103_3115286_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135283.1|3115502_3116000_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_000839596.1|3115999_3116215_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|3116803_3117886_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|3118074_3118458_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971056.1|3118543_3118684_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3118680_3119043_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774485.1|3119039_3119330_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
WP_000224917.1|3119322_3119493_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
WP_001053041.1|3119492_3119948_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
WP_000182282.1|3120215_3120593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000608370.1|3120589_3121018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788796.1|3121096_3121810_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
WP_000147913.1|3121806_3122826_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	6.1e-112
WP_001182882.1|3122822_3123362_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000184665.1|3123392_3123620_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001337214.1|3123730_3124423_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000380252.1|3124503_3125565_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|3125542_3125920_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|3126395_3126602_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995491.1|3126676_3126973_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000100847.1|3126978_3127764_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|3127760_3128441_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682300.1|3128437_3128620_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548537.1|3128592_3128784_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001308571.1|3128794_3129076_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000763364.1|3129174_3129393_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488406.1|3129440_3129680_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|3129819_3130056_+	excisionase	NA	NA	NA	NA	NA
WP_000741330.1|3130045_3131188_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	99.4	3.1e-205
WP_000444487.1|3131301_3132552_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248675.1|3132723_3133377_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3133386_3133848_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|3133901_3135008_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3142359:3142374	attR	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
>prophage 6
NZ_CP053080	Escherichia coli strain HB37 chromosome HB37, complete sequence	5307814	3498466	3535947	5307814	head,holin,portal,terminase,lysis,integrase	Enterobacteria_phage(50.0%)	56	3494988:3495002	3536021:3536035
3494988:3495002	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_170171992.1|3498466_3499195_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	67.2	8.3e-79
WP_050575738.1|3499283_3499940_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	76.1	1.1e-87
WP_021518013.1|3499983_3500157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008290.1|3500256_3500898_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000275950.1|3500958_3501279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170172027.1|3501287_3503291_-	injection protein	NA	A0A2I7QW93	Vibrio_phage	36.9	9.9e-98
WP_170171993.1|3503290_3504667_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	57.7	1.4e-119
WP_001461304.1|3504666_3505380_-	hypothetical protein	NA	A0A0A0P253	Enterobacteria_phage	55.7	2.7e-58
WP_170171917.1|3505312_3505702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170171994.1|3505698_3506547_-	hypothetical protein	NA	Q716G6	Shigella_phage	94.7	7.4e-95
WP_102812485.1|3506546_3507965_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.2	3.5e-275
WP_001140510.1|3507974_3508436_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001462613.1|3508416_3508605_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	6.5e-28
WP_000013264.1|3508646_3509900_-	hypothetical protein	NA	A5VW72	Enterobacteria_phage	99.0	1.8e-235
WP_170171995.1|3509918_3510812_-	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	91.9	7.7e-127
WP_170171996.1|3510902_3513101_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.4	0.0e+00
WP_000200779.1|3513102_3514518_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000113732.1|3514514_3514955_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_170171997.1|3514957_3515200_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	97.5	1.9e-35
WP_000191869.1|3515503_3515983_-	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	60.4	1.1e-55
WP_001543881.1|3516064_3516217_-	hypothetical protein	NA	C6ZR68	Salmonella_phage	100.0	1.2e-21
WP_170171998.1|3516204_3516672_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	2.7e-75
WP_080200637.1|3516668_3517145_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	99.4	1.7e-88
WP_000783734.1|3517128_3517452_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_089622057.1|3518128_3518752_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	99.5	2.6e-113
WP_089622058.1|3519389_3519596_-	protein ninH	NA	Q716C0	Shigella_phage	98.5	2.1e-32
WP_001108037.1|3519592_3520204_-	recombination protein NinG	NA	A0A2D1GLP2	Escherichia_phage	99.0	1.3e-98
WP_001543885.1|3520196_3520406_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_170171999.1|3520365_3520767_-	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	97.7	1.0e-70
WP_025748955.1|3520769_3520946_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	1.4e-27
WP_000814617.1|3520942_3521353_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_023351780.1|3521360_3521567_-	hypothetical protein	NA	A0A2I6PIF1	Escherichia_phage	97.1	6.0e-27
WP_078233029.1|3521643_3523524_-	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	99.7	0.0e+00
WP_000067065.1|3523631_3524492_-	replication protein	NA	K7PL20	Enterobacteria_phage	100.0	3.0e-160
WP_000166207.1|3524484_3524631_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000189606.1|3524663_3524960_-	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
WP_000437871.1|3525097_3525298_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_021568302.1|3525398_3526112_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	1.2e-130
WP_000588959.1|3526119_3526557_+	hypothetical protein	NA	C6ZR46	Salmonella_phage	73.1	3.8e-55
WP_000050904.1|3526543_3526915_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	58.3	3.6e-06
WP_000198445.1|3527369_3527753_+	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_170172000.1|3527755_3528118_+	antitermination N domain protein	NA	K7PHE0	Enterobacteria_phage	98.3	2.6e-57
WP_000382838.1|3528148_3528643_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
WP_001183771.1|3528944_3529115_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_170171918.1|3529190_3529361_+	hypothetical protein	NA	A5VWA7	Enterobacteria_phage	98.2	2.1e-25
WP_021556101.1|3529369_3530077_+	hypothetical protein	NA	K7PKU3	Enterobacteria_phage	98.7	7.2e-136
WP_000018646.1|3530077_3530545_+	HNH endonuclease	NA	A0A2I7QWC6	Vibrio_phage	62.0	1.2e-46
WP_000098523.1|3530541_3531048_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_001111278.1|3531061_3531355_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214456.1|3531365_3531530_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_170172028.1|3531526_3532069_+	ead/Ea22-like family protein	NA	Q76H44	Enterobacteria_phage	54.2	4.5e-37
WP_048955281.1|3532065_3532950_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	80.6	1.2e-135
WP_000212745.1|3532951_3533239_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	98.9	3.5e-49
WP_001281200.1|3534230_3534575_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_001303849.1|3534680_3534899_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3534876_3535947_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3536021:3536035	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 7
NZ_CP053080	Escherichia coli strain HB37 chromosome HB37, complete sequence	5307814	4038732	4093790	5307814	protease,plate,transposase	Escherichia_phage(15.38%)	48	NA	NA
WP_000406621.1|4038732_4039419_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024186735.1|4039595_4039874_-	microcin McmA	NA	NA	NA	NA	NA
WP_102804181.1|4041349_4042499_+|transposase	IS3-like element ISEc16 family transposase	transposase	U5P429	Shigella_phage	40.9	4.0e-51
WP_001335133.1|4043376_4044411_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	43.4	1.4e-71
WP_071587598.1|4044691_4044934_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_000273845.1|4045931_4047683_+	NTPase	NA	NA	NA	NA	NA
WP_001297096.1|4047733_4048513_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001298025.1|4048512_4049535_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
WP_089644009.1|4050480_4052011_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	2.8e-44
WP_170172009.1|4052219_4052783_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000120393.1|4055433_4055661_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000266639.1|4055766_4055994_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_170172010.1|4056700_4057003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001335540.1|4058407_4059004_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.4	1.7e-98
WP_000893298.1|4059504_4060758_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_001285288.1|4060769_4061873_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749900.1|4062161_4063217_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
WP_000174703.1|4063255_4063657_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189578.1|4063714_4064959_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291991.1|4065050_4065509_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292999.1|4065769_4067227_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602124.1|4067283_4067898_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001335538.1|4067894_4069046_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.8e-31
WP_001059895.1|4069223_4069676_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263500.1|4069685_4070084_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|4070086_4070380_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226168.1|4070431_4071487_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207578.1|4071557_4072343_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001298188.1|4072287_4074027_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_071778446.1|4074054_4074264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000006241.1|4074346_4074844_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000093934.1|4075019_4075769_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_001225679.1|4076080_4076821_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001298195.1|4076791_4077559_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4077763_4078342_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973131.1|4078581_4081026_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532690.1|4081068_4081542_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118042.1|4081695_4082466_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001298174.1|4082736_4083225_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000227712.1|4083318_4083822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513317.1|4085072_4085363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528851.1|4085337_4086777_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_170172011.1|4086769_4087816_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000053624.1|4087922_4089905_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	1.6e-23
WP_001142963.1|4090125_4090644_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000041480.1|4091349_4091853_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000111582.1|4091875_4093360_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001189667.1|4093364_4093790_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 8
NZ_CP053080	Escherichia coli strain HB37 chromosome HB37, complete sequence	5307814	4354593	4430734	5307814	holin,portal,terminase,protease,lysis,integrase,tail,tRNA	Enterobacteria_phage(43.4%)	83	4385842:4385861	4430965:4430984
WP_001223137.1|4354593_4355280_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001295754.1|4355679_4355820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4355915_4356632_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920364.1|4356691_4358044_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219582.1|4358101_4359526_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
WP_001188687.1|4359525_4360215_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4360227_4360701_-	protein CreA	NA	NA	NA	NA	NA
WP_000371658.1|4360910_4361780_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942350.1|4361776_4362424_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001350367.1|4362475_4363003_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000068677.1|4363075_4363402_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409429.1|4363491_4365429_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046754.1|4365635_4367303_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000007436.1|4367358_4367643_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001298496.1|4367644_4367977_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000093832.1|4368068_4369301_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.3	2.7e-82
WP_001298501.1|4369321_4370704_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132964.1|4370752_4371721_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000105872.1|4372497_4373514_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566144.1|4373545_4373788_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224879.1|4373969_4374689_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816460.1|4374745_4375969_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477849.1|4376020_4377343_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001298497.1|4377420_4378200_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143234.1|4378457_4380008_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088372.1|4379979_4380843_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563047.1|4381059_4381839_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001298490.1|4381835_4382909_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4383030_4383192_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4383318_4383924_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4384316_4385903_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
4385842:4385861	attL	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
WP_001217549.1|4386122_4386371_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	4.1e-38
WP_000415965.1|4386428_4386656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355361.1|4389231_4389525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021518115.1|4389812_4391873_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
WP_021518114.1|4391931_4395414_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_032143682.1|4395474_4396122_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	3.0e-112
WP_000194752.1|4396019_4396763_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.2e-151
WP_001152410.1|4396768_4397467_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.9e-133
WP_000447254.1|4397476_4397806_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
WP_000372054.1|4397805_4400871_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
WP_001161009.1|4400842_4401172_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|4401180_4401567_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211128.1|4401627_4402371_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298485.1|4402381_4402783_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	1.6e-71
WP_000677099.1|4402779_4403358_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	2.1e-101
WP_001283153.1|4403369_4403645_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|4403637_4403961_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136583.1|4404047_4406075_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_072134767.1|4406019_4407600_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001072975.1|4407527_4407740_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934116.1|4407736_4409839_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_000373423.1|4409838_4410333_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_001205132.1|4410690_4410873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084843.1|4410971_4411346_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	87.9	2.5e-55
WP_001298489.1|4411384_4411828_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	93.9	1.5e-70
WP_001197768.1|4411824_4412301_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
WP_001120490.1|4412304_4412631_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_000799673.1|4412707_4413760_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
WP_000917727.1|4413910_4414114_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
WP_000868396.1|4414378_4415305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131905.1|4415291_4415840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|4415852_4416194_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001540821.1|4416211_4417201_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001061422.1|4417208_4418051_-	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
WP_000767113.1|4418070_4418460_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210180.1|4418456_4418783_-	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
WP_000066917.1|4418779_4419433_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001315196.1|4419432_4419927_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_000061519.1|4419923_4420742_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_000933943.1|4420738_4420975_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.7	2.7e-39
WP_001087311.1|4420967_4421804_-	ash family protein	NA	Q8SBF3	Shigella_phage	92.4	1.1e-138
WP_000515840.1|4421800_4422352_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
WP_001191672.1|4422344_4422605_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	9.3e-41
WP_001298691.1|4422702_4423395_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	7.3e-125
WP_000500990.1|4423710_4424223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|4424691_4425054_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081256.1|4425119_4425944_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000008232.1|4426071_4426608_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_001242728.1|4426598_4426961_+	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
WP_000206728.1|4426960_4427581_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.6	1.2e-118
WP_000653746.1|4428148_4429144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218287.1|4429519_4430734_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
4430965:4430984	attR	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
>prophage 1
NZ_CP053083	Escherichia coli strain HB37 plasmid pHB37-3, complete sequence	56716	9855	11867	56716		Escherichia_phage(33.33%)	6	NA	NA
WP_023225990.1|9855_10293_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	34.7	1.6e-13
WP_000206710.1|10423_10744_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	90.3	2.3e-25
WP_023225989.1|10754_11018_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	2.0e-30
WP_023225988.1|11019_11217_-	hypothetical protein	NA	A0A0F6R8N3	Escherichia_coli_O157_typing_phage	91.8	8.3e-26
WP_000224733.1|11218_11413_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	93.3	5.1e-28
WP_023225987.1|11393_11867_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	57.7	1.1e-15
