The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053032	Halomonas sp. PGE1 chromosome, complete genome	3905792	1541956	1581547	3905792	protease,tRNA,transposase,integrase	Pseudomonas_phage(28.57%)	32	1543749:1543768	1589723:1589742
WP_119020722.1|1541956_1543087_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_169957817.1|1543159_1543609_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_169957818.1|1543605_1544244_-	pseudouridine synthase	NA	NA	NA	NA	NA
1543749:1543768	attL	TGGCCACGCGCACCAGGCGC	NA	NA	NA	NA
WP_169957819.1|1544527_1546762_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_169957820.1|1546996_1547347_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	4.2e-12
WP_169957821.1|1547491_1549768_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.6	7.9e-168
WP_027961652.1|1549861_1550080_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_169957822.1|1550201_1550939_-	arginyltransferase	NA	NA	NA	NA	NA
WP_110068225.1|1550935_1551712_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_169957823.1|1555414_1556044_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_169957824.1|1556191_1557535_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	36.4	4.9e-61
WP_169957825.1|1557712_1558261_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_169957826.1|1558403_1559183_+	glutamate racemase	NA	NA	NA	NA	NA
WP_169957827.1|1559228_1560356_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	A0A2K5B251	Erysipelothrix_phage	30.4	3.8e-14
WP_169957828.1|1560533_1565372_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_169957829.1|1565491_1566517_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_110068206.1|1566623_1566830_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_169957830.1|1567074_1569279_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_169957831.1|1569275_1569623_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_110068203.1|1569627_1569909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169957832.1|1570002_1571184_+	4-phosphoerythronate dehydrogenase PdxB	NA	NA	NA	NA	NA
WP_169959508.1|1571760_1572231_+	HNH endonuclease	NA	A0A125RNK0	Pseudomonas_phage	44.3	1.4e-10
WP_169957833.1|1572313_1572778_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_169959509.1|1572916_1573339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169957834.1|1573441_1574542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169957835.1|1574534_1575029_+	threonine transporter	NA	NA	NA	NA	NA
WP_169957836.1|1575033_1576896_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_169957837.1|1577130_1577988_+|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	27.4	5.6e-26
WP_169957838.1|1577980_1578214_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_169957839.1|1578238_1578724_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_169957840.1|1579182_1580358_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.1	2.9e-25
WP_169957841.1|1580290_1581547_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
1589723:1589742	attR	TGGCCACGCGCACCAGGCGC	NA	NA	NA	NA
>prophage 2
NZ_CP053032	Halomonas sp. PGE1 chromosome, complete genome	3905792	2510816	2569419	3905792	transposase,integrase	Trichoplusia_ni_ascovirus(12.5%)	54	2511089:2511105	2557632:2557648
WP_169958518.1|2510816_2511104_-|transposase	transposase	transposase	NA	NA	NA	NA
2511089:2511105	attL	TGCTGGGTAAGATCAAT	NA	NA	NA	NA
WP_169958519.1|2511530_2511791_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_169958520.1|2511962_2512220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169958521.1|2512216_2512480_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_169958522.1|2512476_2512836_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_169958523.1|2513050_2513884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169958524.1|2513880_2516247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169958525.1|2516237_2518625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169959561.1|2518731_2519094_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_169959562.1|2520688_2522074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169958526.1|2522214_2523717_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_169958527.1|2523748_2524249_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_169958528.1|2524346_2525336_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_169958529.1|2525594_2526797_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_169958530.1|2526824_2528492_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_169958531.1|2528607_2529570_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_169958532.1|2529584_2530346_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_169958533.1|2530383_2531607_-	CoA transferase	NA	NA	NA	NA	NA
WP_169958534.1|2531648_2533178_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_169958535.1|2533177_2533969_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_169958536.1|2534219_2535074_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169958537.1|2535125_2536280_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_169958538.1|2536396_2537290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169958539.1|2537454_2538168_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.1	2.1e-10
WP_169958540.1|2538346_2539849_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_169958541.1|2539880_2540381_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_169958542.1|2540476_2541466_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_169958543.1|2542570_2543758_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	56.0	1.2e-98
WP_169959563.1|2543952_2545047_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.2e-18
WP_169959564.1|2545058_2545721_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169958544.1|2545736_2547593_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_169958545.1|2547651_2549367_+	O-antigen ligase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_169958546.1|2549482_2549953_-	pilin	NA	NA	NA	NA	NA
WP_169958547.1|2550114_2550411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169958548.1|2550391_2550895_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_169959565.1|2550873_2550957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169958549.1|2551275_2551482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169958550.1|2551478_2552126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169958551.1|2552122_2553688_+	DEAD/DEAH box helicase family protein	NA	I4AZM6	Saccharomonospora_phage	30.0	1.9e-32
WP_169959566.1|2553847_2554693_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_169958552.1|2554796_2556071_-	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_169958553.1|2556109_2557327_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_169958554.1|2557744_2558920_-	hypothetical protein	NA	NA	NA	NA	NA
2557632:2557648	attR	ATTGATCTTACCCAGCA	NA	NA	NA	NA
WP_169958555.1|2559001_2560183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169958556.1|2560358_2561060_-	acylneuraminate cytidylyltransferase family protein	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	36.0	5.4e-11
WP_169958557.1|2561049_2562105_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_169958558.1|2562112_2562772_-	acetyltransferase	NA	NA	NA	NA	NA
WP_169958559.1|2562768_2563845_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_169958560.1|2563841_2565008_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_169958561.1|2565007_2566165_-	LegC family aminotransferase	NA	A0A2K9L470	Tupanvirus	27.8	2.1e-28
WP_169958562.1|2566173_2567160_-	SDR family NAD(P)-dependent oxidoreductase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	33.0	3.8e-26
WP_169958563.1|2567166_2568459_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_169958564.1|2568542_2568875_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_169958565.1|2568987_2569419_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	29.7	3.0e-12
>prophage 3
NZ_CP053032	Halomonas sp. PGE1 chromosome, complete genome	3905792	2905308	2949173	3905792	protease,transposase	Paenibacillus_phage(25.0%)	45	NA	NA
WP_169958781.1|2905308_2906166_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_169958782.1|2906348_2907353_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_169958783.1|2907354_2908275_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_169958784.1|2908350_2909220_-	DMT family transporter	NA	NA	NA	NA	NA
WP_169958785.1|2909313_2909817_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_169958786.1|2909993_2910410_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_169958787.1|2910950_2911325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169958788.1|2911383_2912175_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169958789.1|2912377_2915569_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_169958790.1|2915612_2917091_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_169958791.1|2917192_2917489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169958792.1|2917768_2918380_+	OmpW family protein	NA	NA	NA	NA	NA
WP_169958793.1|2918594_2919179_+	OmpW family protein	NA	NA	NA	NA	NA
WP_169958794.1|2919382_2920030_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_169958795.1|2920239_2920572_-	YqcC family protein	NA	NA	NA	NA	NA
WP_110070477.1|2920890_2921916_+	DUF3549 family protein	NA	NA	NA	NA	NA
WP_110070484.1|2921941_2922379_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_110070476.1|2922419_2923328_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D8KN85	Synechococcus_phage	33.8	1.7e-36
WP_110070475.1|2923440_2923884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110070483.1|2923973_2924687_-	YdcF family protein	NA	NA	NA	NA	NA
WP_110070474.1|2924757_2925330_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_169959603.1|2925338_2926556_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.7e-100
WP_169958796.1|2926620_2927967_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_119020589.1|2927963_2928716_-	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.1	1.0e-10
WP_169958797.1|2928748_2930191_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_110070469.1|2930259_2930724_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_119020591.1|2930928_2931270_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_169958798.1|2931411_2932320_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_169958799.1|2932367_2933006_+	DsbA family protein	NA	NA	NA	NA	NA
WP_169958800.1|2933036_2933570_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_169958801.1|2933646_2935230_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_169958802.1|2935289_2935856_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_119020598.1|2936108_2936393_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_119020599.1|2936538_2937027_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_119020600.1|2937200_2937959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169959604.1|2938006_2938492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169958803.1|2938694_2939960_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_119020602.1|2940168_2940417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169958804.1|2940531_2941437_-	ribose-phosphate diphosphokinase	NA	K4F7H8	Cronobacter_phage	26.7	1.5e-08
WP_169958805.1|2941438_2943016_-	thymidine phosphorylase family protein	NA	NA	NA	NA	NA
WP_169958806.1|2943154_2943904_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	2.4e-28
WP_062376034.1|2945299_2946553_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.0	1.1e-99
WP_169958807.1|2946775_2947378_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_169958808.1|2947526_2947874_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.9	4.9e-29
WP_169958809.1|2947916_2949173_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	25.5	2.8e-10
>prophage 4
NZ_CP053032	Halomonas sp. PGE1 chromosome, complete genome	3905792	3004182	3014902	3905792		Acinetobacter_phage(42.86%)	8	NA	NA
WP_169958839.1|3004182_3005232_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	45.5	3.4e-25
WP_169958840.1|3005228_3006476_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_169958841.1|3006472_3009253_-	N-6 DNA methylase	NA	A0A2H4PQP4	Staphylococcus_phage	36.5	2.6e-72
WP_169958842.1|3009431_3010241_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	51.9	2.4e-63
WP_169959607.1|3010302_3011328_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	54.3	9.5e-97
WP_169958843.1|3011344_3011929_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.4	4.2e-65
WP_169959608.1|3011945_3013442_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	35.1	1.7e-41
WP_169958844.1|3013714_3014902_-	phosphoglycolate phosphatase	NA	Q06VJ4	Trichoplusia_ni_ascovirus	40.3	4.4e-05
>prophage 5
NZ_CP053032	Halomonas sp. PGE1 chromosome, complete genome	3905792	3078155	3129373	3905792	protease,transposase,tRNA	Vibrio_phage(18.18%)	42	NA	NA
WP_169958882.1|3078155_3079040_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_169958883.1|3079040_3080285_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_169958884.1|3080419_3081748_-	GTPase HflX	NA	NA	NA	NA	NA
WP_110069332.1|3081756_3082005_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_169958885.1|3082128_3083067_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_119021648.1|3083227_3085183_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.7	6.7e-91
WP_169958886.1|3085203_3086649_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	27.2	8.3e-14
WP_169959610.1|3086645_3087164_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_169958887.1|3087144_3088662_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_169958888.1|3088760_3089855_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_169958889.1|3089856_3090450_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	36.0	1.1e-28
WP_169958890.1|3090553_3091591_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_169958891.1|3091641_3092472_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_169958892.1|3092493_3093345_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_169957516.1|3093498_3094539_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_169958893.1|3094905_3095892_-	EF-P lysine aminoacylase GenX	NA	A0A2K9KZX5	Tupanvirus	27.4	7.9e-24
WP_169958894.1|3095992_3096559_-	elongation factor P	NA	NA	NA	NA	NA
WP_169958895.1|3096674_3097709_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_169957516.1|3097884_3098925_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_169958896.1|3099264_3100980_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_169958897.1|3101338_3102172_-	ion transporter	NA	NA	NA	NA	NA
WP_119021660.1|3102177_3103398_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_169958898.1|3103455_3105717_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	6.8e-87
WP_119021662.1|3105984_3107865_-	DNA topoisomerase IV subunit B	NA	A0A127AW23	Bacillus_phage	31.0	1.3e-67
WP_169958899.1|3107861_3108509_-	esterase	NA	NA	NA	NA	NA
WP_169958900.1|3108537_3110220_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_169958901.1|3110305_3111073_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_169958902.1|3111075_3112068_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_169958903.1|3112064_3112739_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_169958904.1|3113034_3114483_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.9	3.4e-31
WP_169958905.1|3114482_3115376_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_119023621.1|3115562_3116297_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_169958906.1|3116353_3116800_-	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
WP_169958907.1|3116829_3117471_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	38.1	8.5e-27
WP_169958908.1|3117551_3118199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169958909.1|3118371_3118911_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_169958910.1|3118924_3120010_-	methyltransferase	NA	NA	NA	NA	NA
WP_169958911.1|3120006_3120852_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_169958912.1|3120893_3122399_-	amidase	NA	NA	NA	NA	NA
WP_110070903.1|3124731_3126030_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.0	1.1e-28
WP_169959542.1|3126728_3127871_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	56.3	2.8e-113
WP_169959611.1|3128053_3129373_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	1.3e-29
