The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019929	Bordetella avium strain 14-4061 chromosome, complete genome	3836621	1392462	1443206	3836621	head,tail,terminase,integrase,protease,tRNA,portal,capsid	Pseudomonas_phage(21.74%)	53	1402340:1402354	1417144:1417158
WP_119536594.1|1392462_1395324_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	3.3e-70
WP_039052066.1|1395313_1396279_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_119536631.1|1396327_1396996_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.3	5.2e-27
WP_119536595.1|1397035_1398499_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_169512726.1|1398505_1398871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012417097.1|1399121_1400330_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_119536596.1|1400326_1402579_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.3	5.9e-107
1402340:1402354	attL	TATGGCCGTCGCCAG	NA	NA	NA	NA
WP_119536597.1|1402934_1404857_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_119653330.1|1404853_1405744_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_119536599.1|1405750_1406884_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_012417102.1|1406883_1407705_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_012417103.1|1407728_1408919_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_127815019.1|1409250_1410459_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	61.6	1.8e-131
WP_127815020.1|1410794_1411526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127815021.1|1411550_1412048_-	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	63.0	3.6e-57
WP_119651390.1|1412047_1412326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127815022.1|1412322_1412907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041937512.1|1413039_1414056_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	47.8	2.2e-61
WP_127815328.1|1414067_1414907_-	exonuclease VIII	NA	V5YTC9	Pseudomonas_phage	32.2	1.6e-38
WP_012416093.1|1414926_1415112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119651373.1|1415108_1415396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127815023.1|1415457_1415811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127815024.1|1417054_1417519_-	hypothetical protein	NA	NA	NA	NA	NA
1417144:1417158	attR	TATGGCCGTCGCCAG	NA	NA	NA	NA
WP_012417110.1|1418053_1418608_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_012417112.1|1419290_1419653_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_127812204.1|1420278_1420644_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_127815025.1|1420992_1421241_-	bssS family protein	NA	NA	NA	NA	NA
WP_012416105.1|1421470_1421935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127815026.1|1422179_1422998_+	YdaU family protein	NA	A0A2I7RHJ6	Vibrio_phage	47.7	3.7e-19
WP_012416108.1|1422984_1423683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127812207.1|1423816_1424179_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	50.0	1.0e-21
WP_127812208.1|1424189_1424573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127812209.1|1424569_1425160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127812210.1|1425361_1425844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127812211.1|1426206_1426989_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	74.6	2.2e-114
WP_127815027.1|1427526_1427805_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	59.2	1.0e-08
WP_012417133.1|1427791_1428058_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_012417134.1|1428238_1428622_+	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	55.6	7.0e-29
WP_012417135.1|1428816_1429299_+|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	64.6	2.7e-54
WP_039052220.1|1429302_1431027_+|terminase	terminase large subunit	terminase	A4JWZ7	Burkholderia_virus	80.5	7.0e-278
WP_012417137.1|1431028_1431184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012417138.1|1431180_1432413_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	66.8	1.2e-154
WP_012417139.1|1432421_1433039_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	61.8	5.1e-61
WP_012417140.1|1433051_1434275_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	59.3	3.6e-135
WP_039052222.1|1434312_1434633_+|head,tail	phage head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	36.5	3.8e-12
WP_012417142.1|1434643_1434982_+|head	phage head closure protein	head	Q3HQT3	Burkholderia_phage	39.3	9.3e-09
WP_012417143.1|1434978_1435473_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_012417144.1|1435465_1435816_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_039052219.1|1435815_1436256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012417146.1|1436327_1436975_+|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	52.1	3.9e-56
WP_012417147.1|1437008_1437326_+	hypothetical protein	NA	A0A0S2SYT8	Pseudomonas_phage	48.6	5.6e-24
WP_119649675.1|1437388_1437634_+	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_041937514.1|1437668_1443206_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	34.0	8.8e-72
>prophage 2
NZ_CP019929	Bordetella avium strain 14-4061 chromosome, complete genome	3836621	1457421	1466163	3836621	protease	Lake_Baikal_phage(16.67%)	7	NA	NA
WP_012417171.1|1457421_1457628_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.1	1.1e-15
WP_012417172.1|1457697_1458276_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	34.3	1.8e-23
WP_012417173.1|1458455_1459766_+	trigger factor	NA	NA	NA	NA	NA
WP_012417174.1|1459768_1460422_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	7.5e-55
WP_012417175.1|1460525_1461824_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	1.8e-129
WP_012417176.1|1461998_1464431_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	2.5e-220
WP_012417177.1|1464666_1466163_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	28.5	4.1e-16
>prophage 3
NZ_CP019929	Bordetella avium strain 14-4061 chromosome, complete genome	3836621	2030369	2041403	3836621	tRNA	uncultured_Mediterranean_phage(25.0%)	12	NA	NA
WP_114851977.1|2030369_2031800_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.4	1.4e-29
WP_012417643.1|2031912_2032461_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_012417644.1|2032564_2033344_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_012417645.1|2033340_2034192_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	40.3	9.2e-13
WP_012417646.1|2034209_2035004_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.7	1.3e-32
WP_012417647.1|2034988_2035747_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	6.2e-69
WP_012417648.1|2035916_2036555_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_114851975.1|2036707_2037745_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	52.9	9.0e-95
WP_114851974.1|2037843_2039136_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	5.8e-67
WP_012417651.1|2039289_2040303_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_114851972.1|2040414_2040798_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	27.6	1.5e-10
WP_114852034.1|2040800_2041403_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.6	7.4e-17
>prophage 4
NZ_CP019929	Bordetella avium strain 14-4061 chromosome, complete genome	3836621	2192997	2202519	3836621	integrase	Bordetella_phage(60.0%)	12	2190718:2190732	2201829:2201843
2190718:2190732	attL	ATGAAATCGACGCCG	NA	NA	NA	NA
WP_127815071.1|2192997_2194080_-|integrase	site-specific integrase	integrase	A4PE72	Ralstonia_virus	38.9	3.4e-60
WP_127815072.1|2194302_2194488_-	conjugal transfer protein TraR	NA	A0A2D0W9R7	Bordetella_phage	55.6	1.7e-12
WP_127815073.1|2194490_2194976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169512731.1|2194972_2196406_-	DEAD/DEAH box helicase	NA	Q774Z8	Bordetella_phage	68.2	1.7e-184
WP_127815074.1|2196402_2196876_-	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	59.5	6.2e-51
WP_127815075.1|2196905_2197277_-	VRR-NUC domain-containing protein	NA	Q775A2	Bordetella_phage	56.1	7.5e-28
WP_127815076.1|2197367_2199536_-	DNA polymerase I	NA	Q775A3	Bordetella_phage	68.3	2.9e-281
WP_127815331.1|2199532_2199733_-	hypothetical protein	NA	Q775A4	Bordetella_phage	60.4	2.2e-13
WP_127815077.1|2199941_2200391_-	hypothetical protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	68.3	2.4e-36
WP_127815078.1|2200401_2200995_-	DUF2815 family protein	NA	Q6J1N9	Burkholderia_virus	45.3	6.8e-31
WP_127815079.1|2201008_2201215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127815080.1|2201211_2202519_-	DUF2800 domain-containing protein	NA	Q775A7	Bordetella_phage	65.2	7.2e-150
2201829:2201843	attR	CGGCGTCGATTTCAT	NA	NA	NA	NA
>prophage 5
NZ_CP019929	Bordetella avium strain 14-4061 chromosome, complete genome	3836621	2205622	2239801	3836621	head,protease,tail,terminase	Bordetella_phage(58.62%)	31	NA	NA
WP_127815087.1|2205622_2206015_-	hypothetical protein	NA	C7BGF7	Burkholderia_phage	47.3	1.1e-16
WP_127815088.1|2206128_2206380_+	helix-turn-helix domain-containing protein	NA	A0A0R6PJ81	Moraxella_phage	43.8	2.1e-05
WP_127815089.1|2206376_2207411_+	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	58.7	6.2e-104
WP_127815090.1|2207407_2209681_+	replication protein	NA	B6SD24	Bacteriophage	55.6	3.5e-123
WP_127815091.1|2209868_2210108_+	hypothetical protein	NA	Q775B7	Bordetella_phage	45.5	4.9e-12
WP_127815092.1|2210168_2210705_+|terminase	terminase	terminase	Q775B8	Bordetella_phage	54.5	1.3e-36
WP_164855667.1|2210701_2212312_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	78.9	1.7e-257
WP_127815093.1|2212352_2212817_+	GNAT family N-acetyltransferase	NA	Q775C0	Bordetella_phage	57.5	1.5e-41
WP_127815094.1|2212813_2213278_+	hypothetical protein	NA	Q775C1	Bordetella_phage	64.3	7.7e-46
WP_127815095.1|2213280_2213688_+	hypothetical protein	NA	Q775C2	Bordetella_phage	77.3	1.0e-09
WP_127815096.1|2213697_2215362_+|head,tail	phage head-tail adapter protein	head,tail	T1S9Z7	Salmonella_phage	46.4	7.6e-136
WP_127815097.1|2215373_2215706_+	hypothetical protein	NA	Q775C4	Bordetella_phage	77.1	1.2e-37
WP_127815098.1|2215749_2216094_+	endopeptidase	NA	Q775C5	Bordetella_phage	52.2	1.5e-22
WP_127815099.1|2216053_2216737_+|protease	protease	protease	Q775C6	Bordetella_phage	58.1	5.4e-40
WP_127815100.1|2216749_2217763_+	hypothetical protein	NA	Q6J1R9	Burkholderia_virus	71.4	9.0e-140
WP_127815101.1|2217783_2218227_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	43.3	2.4e-20
WP_127815102.1|2218237_2218426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127815103.1|2218504_2219146_+	hypothetical protein	NA	Q775D0	Bordetella_phage	60.1	7.1e-66
WP_127815104.1|2219145_2221194_+	hypothetical protein	NA	Q775D1	Bordetella_phage	80.8	0.0e+00
WP_127815105.1|2221971_2224944_+	hypothetical protein	NA	Q858G0	Salmonella_phage	25.0	1.4e-47
WP_127815106.1|2224943_2226782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127815107.1|2226774_2229228_+	hypothetical protein	NA	A0A2H4J9B2	uncultured_Caudovirales_phage	42.8	1.0e-176
WP_127815108.1|2229287_2230808_+	hypothetical protein	NA	Q775D5	Bordetella_phage	46.3	5.3e-43
WP_127815109.1|2230823_2231984_+	hypothetical protein	NA	G8CLA7	Synechococcus_phage	38.6	3.0e-46
WP_127815110.1|2232012_2232387_+	diversity-generating retroelement protein Avd	NA	Q775D7	Bordetella_phage	87.9	6.4e-59
WP_127815111.1|2232671_2233658_+	Retron-type reverse transcriptase	NA	Q775D8	Bordetella_phage	64.5	4.8e-130
WP_127815112.1|2234138_2234387_+	hypothetical protein	NA	Q775E0	Bordetella_phage	74.7	5.0e-28
WP_127815113.1|2234386_2234884_+	glycoside hydrolase family 108 protein	NA	Q775E1	Bordetella_phage	71.8	2.1e-65
WP_164855668.1|2234886_2235510_+	hypothetical protein	NA	Q775E2	Bordetella_phage	80.5	2.0e-65
WP_127812357.1|2237240_2238398_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.4	1.8e-11
WP_082011639.1|2238313_2239801_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.6	2.1e-20
>prophage 6
NZ_CP019929	Bordetella avium strain 14-4061 chromosome, complete genome	3836621	2466138	2493772	3836621	head,tail,terminase,integrase,protease	Bordetella_phage(63.64%)	33	2459648:2459662	2496355:2496369
2459648:2459662	attL	AATCAAAAAATGCCT	NA	NA	NA	NA
WP_119647740.1|2466138_2466531_-	hypothetical protein	NA	L0MXF6	Edwardsiella_phage	40.3	1.1e-05
WP_119651456.1|2466536_2467649_-|tail	phage tail protein	tail	Q775D5	Bordetella_phage	67.3	1.5e-50
WP_164855670.1|2467809_2471199_-	hypothetical protein	NA	M1IDU6	Pelagibacter_phage	24.1	2.8e-52
WP_127815127.1|2471185_2472781_-	hypothetical protein	NA	W6MYA2	Pseudomonas_phage	28.6	3.3e-19
WP_012416124.1|2472792_2473386_-	phage protein	NA	Q775D2	Bordetella_phage	45.8	3.5e-19
WP_012416123.1|2473397_2475443_-	hypothetical protein	NA	Q775D1	Bordetella_phage	93.7	0.0e+00
WP_012416122.1|2475442_2476114_-	hypothetical protein	NA	Q775D0	Bordetella_phage	93.2	2.1e-116
WP_012416121.1|2476188_2476389_-	hypothetical protein	NA	Q775C9	Bordetella_phage	79.4	7.9e-24
WP_012416120.1|2476401_2476824_-	hypothetical protein	NA	Q775C8	Bordetella_phage	82.1	3.3e-56
WP_039052162.1|2476842_2477838_-	phage protein	NA	Q775C7	Bordetella_phage	97.6	4.5e-184
WP_164855694.1|2477851_2478526_-|protease	protease	protease	Q775C6	Bordetella_phage	82.1	2.1e-84
WP_012416117.1|2478500_2478848_-	hypothetical protein	NA	Q775C5	Bordetella_phage	89.6	3.1e-52
WP_127815129.1|2478934_2480602_-|head,tail	phage head-tail adapter protein	head,tail	T1S9Z7	Salmonella_phage	46.0	2.4e-134
WP_127815130.1|2480984_2481443_-	hypothetical protein	NA	Q775C1	Bordetella_phage	90.8	8.3e-69
WP_041937483.1|2481439_2481904_-	GNAT family N-acetyltransferase	NA	Q775C0	Bordetella_phage	93.5	8.7e-74
WP_164855671.1|2481947_2483480_-|terminase	terminase	terminase	Q775B9	Bordetella_phage	75.5	2.7e-236
WP_119647729.1|2483485_2484061_-|terminase	terminase	terminase	Q775B8	Bordetella_phage	85.6	4.2e-78
WP_012416110.1|2484079_2484346_-	hypothetical protein	NA	Q775B7	Bordetella_phage	84.2	1.2e-27
WP_127815131.1|2484506_2485136_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	49.4	2.8e-30
WP_012417122.1|2485132_2485615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127815132.1|2485611_2486580_-	YdaU family protein	NA	A0A2H4FS76	Methylophilaceae_phage	41.8	1.1e-14
WP_127815133.1|2486579_2486789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119647723.1|2486790_2487105_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_164855672.1|2487140_2487305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114852948.1|2487375_2487624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119529931.1|2488034_2488988_+	LexA family transcriptional regulator	NA	B5TK58	Pseudomonas_phage	26.1	2.2e-10
WP_127815134.1|2489221_2490049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119536246.1|2490340_2491132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039052263.1|2491830_2492157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119529935.1|2492257_2492542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114852954.1|2492538_2493024_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_114852955.1|2493146_2493533_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	57.4	2.0e-07
WP_114852956.1|2493580_2493772_-|integrase	integrase	integrase	NA	NA	NA	NA
2496355:2496369	attR	AGGCATTTTTTGATT	NA	NA	NA	NA
>prophage 7
NZ_CP019929	Bordetella avium strain 14-4061 chromosome, complete genome	3836621	2763505	2799178	3836621	head,plate,lysis,tail,terminase,integrase,holin,tRNA,portal,capsid	Burkholderia_phage(26.92%)	41	2763293:2763317	2793501:2793525
2763293:2763317	attL	TTGGCGGAGACGGTGGGATTCGAAC	NA	NA	NA	NA
WP_127815158.1|2763505_2764546_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	41.4	1.4e-71
WP_127815159.1|2764547_2765174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127815160.1|2765743_2766814_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	60.1	2.5e-116
WP_127815338.1|2766813_2768562_-|terminase	terminase	terminase	A4JWQ1	Burkholderia_virus	64.9	9.5e-214
WP_127815161.1|2768720_2769578_+|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	45.1	5.4e-53
WP_127815162.1|2769607_2770648_+|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	56.7	1.8e-106
WP_127815163.1|2770647_2771418_+|integrase	integrase	integrase	A4PE31	Ralstonia_virus	40.7	5.4e-36
WP_127815164.1|2771511_2771979_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	52.2	5.4e-31
WP_164855675.1|2771978_2772185_+|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	57.6	8.1e-16
WP_127815165.1|2772189_2772552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127815166.1|2772548_2772848_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_127815167.1|2772840_2773647_+	DUF3380 domain-containing protein	NA	E5E3R7	Burkholderia_phage	57.1	8.3e-72
WP_164855676.1|2773643_2774090_+|lysis	LysB family phage lysis regulatory protein	lysis	NA	NA	NA	NA
WP_127815169.1|2774164_2774668_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	39.4	1.5e-23
WP_127815170.1|2774660_2775125_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	51.7	8.0e-35
WP_127815171.1|2775186_2775813_+|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	48.7	5.1e-45
WP_127815340.1|2775824_2776166_+	GPW/gp25 family protein	NA	K4PAX6	Burkholderia_phage	49.1	2.5e-17
WP_127815172.1|2776167_2777085_+|plate	baseplate J/gp47 family protein	plate	A0A077K9X9	Ralstonia_phage	54.4	2.8e-76
WP_164855677.1|2777086_2777707_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	57.0	8.1e-51
WP_127815174.1|2779084_2779267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127815175.1|2779390_2780572_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	66.4	2.1e-148
WP_127815176.1|2780628_2781144_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	57.9	1.4e-51
WP_127815177.1|2781168_2781537_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	46.2	6.6e-16
WP_127815178.1|2781545_2781662_+|tail	GpE family phage tail protein	tail	E5FFG6	Burkholderia_phage	78.8	3.0e-07
WP_127815179.1|2781665_2784404_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	43.0	1.1e-171
WP_127815180.1|2784416_2784872_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	50.4	1.2e-32
WP_127815181.1|2784871_2785975_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	48.8	4.9e-83
WP_127815182.1|2786402_2786801_-	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	56.6	9.6e-13
WP_127815183.1|2786903_2787128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127815341.1|2787133_2787406_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_127815184.1|2787395_2787797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127815185.1|2787878_2788112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127815186.1|2788361_2788646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127815187.1|2788647_2791461_+	toprim domain-containing protein	NA	K4NXL6	Burkholderia_phage	48.7	4.3e-248
WP_127815188.1|2791776_2792034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164855678.1|2792043_2793423_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	36.0	1.9e-63
WP_012418211.1|2793670_2794930_-	aspartate kinase	NA	NA	NA	NA	NA
2793501:2793525	attR	TTGGCGGAGACGGTGGGATTCGAAC	NA	NA	NA	NA
WP_169512745.1|2795022_2795997_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_012418213.1|2796066_2797032_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_012418214.1|2797068_2797713_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_012418215.1|2797726_2799178_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	33.3	1.0e-35
