The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048920	Escherichia coli strain SCU-101 chromosome, complete genome	5357129	906512	972696	5357129	transposase,lysis,protease	Stx2-converting_phage(40.0%)	59	NA	NA
WP_000997995.1|906512_908051_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|909178_909529_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|909525_909951_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_001149834.1|910612_911530_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|911563_912439_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|912487_913960_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948501.1|913963_914794_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|914839_915550_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|915562_916672_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001328061.1|916721_917657_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|917692_918427_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|918526_919513_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_000074482.1|919671_920865_-	MFS transporter	NA	NA	NA	NA	NA
WP_001299620.1|921000_922725_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287497.1|922725_923673_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015709.1|923672_925415_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750139.1|925411_926749_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_016265865.1|926754_928950_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|929500_929644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034089.1|929893_933781_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	8.8e-228
WP_000291745.1|933827_934409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309734.1|934746_935181_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|935177_935528_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001223352.1|939276_941367_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001363144.1|942228_942471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322947.1|942558_942750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001443103.1|942761_943130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266543.1|943133_943349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021561142.1|943901_944330_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109148.1|944369_944930_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|944971_945232_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|947057_947171_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001309729.1|949037_949259_-	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
WP_000930062.1|949675_949990_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_021561141.1|950196_950742_+	P fimbria major subunit PapA	NA	NA	NA	NA	NA
WP_001350743.1|950804_951392_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_019842854.1|951450_953961_+	PapC/FimD family outer membrane usher protein	NA	NA	NA	NA	NA
WP_000265730.1|954031_954766_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001519114.1|954802_955384_+	protein prsJ	NA	NA	NA	NA	NA
WP_169711403.1|955393_955930_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001519115.1|955956_956481_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001519117.1|956556_957060_+	P fimbrial tip protein PapF	NA	NA	NA	NA	NA
WP_001519118.1|957103_958111_+	P fimbria tip G-adhesin PapG-III	NA	NA	NA	NA	NA
WP_001519119.1|958373_958925_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297096.1|960212_960992_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255956.1|960991_962014_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001519124.1|962922_963174_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	96.3	5.2e-41
WP_001519125.1|963170_963551_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	9.3e-66
WP_001519129.1|964181_964505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169711404.1|965116_965803_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_169711405.1|965902_966361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519131.1|966818_967367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519132.1|967385_967730_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	39.7	1.0e-07
WP_000258195.1|967726_967900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153274641.1|968035_968209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519134.1|968623_969058_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_153276072.1|969474_970044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519135.1|970144_971377_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_085962211.1|971527_972696_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 2
NZ_CP048920	Escherichia coli strain SCU-101 chromosome, complete genome	5357129	1299994	1307134	5357129		Escherichia_phage(83.33%)	6	NA	NA
WP_001279001.1|1299994_1300633_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_000590418.1|1300629_1301892_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847998.1|1301888_1302797_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_001298167.1|1302992_1303760_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_001141289.1|1303810_1304467_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_000103863.1|1304572_1307134_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 3
NZ_CP048920	Escherichia coli strain SCU-101 chromosome, complete genome	5357129	1379934	1462369	5357129	tail,holin,tRNA,capsid,head,portal,terminase	Enterobacteria_phage(35.85%)	93	NA	NA
WP_021519465.1|1379934_1381107_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.3	2.0e-146
WP_001331174.1|1381067_1381274_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001075212.1|1381315_1382182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008221.1|1382290_1382815_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	97.7	2.0e-95
WP_021519464.1|1382942_1383767_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.6e-149
WP_000135691.1|1383832_1384195_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000500991.1|1384662_1385175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353346.1|1385489_1386182_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	1.9e-125
WP_001191674.1|1386279_1386540_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515846.1|1386532_1387090_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.5e-96
WP_001250269.1|1387265_1387445_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_021561135.1|1387434_1388376_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.9	2.3e-142
WP_023568689.1|1388372_1388867_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000210150.1|1388866_1389193_+	LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.3e-52
WP_000767122.1|1389189_1389579_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	1.0e-67
WP_016159282.1|1389598_1390396_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	1.3e-149
WP_016230662.1|1390403_1391393_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
WP_001047084.1|1391406_1392159_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
WP_122985741.1|1392430_1392520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|1392574_1392787_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|1393087_1393303_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|1394055_1394271_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000189904.1|1394275_1394827_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	50.6	4.2e-35
WP_001306174.1|1394774_1395035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|1395148_1395682_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071776.1|1395678_1396176_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|1396539_1396752_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|1396762_1396951_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|1397098_1397254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|1397426_1397600_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548592.1|1397895_1398102_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001300120.1|1398352_1398547_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453567.1|1398935_1399481_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	93.4	7.8e-90
WP_001027232.1|1399455_1401381_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000198149.1|1401377_1401584_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001534239.1|1401580_1403182_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.1e-309
WP_169711412.1|1403162_1404482_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	3.7e-234
WP_001338090.1|1404491_1404824_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_000063221.1|1404878_1405904_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_000158882.1|1405945_1406341_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	3.1e-56
WP_000752955.1|1406352_1406706_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_000985118.1|1406717_1407296_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_000683090.1|1407292_1407688_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.9	2.5e-69
WP_001547293.1|1407695_1408436_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	1.2e-128
WP_000479168.1|1408451_1408874_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	1.2e-69
WP_000459484.1|1408855_1409290_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	5.0e-63
WP_000840199.1|1409282_1411850_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.5	0.0e+00
WP_000847330.1|1411846_1412176_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	1.6e-58
WP_001152619.1|1412175_1412874_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_001519691.1|1412879_1413623_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090917.1|1413559_1414192_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_001519692.1|1414252_1417735_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001519693.1|1417793_1419854_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_000654175.1|1419850_1420129_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	9.9e-25
WP_000355360.1|1420141_1420435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|1420662_1421253_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836769.1|1421627_1421861_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|1421929_1422043_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001072749.1|1423008_1423929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162576.1|1424674_1425157_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	2.6e-28
WP_000600193.1|1425288_1425765_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|1425754_1426045_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1426106_1426448_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880938.1|1426596_1428258_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|1428343_1429222_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1429344_1429938_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_032140825.1|1429992_1431279_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1431299_1432091_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1432257_1433619_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1433755_1434004_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1434022_1434571_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1434601_1435369_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1435410_1435758_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589793.1|1435834_1436317_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969016.1|1436332_1437559_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212400.1|1437548_1438067_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001298694.1|1438213_1438579_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|1438788_1439859_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225230.1|1439869_1440991_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200106.1|1441033_1442194_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1442292_1442340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1442443_1442785_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1443054_1443792_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079112.1|1443926_1444907_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040136.1|1444903_1445635_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1445764_1448338_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_001443088.1|1454113_1455412_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	2.8e-45
WP_001370843.1|1455408_1455732_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001305244.1|1455777_1457133_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083020.1|1457246_1459907_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001298618.1|1459938_1460637_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1460705_1461125_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997384.1|1461331_1462369_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP048920	Escherichia coli strain SCU-101 chromosome, complete genome	5357129	1551514	1596005	5357129	tail,holin,integrase,terminase	Escherichia_phage(50.0%)	58	1544567:1544584	1575518:1575535
1544567:1544584	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_001296289.1|1551514_1552981_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|1553049_1554627_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_021537587.1|1554819_1556070_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	1.8e-238
WP_021537586.1|1556073_1556268_-	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	95.3	3.1e-25
WP_024188149.1|1556264_1556915_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	98.6	5.6e-127
WP_001335975.1|1556907_1557159_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000675390.1|1557316_1557565_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_020233747.1|1557614_1558556_-	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.4	8.5e-177
WP_021537583.1|1558552_1559374_-	hypothetical protein	NA	A0A2R9YJH7	Escherichia_phage	98.9	5.7e-161
WP_047629887.1|1559370_1559670_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	99.0	6.4e-46
WP_021537582.1|1559672_1559825_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	98.0	2.7e-24
WP_000836290.1|1559978_1560563_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282459.1|1560717_1560948_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000402893.1|1561098_1561299_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_097564307.1|1561314_1562130_+	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	95.3	1.4e-119
WP_097564311.1|1562126_1562912_+	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	6.1e-152
WP_097564306.1|1563029_1563374_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	1.1e-60
WP_032148017.1|1563456_1563981_+	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	58.0	2.5e-37
WP_024008601.1|1563977_1564292_+	hypothetical protein	NA	B1GS43	Salmonella_phage	84.0	6.8e-38
WP_169711413.1|1564278_1564722_+	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	96.4	4.8e-37
WP_000360279.1|1564723_1564921_+	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	84.6	1.5e-30
WP_169711414.1|1564931_1565738_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.8	1.1e-47
WP_023278008.1|1565737_1566079_+	DUF2591 family protein	NA	G9L6B5	Escherichia_phage	95.6	2.1e-61
WP_001129691.1|1566071_1566410_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	100.0	5.8e-59
WP_001124396.1|1566427_1566640_+	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_024946519.1|1566636_1567311_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_021537574.1|1567307_1568783_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.0	1.9e-295
WP_021537573.1|1568873_1569293_-	hypothetical protein	NA	A0A2H4ZJ80	Enterobacter_phage	84.0	2.0e-16
WP_000335899.1|1569995_1570202_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_169711415.1|1570216_1571896_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	4.7e-303
WP_000133160.1|1571892_1572189_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_021537571.1|1572191_1572887_+	hypothetical protein	NA	G9L6C4	Escherichia_phage	97.0	4.0e-91
WP_000268715.1|1572901_1573888_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_000627074.1|1573939_1574377_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	100.0	2.2e-74
WP_000012377.1|1574387_1574723_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000424495.1|1574773_1575097_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_000179265.1|1575096_1575702_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	4.7e-112
1575518:1575535	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
WP_021537570.1|1575701_1578173_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
WP_032342179.1|1578172_1578637_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.7	2.4e-84
WP_129773718.1|1578636_1579143_+	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	82.4	2.4e-48
WP_097437899.1|1579215_1581963_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.5	2.6e-117
WP_083586196.1|1581962_1585352_+	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.9	1.1e-184
WP_001555613.1|1585353_1586205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000671199.1|1586296_1586737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000125783.1|1586757_1586925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993736.1|1587024_1587681_-	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	81.0	7.5e-55
WP_021537563.1|1588080_1588809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001188254.1|1588831_1589089_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	98.8	1.7e-42
WP_097564300.1|1589284_1591936_+|tail	tail fiber domain-containing protein	tail	G9L6E4	Escherichia_phage	78.3	8.5e-65
WP_021537561.1|1592033_1592435_+	hypothetical protein	NA	A0A193GYV1	Enterobacter_phage	85.0	5.4e-56
WP_021537560.1|1592424_1592733_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	91.2	7.3e-45
WP_021537559.1|1592722_1593349_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	94.2	1.7e-109
WP_021537558.1|1593345_1593570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021537557.1|1593566_1594064_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	68.9	8.2e-54
WP_000755178.1|1594259_1594799_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000976952.1|1594814_1595333_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	98.8	2.5e-61
WP_000076001.1|1595643_1595835_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017553.1|1595852_1596005_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
>prophage 5
NZ_CP048920	Escherichia coli strain SCU-101 chromosome, complete genome	5357129	1723412	1802565	5357129	tail,holin,plate,tRNA,capsid,head,portal,terminase,integrase	Enterobacteria_phage(71.15%)	83	1762440:1762459	1799541:1799560
WP_001224626.1|1723412_1723982_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
WP_001181152.1|1724729_1725359_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	1.6e-118
WP_000243056.1|1725676_1726297_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	5.9e-118
WP_001529349.1|1726321_1734271_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	99.3	0.0e+00
WP_001305200.1|1734330_1734849_+	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	100.0	1.9e-85
WP_000368121.1|1735436_1736369_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	4.6e-167
WP_000776774.1|1736662_1737418_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_001350318.1|1737479_1738820_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296261.1|1739191_1739476_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531944.1|1739655_1740966_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000425032.1|1740965_1743110_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195816.1|1743312_1743798_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000032640.1|1744364_1744931_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001305198.1|1745011_1747660_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000120669.1|1747679_1748432_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000642894.1|1748448_1748952_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000824841.1|1748948_1749428_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001050120.1|1749424_1749952_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000753501.1|1749953_1750811_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|1751130_1751682_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001305196.1|1751847_1752780_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|1752814_1753900_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001043802.1|1753903_1754728_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1754727_1755537_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089230.1|1755536_1756085_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559761.1|1756118_1756397_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683752.1|1756517_1758524_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1758682_1759903_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127769.1|1760167_1761346_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615818.1|1761342_1762338_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
1762440:1762459	attL	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_000789404.1|1762605_1763499_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_001173927.1|1763503_1763836_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000078920.1|1764097_1764238_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|1764428_1764689_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_169711418.1|1764880_1765903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132788.1|1766023_1767133_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	2.8e-195
WP_085452166.1|1767290_1768475_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	1.5e-223
WP_000290462.1|1768474_1768987_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_042028455.1|1769042_1769417_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	1.5e-36
WP_000333503.1|1769425_1769581_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_169711419.1|1769567_1772375_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.5	0.0e+00
WP_123010496.1|1772387_1772876_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	4.0e-85
WP_001165544.1|1772902_1773502_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
WP_169711460.1|1773573_1774002_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.9	2.9e-39
WP_001057723.1|1774102_1774714_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	80.0	2.5e-84
WP_169711420.1|1774713_1776702_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	61.8	5.1e-139
WP_097427811.1|1776698_1777307_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.4	5.8e-86
WP_001111967.1|1777299_1778196_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_169711461.1|1778198_1778528_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	6.4e-55
WP_001345538.1|1778545_1779112_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.9	1.7e-100
WP_000356352.1|1779123_1779759_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
WP_000920601.1|1779751_1780219_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	5.9e-86
WP_169711421.1|1780356_1780764_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	2.9e-65
WP_169711422.1|1780760_1781153_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	3.8e-70
WP_000104350.1|1781149_1781473_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1781475_1781676_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063082.1|1781675_1782170_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000632343.1|1782272_1783073_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	99.2	1.1e-140
WP_169711423.1|1783118_1784171_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	1.5e-193
WP_001262655.1|1784194_1785031_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_169711424.1|1785185_1786937_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	99.1	0.0e+00
WP_097768361.1|1786936_1787983_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	98.8	1.2e-200
WP_097768362.1|1787997_1788522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094319518.1|1789402_1789999_+	DUF4760 domain-containing protein	NA	Q8HA56	Vibrio_phage	32.5	1.0e-18
WP_094319519.1|1790066_1790378_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	2.2e-49
WP_095844199.1|1790382_1791342_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.4e-179
WP_123005330.1|1791418_1794241_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000599375.1|1794247_1794613_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	8.7e-61
WP_001326016.1|1794609_1795227_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_001274220.1|1795238_1795538_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	2.8e-41
WP_000153674.1|1795534_1795780_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_095844198.1|1795776_1795980_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	1.1e-25
WP_000021652.1|1796066_1796180_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000514277.1|1796176_1796419_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158971.1|1796430_1796718_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000813363.1|1796728_1797070_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000200503.1|1797322_1797529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004249.1|1797535_1797823_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_001390705.1|1797936_1798257_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_169711425.1|1798353_1799358_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
WP_001534306.1|1799516_1800674_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	4.6e-23
1799541:1799560	attR	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_001289179.1|1800739_1801753_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1801752_1802565_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP048920	Escherichia coli strain SCU-101 chromosome, complete genome	5357129	2114710	2122445	5357129		Enterobacteria_phage(33.33%)	8	NA	NA
WP_001560618.1|2114710_2116105_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	4.1e-18
WP_001560617.1|2116279_2117173_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.1e-45
WP_000699401.1|2117545_2118631_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.7e-99
WP_001023616.1|2118630_2119530_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_001560616.1|2119588_2120464_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001350333.1|2120481_2120892_+	FdtA/QdtA family cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001219875.1|2120878_2121346_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001560615.1|2121338_2122445_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.9	1.2e-44
>prophage 7
NZ_CP048920	Escherichia coli strain SCU-101 chromosome, complete genome	5357129	2868842	2914711	5357129	tail,transposase,plate,tRNA,capsid,integrase	Burkholderia_virus(41.46%)	60	2866676:2866691	2898559:2898574
2866676:2866691	attL	TAAAAGGCTGGGCGCT	NA	NA	NA	NA
WP_001157412.1|2868842_2869778_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000123770.1|2869906_2871280_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.5e-52
WP_000387388.1|2871757_2872741_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001281694.1|2873135_2873525_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	5.8e-31
WP_042069293.1|2873496_2873946_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.9	4.7e-24
WP_000206212.1|2873947_2874154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|2874143_2874374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132037.1|2874370_2875054_-	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.2	1.4e-24
WP_000763554.1|2875050_2875266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299260.1|2875280_2875577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021519404.1|2875586_2875859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001405163.1|2876147_2876678_-	bacteriophage Mu Gam like family protein	NA	L7P7T1	Pseudomonas_phage	67.9	8.2e-60
WP_021519401.1|2876705_2876975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960680.1|2876977_2878144_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_169711430.1|2878154_2879924_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	3.6e-229
WP_000533821.1|2879927_2880842_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	52.5	6.8e-70
WP_000049025.1|2880852_2881161_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	5.5e-24
WP_000200153.1|2881213_2881402_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	6.1e-18
WP_001259268.1|2881452_2881914_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000031883.1|2881910_2882897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001330012.1|2882981_2883569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042069514.1|2883606_2884083_-	ABC transporter ATPase	NA	NA	NA	NA	NA
WP_000793146.1|2884213_2884564_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|2884566_2885307_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264664.1|2885290_2885941_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|2885937_2886264_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|2886263_2886575_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|2886574_2887120_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_169711462.1|2887170_2888712_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.3e-185
WP_169711431.1|2888711_2890208_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.4	7.5e-167
WP_000117556.1|2890188_2891010_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_000135514.1|2891012_2891471_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|2891685_2892801_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|2892815_2893769_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|2893778_2894117_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2894118_2894565_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2894564_2895029_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000666499.1|2895028_2895280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|2895269_2896697_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_162832341.1|2896693_2897218_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_001513983.1|2897220_2897502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|2897599_2897935_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|2897858_2898017_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_169711432.1|2898092_2901305_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.0	8.4e-83
2898559:2898574	attR	TAAAAGGCTGGGCGCT	NA	NA	NA	NA
WP_000458387.1|2901304_2902189_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000478224.1|2902188_2902401_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_001529032.1|2902388_2903561_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
WP_001404342.1|2903557_2904154_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	3.2e-36
WP_000859111.1|2904208_2904556_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001529034.1|2904546_2905650_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.0	1.4e-106
WP_000138756.1|2905642_2906221_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_169711433.1|2906223_2908227_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.0	3.6e-39
WP_001529037.1|2908226_2908841_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_169711463.1|2908847_2909303_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.3	8.9e-31
WP_000904922.1|2909392_2909965_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_001350888.1|2910071_2911304_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_001046824.1|2911324_2911888_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_021519392.1|2912477_2912771_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_000156569.1|2912867_2913683_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000945018.1|2914195_2914711_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	3.2e-24
>prophage 8
NZ_CP048920	Escherichia coli strain SCU-101 chromosome, complete genome	5357129	3110260	3161778	5357129	tail,lysis,capsid,head,portal,terminase,integrase	Enterobacteria_phage(53.7%)	70	3129927:3129941	3143423:3143437
WP_000654175.1|3110260_3110539_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	9.9e-25
WP_001519693.1|3110535_3112596_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_001519692.1|3112654_3116137_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_000090917.1|3116197_3116830_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_001519691.1|3116766_3117510_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152619.1|3117515_3118214_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847330.1|3118213_3118543_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	1.6e-58
WP_000840199.1|3118539_3121107_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.5	0.0e+00
WP_000459484.1|3121099_3121534_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	5.0e-63
WP_000479168.1|3121515_3121938_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	1.2e-69
WP_001547293.1|3121953_3122694_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	1.2e-128
WP_021519453.1|3122701_3123097_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_000985119.1|3123093_3123672_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752955.1|3123683_3124037_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_000158869.1|3124048_3124444_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_001021158.1|3125435_3126197_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_001560459.1|3126599_3126875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766228.1|3126886_3127429_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.2	1.9e-35
WP_001178672.1|3127630_3128014_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190773.1|3128025_3128367_-|head	head decoration protein	head	NA	NA	NA	NA
WP_001560457.1|3128376_3129417_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.1	5.7e-65
WP_000126719.1|3129634_3130084_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
3129927:3129941	attL	GCCAGGACAGATAAC	NA	NA	NA	NA
WP_001560455.1|3130080_3130326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817024.1|3130613_3132434_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.6	4.9e-128
WP_000790824.1|3132430_3132718_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000999172.1|3132721_3132946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021519454.1|3132938_3133304_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001560452.1|3133440_3133635_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001560451.1|3133667_3134351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001560450.1|3134377_3134599_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000896722.1|3134600_3135836_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	44.9	1.4e-99
WP_001298472.1|3136299_3136632_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
WP_000123275.1|3136641_3137961_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	1.0e-231
WP_001298484.1|3137941_3139543_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	3.5e-311
WP_000198149.1|3139539_3139746_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_053879349.1|3139742_3141668_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000867508.1|3141642_3142188_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.9	1.2e-79
WP_000881607.1|3142750_3142933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3143139_3143466_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
3143423:3143437	attR	GCCAGGACAGATAAC	NA	NA	NA	NA
WP_001298464.1|3143946_3144240_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|3144330_3144513_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135283.1|3144729_3145227_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_000839596.1|3145226_3145442_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|3146030_3147113_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|3147301_3147685_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971056.1|3147770_3147911_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3147907_3148270_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774485.1|3148266_3148557_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
WP_000224917.1|3148549_3148720_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
WP_001053041.1|3148719_3149175_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
WP_000182282.1|3149442_3149820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000608370.1|3149816_3150245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788796.1|3150323_3151037_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
WP_000147913.1|3151033_3152053_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	6.1e-112
WP_001182882.1|3152049_3152589_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000184665.1|3152619_3152847_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001337214.1|3152957_3153650_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000380252.1|3153730_3154792_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|3154769_3155147_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|3155622_3155829_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995491.1|3155903_3156200_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000100847.1|3156205_3156991_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|3156987_3157668_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682300.1|3157664_3157847_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548537.1|3157819_3158011_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001308571.1|3158021_3158303_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000763364.1|3158401_3158620_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488406.1|3158667_3158907_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|3159046_3159283_+	excisionase	NA	NA	NA	NA	NA
WP_000444487.1|3160527_3161778_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 9
NZ_CP048920	Escherichia coli strain SCU-101 chromosome, complete genome	5357129	4192124	4280383	5357129	tail,transposase,plate,tRNA,capsid,integrase	Burkholderia_virus(33.33%)	104	4192187:4192201	4209743:4209757
WP_001305361.1|4192124_4192727_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	33.3	1.8e-07
4192187:4192201	attL	CTGTGCTTTCCAGTT	NA	NA	NA	NA
WP_001313577.1|4193125_4194226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001560379.1|4194447_4194882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000544741.1|4195099_4197496_+	dynamin family protein	NA	NA	NA	NA	NA
WP_000203555.1|4197492_4198398_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102646.1|4198394_4199465_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000238685.1|4199554_4200061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000680181.1|4200116_4200746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682723.1|4201180_4201633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169711447.1|4201750_4201960_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001571575.1|4202143_4202305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021522614.1|4202308_4202941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281696.1|4203055_4203454_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
WP_001573929.1|4203425_4203875_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
WP_000123379.1|4203867_4204083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631814.1|4204072_4204303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131939.1|4204299_4204983_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.9	4.5e-34
WP_000197789.1|4204979_4205285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001774057.1|4205294_4205567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001405163.1|4205855_4206386_-	bacteriophage Mu Gam like family protein	NA	L7P7T1	Pseudomonas_phage	67.9	8.2e-60
WP_000843446.1|4206413_4206683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960680.1|4206685_4207852_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_001774059.1|4207862_4209632_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	4.8e-229
WP_000533819.1|4209635_4210547_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	55.3	2.0e-74
4209743:4209757	attR	CTGTGCTTTCCAGTT	NA	NA	NA	NA
WP_000047758.1|4210557_4210866_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_000123378.1|4210918_4211107_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000579778.1|4211207_4211546_+	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	34.4	4.8e-05
WP_001573937.1|4211662_4212427_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
WP_001069609.1|4212618_4212834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001573938.1|4212835_4213237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194949.1|4213212_4213956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793145.1|4214086_4214437_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_072665071.1|4214439_4215177_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_001299256.1|4215205_4215817_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
WP_000175097.1|4215813_4216140_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227704.1|4216139_4216451_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000533684.1|4216453_4216996_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000137893.1|4216992_4218516_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
WP_169711448.1|4218515_4220012_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	6.1e-169
WP_000117556.1|4219992_4220814_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_000135514.1|4220816_4221275_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|4221489_4222605_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|4222619_4223573_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|4223582_4223921_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|4223922_4224369_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|4224368_4224833_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000666499.1|4224832_4225084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|4225073_4226501_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_162832341.1|4226497_4227022_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_001513983.1|4227024_4227306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|4227403_4227739_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|4227662_4227821_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_169711449.1|4227896_4231109_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	5.8e-84
WP_000458387.1|4231108_4231993_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000478224.1|4231992_4232205_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_001529032.1|4232192_4233365_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
WP_000148265.1|4233361_4233958_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_000859116.1|4234012_4234360_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_001529034.1|4234350_4235454_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.0	1.4e-106
WP_000138756.1|4235446_4236025_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_096976434.1|4236027_4237959_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	9.0e-40
WP_001529037.1|4237958_4238573_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_169711463.1|4238579_4239035_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.3	8.9e-31
WP_024189672.1|4239063_4239537_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	45.4	2.1e-30
WP_000904922.1|4239638_4240211_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_021567056.1|4240431_4241253_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	6.1e-46
WP_001164966.1|4241252_4241498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001313575.1|4241591_4242065_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	4.3e-12
WP_001186170.1|4242080_4242557_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692315.1|4242619_4242841_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_000086759.1|4242859_4243504_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.7	2.7e-25
WP_001285482.1|4243553_4243928_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854737.1|4243974_4244352_+	toxin	NA	NA	NA	NA	NA
WP_000555410.1|4246304_4247438_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_000555410.1|4247824_4248958_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_000555410.1|4249344_4250478_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_000624707.1|4252166_4252517_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
WP_001313570.1|4252846_4253041_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001294853.1|4253122_4253569_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_106426235.1|4253578_4253704_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000928633.1|4253734_4253980_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001308374.1|4254309_4255041_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917878.1|4255105_4255573_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.4e-50
WP_001295200.1|4255569_4256292_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052735.1|4256325_4257081_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4257152_4258511_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211716.1|4258559_4259330_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4259407_4260208_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648563.1|4260448_4261363_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997016.1|4261359_4262163_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
WP_001140167.1|4267924_4268497_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4268684_4269716_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294595.1|4269708_4270362_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|4270401_4271217_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4271334_4271739_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094025.1|4271735_4272443_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260694.1|4272553_4274272_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000360468.1|4274324_4275149_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239175.1|4276734_4277445_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635528.1|4277458_4277881_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185284.1|4277877_4278423_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417060.1|4278588_4278789_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062311.1|4278775_4279036_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176513.1|4279069_4280383_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
