The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052854	Xylella fastidiosa subsp. multiplex strain LM10 chromosome, complete genome	2669650	168222	288520	2669650	holin,terminase,tail,tRNA,protease,integrase,plate,portal,capsid	Xylella_phage(31.58%)	109	171722:171739	263364:263381
WP_004085497.1|168222_169479_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
171722:171739	attL	TAGCTCAGCTGGTAGAGC	NA	NA	NA	NA
WP_004085054.1|175310_176126_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	28.2	2.6e-20
WP_004085053.1|176260_177058_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004085052.1|177555_179469_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_004085051.1|179868_180609_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004085050.1|181155_182760_+	peptide chain release factor 3	NA	NA	NA	NA	NA
WP_004085049.1|182842_183487_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_004085048.1|183711_184725_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	44.0	1.9e-73
WP_012337571.1|185013_185796_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_004085046.1|186144_186918_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_021358332.1|187745_188174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085045.1|189539_189935_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_004085044.1|190465_191572_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_021358331.1|191723_192155_-	NfeD family protein	NA	NA	NA	NA	NA
WP_004085042.1|192158_193115_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	28.5	8.2e-18
WP_004085041.1|193449_194283_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_021358329.1|194316_195117_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_004085039.1|195113_195662_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_004085038.1|195703_197161_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	21.8	1.5e-07
WP_169709882.1|197151_197886_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_004085036.1|199480_200821_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.0	1.4e-52
WP_004085035.1|200901_201258_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_004085034.1|202356_202881_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_004085033.1|203405_204035_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_004085032.1|204646_205354_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	27.2	6.3e-07
WP_169709883.1|205499_206519_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	97.3	3.6e-189
WP_169709884.1|206518_206767_-	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	84.1	1.0e-33
WP_169709885.1|206759_206924_-	hypothetical protein	NA	C8CLF6	Xylella_phage	94.4	7.4e-20
WP_169710133.1|206920_208339_-	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.8	3.8e-269
WP_169709887.1|208423_208849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086077.1|208850_209129_-	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	5.6e-44
WP_169709888.1|209125_211306_-	DNA polymerase	NA	C8CLG0	Xylella_phage	93.9	0.0e+00
WP_169710109.1|211307_212459_-	hypothetical protein	NA	C8CLG1	Xylella_phage	89.4	1.4e-194
WP_169710134.1|212545_213112_-	DUF2815 family protein	NA	C8CLG2	Xylella_phage	95.2	3.9e-100
WP_012337864.1|213111_214389_-	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	93.4	5.0e-228
WP_021358684.1|214385_214817_-	hypothetical protein	NA	C8CLG4	Xylella_phage	97.2	3.1e-49
WP_169709890.1|214859_215090_-	hypothetical protein	NA	C8CLG5	Xylella_phage	79.7	6.7e-19
WP_169709891.1|215121_215313_-	hypothetical protein	NA	C8CLG6	Xylella_phage	75.0	1.2e-16
WP_004086365.1|215336_215528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709892.1|215524_215926_-	hypothetical protein	NA	C8CLG7	Xylella_phage	88.0	6.6e-62
WP_169710135.1|215922_216393_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_169710110.1|216389_216833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709894.1|216937_217498_-	hypothetical protein	NA	C8CLG9	Xylella_phage	35.7	6.9e-09
WP_169709895.1|217678_218434_-	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	30.8	3.3e-30
WP_024748600.1|218516_218753_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169709896.1|218742_219072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012337854.1|219159_219543_+	hypothetical protein	NA	C8CLH2	Xylella_phage	89.7	3.6e-57
WP_169709897.1|219802_220411_+	hypothetical protein	NA	C8CLH5	Xylella_phage	55.4	4.5e-46
WP_169709898.1|220548_223080_+	DNA primase	NA	C8CLH6	Xylella_phage	73.7	0.0e+00
WP_169709899.1|223431_224049_+	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	52.2	4.0e-26
WP_169709900.1|224015_224510_+	lysozyme	NA	A0A2H5BQB7	Pseudomonas_phage	56.0	2.5e-26
WP_004086884.1|224502_224832_+|holin	phage holin family protein	holin	A0A172PZR6	Pseudomonas_phage	41.7	5.7e-19
WP_169710136.1|224821_225283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169709902.1|225284_225509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169709903.1|225639_226215_+|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	57.4	2.1e-45
WP_169710137.1|226207_228160_+|terminase	phage terminase large subunit family protein	terminase	D5LH04	Escherichia_phage	67.2	2.4e-250
WP_169709905.1|228163_228715_+	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.2	7.5e-40
WP_169710138.1|228711_230298_+|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	51.3	8.3e-132
WP_169709907.1|230294_232169_+|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	48.7	1.9e-164
WP_012337650.1|232186_232447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169709908.1|232446_232770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169709909.1|232766_233294_+	hypothetical protein	NA	D5LGZ7	Escherichia_phage	36.2	3.7e-12
WP_154436958.1|233269_233812_+	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	43.2	8.1e-39
WP_042836490.1|233808_234396_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_004085172.1|234400_234676_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_004085174.1|234686_234968_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	45.2	1.6e-14
WP_004088650.1|235165_235504_+	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	61.3	2.4e-33
WP_038284057.1|235503_236397_+|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	8.6e-70
WP_169709910.1|236389_236947_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	53.9	1.1e-51
WP_169709911.1|236954_238547_+|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	36.6	2.0e-85
WP_038230457.1|238611_239790_+|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	55.4	4.5e-135
WP_004086986.1|239789_240299_+|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	52.7	5.3e-48
WP_169709912.1|240301_240589_+|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	43.4	4.0e-13
WP_169710111.1|240715_242935_+|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	44.9	7.8e-96
WP_169709913.1|242931_243414_+|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	46.8	2.6e-28
WP_040123123.1|243410_243629_+|tail	tail protein	tail	A0A1W6JT40	Escherichia_phage	48.6	2.0e-12
WP_169709914.1|243619_244702_+	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.6	5.7e-92
WP_169709915.1|245120_246050_+|protease	serine protease	protease	NA	NA	NA	NA
WP_143704329.1|246259_246481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086316.1|246807_247407_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004086315.1|247471_247924_+	CopD family protein	NA	NA	NA	NA	NA
WP_012337572.1|248089_249049_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_128723644.1|249143_252725_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.4	5.3e-187
WP_012337574.1|253013_253940_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.7	7.4e-48
WP_004086308.1|254477_254807_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_004086307.1|254851_255523_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027700348.1|256425_257901_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	29.8	3.5e-36
WP_012337576.1|258054_258639_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.7	2.9e-66
WP_004086298.1|258707_259742_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.9	8.7e-74
WP_012337577.1|259826_260621_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	54.6	6.7e-66
WP_004086296.1|260617_261340_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_004086295.1|262324_262831_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004086294.1|264565_265768_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
263364:263381	attR	GCTCTACCAGCTGAGCTA	NA	NA	NA	NA
WP_004086293.1|265955_267782_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_004086289.1|270087_271242_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	6.1e-84
WP_027700344.1|271364_271715_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_004086285.1|271781_273626_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004086283.1|273645_274611_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.8	9.4e-30
WP_004086282.1|274946_276212_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.7	2.7e-24
WP_012337581.1|276211_276730_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004086274.1|276762_277581_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.9	2.2e-35
WP_004086273.1|277577_278423_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_004086272.1|278505_278886_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_004086271.1|278889_280398_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_021358323.1|282151_282751_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004086267.1|282747_284259_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004086265.1|284354_287033_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	21.9	7.6e-21
WP_004086263.1|287143_287521_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004086261.1|287617_288520_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP052854	Xylella fastidiosa subsp. multiplex strain LM10 chromosome, complete genome	2669650	424579	549377	2669650	holin,terminase,tail,tRNA,protease,integrase,plate,portal,capsid	Escherichia_phage(22.5%)	106	469662:469682	559761:559781
WP_011097581.1|424579_425077_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	36.0	3.7e-06
WP_049756302.1|425084_425567_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_012337622.1|425766_427143_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_004085229.1|427673_428438_-	arginyltransferase	NA	NA	NA	NA	NA
WP_004085228.1|428861_429353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049756303.1|429356_430208_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_004085334.1|431122_431452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709920.1|432577_435454_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_004085225.1|436753_438736_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_004085224.1|439390_441982_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_004085223.1|443882_446909_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004085222.1|447014_448457_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.1	2.0e-47
WP_021358468.1|449606_450914_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_004085220.1|451784_452489_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	38.3	1.0e-25
WP_004085219.1|452545_453703_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011097591.1|453779_454571_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_004085217.1|454592_455075_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_004085216.1|455071_456088_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012337629.1|456275_458630_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_004085214.1|458728_460063_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_169710112.1|460089_461280_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_004085212.1|461276_462131_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004085211.1|462127_462895_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	34.8	1.6e-16
WP_004089320.1|462897_463455_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_004085207.1|465828_466509_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004085206.1|466620_466941_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_004085205.1|468151_468883_-	UMP kinase	NA	NA	NA	NA	NA
WP_004085344.1|469327_469576_+	hypothetical protein	NA	NA	NA	NA	NA
469662:469682	attL	TGCGTCTACCAATTCCGCCAC	NA	NA	NA	NA
WP_004085204.1|470276_470936_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_004085203.1|471032_472949_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_004085202.1|473047_473767_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_004085201.1|473763_474777_-	glucokinase	NA	NA	NA	NA	NA
WP_021358465.1|474773_476207_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.2	5.8e-68
WP_012337631.1|476535_477630_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	2.1e-25
WP_004085198.1|477774_478578_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_004085343.1|478890_479109_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_021358463.1|479166_479589_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004085197.1|479585_479969_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_004085196.1|479976_481767_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004085195.1|481787_482573_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004085194.1|482693_482942_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_012337633.1|482964_483345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085192.1|483370_484612_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004085191.1|484604_485327_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.2	1.6e-34
WP_012337634.1|485674_488152_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	34.3	1.4e-05
WP_004085189.1|488136_488799_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_004089267.1|488803_489241_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_004085187.1|489258_491007_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.8	5.7e-49
WP_004085186.1|491003_492023_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_012337635.1|492397_493480_-	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.6	5.7e-92
WP_004085341.1|493470_493689_-|tail	tail protein	tail	A0A1W6JT40	Escherichia_phage	50.0	3.1e-13
WP_012337636.1|493685_494168_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	47.6	8.9e-29
WP_012337637.1|494164_496384_-|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	47.1	6.0e-104
WP_012337638.1|496510_496798_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	44.6	1.4e-13
WP_128283754.1|496800_497310_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	53.9	1.4e-48
WP_004086970.1|500148_500706_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	6.6e-52
WP_004085176.1|501589_501928_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	60.4	9.3e-33
WP_004087029.1|502061_502376_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	O64357	Escherichia_phage	30.4	1.6e-07
WP_004087027.1|502377_502659_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_004087025.1|502670_502970_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	49.4	1.2e-15
WP_128283746.1|502974_503562_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_154436958.1|503558_504101_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	43.2	8.1e-39
WP_169710140.1|504076_504598_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	35.0	5.6e-13
WP_169709908.1|504594_504918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337650.1|504917_505178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710141.1|505195_507070_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	48.4	4.8e-163
WP_169710142.1|507066_508653_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	51.3	4.1e-131
WP_038230179.1|508649_509201_-	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.7	2.6e-40
WP_169710143.1|509204_511157_-|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	66.8	4.1e-250
WP_004086888.1|511149_511725_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	58.6	4.3e-46
WP_012337656.1|511855_512080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709972.1|512081_512543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085022.1|512532_512862_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_128382956.1|512854_513355_-	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	51.1	7.3e-26
WP_169709925.1|513454_514186_-	site-specific DNA-methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	53.0	8.4e-63
WP_004085025.1|514375_514711_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_004089517.1|514707_514962_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012337661.1|515014_515737_-	hypothetical protein	NA	C8CLH7	Xylella_phage	82.1	3.0e-105
WP_162010044.1|515679_516027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021358690.1|516080_516239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038230497.1|517479_517758_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	7.3e-44
WP_004085029.1|517759_518164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709926.1|518248_519667_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.4	7.1e-268
WP_004086189.1|519663_519828_+	hypothetical protein	NA	C8CLF6	Xylella_phage	96.3	6.7e-21
WP_004086191.1|519820_520069_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	89.0	2.2e-36
WP_169709927.1|520068_521088_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	90.6	2.4e-172
WP_004085684.1|521864_522506_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	40.7	3.4e-12
WP_004085683.1|522533_523010_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_004085682.1|523014_523587_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_038231298.1|523583_525542_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_071869548.1|526527_526920_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004085680.1|528182_528668_-	asparaginase	NA	NA	NA	NA	NA
WP_004085679.1|528910_529510_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004085726.1|529911_530055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085678.1|530084_531269_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	34.3	1.4e-51
WP_004085677.1|531457_532033_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027700073.1|533386_533680_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_169709928.1|533764_536536_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.7	1.3e-63
WP_012337670.1|537192_537906_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_031345756.1|538103_539228_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	A0A0P0IKJ1	Acinetobacter_phage	25.1	1.8e-08
WP_004085673.1|539426_542669_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_027700071.1|542677_543142_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_004085671.1|543149_544070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161632202.1|544072_545881_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_169709929.1|546548_547673_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	3.4e-07
WP_004085668.1|547856_549377_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.1	5.0e-86
559761:559781	attR	TGCGTCTACCAATTCCGCCAC	NA	NA	NA	NA
>prophage 3
NZ_CP052854	Xylella fastidiosa subsp. multiplex strain LM10 chromosome, complete genome	2669650	882634	973932	2669650	holin,terminase,tail,tRNA,protease,integrase,plate,portal	Xylella_phage(30.43%)	95	932659:932675	974035:974051
WP_169710144.1|882634_883774_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004083752.1|883770_884229_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004083751.1|884408_884729_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.0	4.2e-11
WP_004083750.1|884861_887138_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.7	1.2e-168
WP_004083749.1|887480_887699_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004083748.1|887815_888550_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_012337768.1|888561_889698_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004083746.1|890126_891092_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.0	4.5e-64
WP_004083745.1|891360_893715_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.1	1.4e-82
WP_004083744.1|893899_895810_+	DUF3857 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_049756311.1|896372_896999_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004083742.1|897130_898498_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	36.9	7.7e-70
WP_004083741.1|898658_899060_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_128283905.1|899735_901232_+	response regulator	NA	A0A2K9L0Z8	Tupanvirus	36.1	2.1e-07
WP_031345731.1|901357_901873_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004083738.1|901883_902621_-	pteridine reductase	NA	NA	NA	NA	NA
WP_004083737.1|902701_903886_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004083736.1|903873_904290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004083735.1|904309_905314_-	glucokinase	NA	NA	NA	NA	NA
WP_021358212.1|905740_905926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004083734.1|906017_907307_+	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
WP_004083733.1|907310_908387_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004083732.1|908383_909424_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_004083731.1|909423_910581_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_169709968.1|911257_912154_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_020852600.1|912150_913497_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_004083728.1|913580_914435_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004083727.1|914431_915577_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004083726.1|916091_916421_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_012337770.1|916524_917775_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	37.9	8.6e-84
WP_004083725.1|917762_919031_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_027699983.1|919030_919867_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.6	1.9e-10
WP_012337772.1|920013_921471_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004084097.1|921491_921953_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_004083722.1|922116_922584_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_004083721.1|923380_925534_+	S9 family peptidase	NA	F2Y2Z7	Organic_Lake_phycodnavirus	37.1	3.7e-26
WP_004083720.1|925636_925849_+	lipoprotein	NA	NA	NA	NA	NA
WP_004083719.1|925858_926713_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_004083718.1|926709_927381_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_021358210.1|927404_928289_+	tyrosine recombinase XerC	NA	A0A0K0N6I5	Gordonia_phage	33.8	7.1e-16
WP_004083716.1|928873_929425_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_012337775.1|929492_930872_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	30.2	1.7e-40
WP_012337776.1|931092_932448_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
932659:932675	attL	CTTATGATGGCGGTACA	NA	NA	NA	NA
WP_128283903.1|933063_934071_-	peptidase	NA	NA	NA	NA	NA
WP_169710145.1|934350_935433_-	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.6	7.4e-92
WP_169710146.1|935423_935642_-|tail	phage tail protein	tail	A0A1W6JT40	Escherichia_phage	50.0	3.1e-13
WP_169710147.1|935638_936121_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	46.8	3.4e-28
WP_169710210.1|936117_938331_-|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	46.0	3.6e-101
WP_128283755.1|938457_938745_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	44.6	1.4e-13
WP_012337639.1|938747_939257_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	53.3	5.3e-48
WP_169710148.1|939256_940435_-|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	55.2	1.7e-134
WP_154128230.1|940499_942092_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	35.9	4.6e-82
WP_004086970.1|942099_942657_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	6.6e-52
WP_004085178.1|942649_943543_-|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	8.6e-70
WP_004088650.1|943542_943881_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	61.3	2.4e-33
WP_004086967.1|944030_944294_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_004086966.1|944280_944562_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_128283746.1|944598_945186_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_154436958.1|945182_945725_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	43.2	8.1e-39
WP_154436960.1|945700_946222_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.5	1.3e-12
WP_154436962.1|946218_946542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337650.1|946541_946802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710142.1|948689_950276_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	51.3	4.1e-131
WP_038230179.1|950272_950824_-	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.7	2.6e-40
WP_169710143.1|950827_952780_-|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	66.8	4.1e-250
WP_012337655.1|952772_953348_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	58.0	9.5e-46
WP_012337656.1|953478_953703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709972.1|953704_954166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085022.1|954155_954485_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_169709973.1|954477_954978_-	lysozyme	NA	I2GUG4	Acinetobacter_phage	52.1	8.6e-27
WP_169709899.1|954944_955562_-	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	52.2	4.0e-26
WP_169709974.1|956551_959083_-	DNA primase	NA	C8CLH6	Xylella_phage	75.0	0.0e+00
WP_169709975.1|959220_959829_-	hypothetical protein	NA	C8CLH5	Xylella_phage	56.5	2.2e-48
WP_076613265.1|959825_960110_-	hypothetical protein	NA	C8CLH4	Xylella_phage	64.8	1.2e-22
WP_004085338.1|960106_960355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085135.1|960351_960540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709976.1|960593_960818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085337.1|960807_961044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085133.1|961081_961852_+	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	40.7	5.6e-33
WP_004085336.1|961885_962482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169709977.1|962662_963223_+	hypothetical protein	NA	C8CLG9	Xylella_phage	34.8	2.6e-08
WP_128283727.1|963219_963681_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_012337859.1|963677_964085_+	hypothetical protein	NA	C8CLG7	Xylella_phage	79.3	8.2e-52
WP_004086069.1|964081_964273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038233160.1|964296_964488_+	hypothetical protein	NA	C8CLG6	Xylella_phage	76.6	3.1e-17
WP_004086187.1|964519_964714_+	hypothetical protein	NA	C8CLG5	Xylella_phage	98.4	1.6e-26
WP_169709978.1|964703_965201_+	hypothetical protein	NA	C8CLG4	Xylella_phage	95.4	2.6e-52
WP_169710149.1|966473_967040_+	DUF2815 family protein	NA	C8CLG2	Xylella_phage	95.2	7.8e-101
WP_169710117.1|967126_968278_+	hypothetical protein	NA	C8CLG1	Xylella_phage	89.7	6.5e-195
WP_169710150.1|968279_970460_+	DNA polymerase	NA	C8CLG0	Xylella_phage	96.4	0.0e+00
WP_169710151.1|970456_970735_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	2.8e-43
WP_004083464.1|970736_971063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710152.1|971147_972566_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.6	3.8e-269
WP_169709983.1|972562_972859_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	48.1	4.5e-07
WP_169709984.1|972870_973932_+|integrase	integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	54.1	5.8e-97
974035:974051	attR	CTTATGATGGCGGTACA	NA	NA	NA	NA
>prophage 4
NZ_CP052854	Xylella fastidiosa subsp. multiplex strain LM10 chromosome, complete genome	2669650	1060701	1081107	2669650	holin,integrase	Xylella_phage(72.22%)	20	1047454:1047467	1062789:1062802
1047454:1047467	attL	TTAGCGGGCAATAC	NA	NA	NA	NA
WP_004083657.1|1060701_1061721_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	90.0	1.5e-171
WP_049756312.1|1062028_1062469_+	SocA family protein	NA	K4NZT7	Burkholderia_phage	33.3	9.9e-11
WP_004083655.1|1062565_1063108_-	pilin	NA	NA	NA	NA	NA
1062789:1062802	attR	TTAGCGGGCAATAC	NA	NA	NA	NA
WP_004084093.1|1063347_1063701_-	hypothetical protein	NA	C8CLJ8	Xylella_phage	54.7	3.4e-22
WP_004083654.1|1063697_1064480_-	hypothetical protein	NA	C8CLJ7	Xylella_phage	66.0	4.5e-91
WP_080513455.1|1065148_1065538_-	hypothetical protein	NA	C8CLJ3	Xylella_phage	61.2	1.2e-28
WP_004083651.1|1065978_1067190_-	hypothetical protein	NA	C8CLJ2	Xylella_phage	61.7	1.6e-119
WP_012337788.1|1067193_1067949_-	hypothetical protein	NA	C8CLJ1	Xylella_phage	72.5	2.7e-56
WP_169709989.1|1067998_1068244_-	hypothetical protein	NA	C8CLJ0	Xylella_phage	79.2	2.9e-28
WP_004083648.1|1069878_1070286_-	hypothetical protein	NA	C8CLI8	Xylella_phage	60.3	2.5e-32
WP_004083647.1|1070289_1071519_-	hypothetical protein	NA	C8CLI7	Xylella_phage	71.8	3.0e-166
WP_004083646.1|1071556_1072414_-	hypothetical protein	NA	C8CLI6	Xylella_phage	49.3	1.7e-46
WP_004083645.1|1072433_1074455_-	hypothetical protein	NA	C8CLI5	Xylella_phage	77.7	3.2e-298
WP_004083644.1|1074457_1075876_-	DNA packaging protein	NA	C8CLI4	Xylella_phage	80.6	3.0e-234
WP_021358615.1|1075781_1076108_-	hypothetical protein	NA	C8CLI3	Xylella_phage	63.9	3.1e-33
WP_004083643.1|1076858_1077212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004083642.1|1077213_1077528_-|holin	phage holin family protein	holin	A0A172PZR6	Pseudomonas_phage	32.3	6.2e-07
WP_012337789.1|1077520_1078015_-	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	53.8	2.6e-28
WP_004083639.1|1078114_1078636_-	site-specific DNA-methyltransferase	NA	A0A097EWK8	Mycobacterium_phage	53.2	8.6e-38
WP_128283765.1|1078620_1081107_+	hypothetical protein	NA	A0A2D2W222	Stenotrophomonas_phage	31.1	3.8e-59
>prophage 5
NZ_CP052854	Xylella fastidiosa subsp. multiplex strain LM10 chromosome, complete genome	2669650	1261260	1306431	2669650	holin,terminase,tail,integrase,plate,head	Haemophilus_phage(20.0%)	63	1265827:1265872	1310090:1310135
WP_169710160.1|1261260_1262556_+	hypothetical protein	NA	Q94MX3	Xanthomonas_phage	47.7	7.7e-19
WP_021358671.1|1262568_1262898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154128177.1|1262897_1264232_+	Zonular occludens toxin	NA	Q4LAU4	Stenotrophomonas_phage	49.2	5.0e-114
WP_038230212.1|1264393_1264705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154128173.1|1264967_1265798_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y5X7	Haemophilus_phage	46.2	5.2e-61
1265827:1265872	attL	CTTTTAATCCGCTGGTCGCTGGTTCGATTCCAGCACGGCCCACCAG	NA	NA	NA	NA
WP_169709952.1|1265891_1267076_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	47.3	6.7e-94
WP_128723906.1|1267075_1267351_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	51.7	2.2e-08
WP_154128441.1|1267369_1267816_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	52.9	1.4e-33
WP_038231394.1|1267882_1268518_-	phage antirepressor protein	NA	A4PE61	Ralstonia_virus	48.0	1.7e-19
WP_169710161.1|1268889_1270542_-	YqaJ viral recombinase family protein	NA	U6C712	Ralstonia_phage	36.6	4.6e-93
WP_154437015.1|1270538_1271459_-	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	49.8	4.1e-59
WP_004086371.1|1271474_1272296_-	DUF2303 family protein	NA	K7ZMK3	Xanthomonas_citri_phage	43.3	2.7e-54
WP_169709949.1|1272317_1272680_-	hypothetical protein	NA	U5P4J6	Shigella_phage	43.8	1.7e-16
WP_169709948.1|1272700_1272892_-	hypothetical protein	NA	C8CLG6	Xylella_phage	71.9	1.3e-15
WP_004086367.1|1273010_1273538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004086365.1|1273581_1273773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154128431.1|1273769_1274177_-	hypothetical protein	NA	C8CLG7	Xylella_phage	82.2	2.6e-53
WP_027700621.1|1274173_1274644_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_038231390.1|1274640_1275078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004086362.1|1275188_1275644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004087046.1|1276037_1276226_+	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_004087040.1|1276222_1276834_+	Fic family protein	NA	NA	NA	NA	NA
WP_169710212.1|1276884_1277559_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	30.1	9.9e-18
WP_169710162.1|1277643_1277889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154128206.1|1278147_1278339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851634.1|1278366_1278555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038231490.1|1278551_1278800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710163.1|1278796_1279180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086911.1|1279382_1280495_+	hypothetical protein	NA	C8CLG1	Xylella_phage	58.6	2.1e-110
WP_004086949.1|1280615_1280906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086942.1|1280961_1282038_+	DUF1376 domain-containing protein	NA	A0A142K7R2	Mycobacterium_phage	60.3	5.4e-18
WP_004086944.1|1281943_1282708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710031.1|1282704_1283166_+	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	42.1	3.6e-11
WP_004086916.1|1283294_1283993_+	hypothetical protein	NA	C8CLH7	Xylella_phage	83.5	3.3e-101
WP_004086917.1|1284156_1284657_+	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	51.1	1.1e-26
WP_004086918.1|1284649_1284979_+|holin	phage holin family protein	holin	A0A172PZR6	Pseudomonas_phage	44.0	5.7e-19
WP_004086919.1|1284968_1285430_+	hypothetical protein	NA	A0A0S0N8C8	Pseudomonas_phage	32.6	4.0e-10
WP_004085111.1|1285431_1285644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020851957.1|1286083_1287634_+|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	44.3	1.6e-111
WP_004087067.1|1288975_1289821_+|head	phage head morphogenesis protein	head	Q7Y5U5	Haemophilus_phage	33.5	1.2e-28
WP_012337902.1|1289820_1291029_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	42.2	3.3e-40
WP_004085013.1|1291038_1291521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038231112.1|1291530_1292514_+	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.0	1.1e-49
WP_169710029.1|1292577_1292949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085010.1|1292951_1293323_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	38.3	5.2e-13
WP_004085009.1|1293319_1293799_+	hypothetical protein	NA	M4SN98	Psychrobacter_phage	29.5	7.8e-09
WP_012337896.1|1293773_1294154_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	40.4	6.5e-19
WP_004085008.1|1294077_1294611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085007.1|1294611_1296108_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	48.4	6.4e-126
WP_004085006.1|1296117_1296555_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	61.0	2.0e-43
WP_004085005.1|1296551_1296974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710164.1|1297121_1299011_+	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	28.0	1.0e-24
WP_004085596.1|1299288_1299549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710165.1|1299908_1300679_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	36.1	1.7e-29
WP_012382585.1|1300678_1300996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085594.1|1300992_1301823_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.5	6.8e-77
WP_169710166.1|1301819_1302461_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	36.8	7.4e-31
WP_004084998.1|1302457_1302811_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	50.4	5.7e-25
WP_004085592.1|1302866_1303160_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	37.9	6.2e-09
WP_004085590.1|1303162_1303459_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	54.7	9.0e-24
WP_169710167.1|1303561_1304707_+|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	49.2	6.2e-97
WP_004084996.1|1304703_1305264_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	26.8	8.5e-07
WP_169710168.1|1305267_1306431_+|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.0	1.9e-08
1310090:1310135	attR	CTTTTAATCCGCTGGTCGCTGGTTCGATTCCAGCACGGCCCACCAG	NA	NA	NA	NA
>prophage 6
NZ_CP052854	Xylella fastidiosa subsp. multiplex strain LM10 chromosome, complete genome	2669650	1311982	1321356	2669650	integrase	Stenotrophomonas_phage(50.0%)	11	1317600:1317635	1319535:1319570
WP_004084066.1|1311982_1313158_+	replication initiation factor domain-containing protein	NA	S0F3F7	Stenotrophomonas_phage	45.8	6.6e-78
WP_038230964.1|1313198_1313510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012337834.1|1313634_1313886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710172.1|1314161_1315493_+	hypothetical protein	NA	Q94MX3	Xanthomonas_phage	47.7	7.9e-19
WP_021358671.1|1315505_1315835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154128177.1|1315834_1317169_+	Zonular occludens toxin	NA	Q4LAU4	Stenotrophomonas_phage	49.2	5.0e-114
WP_038210426.1|1317330_1317558_-	hypothetical protein	NA	NA	NA	NA	NA
1317600:1317635	attL	GGGGGTGTAGGGGGCTAGCCCCCTACGGAGACGCTT	NA	NA	NA	NA
WP_154162046.1|1317824_1318655_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y5X7	Haemophilus_phage	46.2	2.5e-63
WP_169710007.1|1319197_1319548_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	53.1	1.8e-07
WP_154128127.1|1319620_1319860_+	hypothetical protein	NA	NA	NA	NA	NA
1319535:1319570	attR	AAGCGTCTCCGTAGGGGGCTAGCCCCCTACACCCCC	NA	NA	NA	NA
WP_169710173.1|1320021_1321356_-	Zonular occludens toxin	NA	Q4LAU4	Stenotrophomonas_phage	49.7	1.5e-113
>prophage 7
NZ_CP052854	Xylella fastidiosa subsp. multiplex strain LM10 chromosome, complete genome	2669650	1363883	1397173	2669650	holin,integrase	Xylella_phage(93.33%)	37	1371665:1371681	1400344:1400360
WP_145510549.1|1363883_1364138_+	hypothetical protein	NA	C8CLJ4	Xylella_phage	96.4	4.6e-37
WP_128283844.1|1367091_1367799_-	hypothetical protein	NA	C8CLJ1	Xylella_phage	71.5	2.8e-79
WP_071869785.1|1367829_1368075_-	hypothetical protein	NA	C8CLJ0	Xylella_phage	97.2	9.3e-35
WP_154128311.1|1368044_1369973_-	hypothetical protein	NA	C8CLI9	Xylella_phage	96.9	0.0e+00
WP_071869787.1|1369969_1370377_-	hypothetical protein	NA	C8CLI8	Xylella_phage	98.5	7.4e-69
WP_169710015.1|1370397_1371624_-	hypothetical protein	NA	C8CLI7	Xylella_phage	97.8	4.9e-225
1371665:1371681	attL	GTTTAGCGCTTGCGCCG	NA	NA	NA	NA
WP_128283841.1|1371666_1372521_-	hypothetical protein	NA	C8CLI6	Xylella_phage	98.2	1.6e-126
WP_128283854.1|1372522_1374595_-	hypothetical protein	NA	C8CLI5	Xylella_phage	99.0	0.0e+00
WP_145510546.1|1374597_1376013_-	DNA packaging protein	NA	C8CLI4	Xylella_phage	99.4	8.6e-282
WP_071869792.1|1375921_1376248_-	hypothetical protein	NA	C8CLI3	Xylella_phage	99.1	7.8e-53
WP_128283839.1|1376247_1376562_-	hypothetical protein	NA	C8CLI2	Xylella_phage	99.0	4.8e-52
WP_038211741.1|1376889_1377219_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_169710016.1|1377211_1377712_-	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	51.1	3.3e-26
WP_154436993.1|1377811_1378543_-	site-specific DNA-methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	51.3	3.2e-62
WP_169710017.1|1378631_1379354_-	hypothetical protein	NA	C8CLH7	Xylella_phage	95.0	7.8e-122
WP_169710018.1|1380453_1382982_-	DNA primase	NA	C8CLH6	Xylella_phage	75.6	0.0e+00
WP_012337852.1|1383118_1383700_-	phage antirepressor	NA	C8CLH5	Xylella_phage	60.4	1.5e-30
WP_012337854.1|1383959_1384343_-	hypothetical protein	NA	C8CLH2	Xylella_phage	89.7	3.6e-57
WP_021358651.1|1384430_1384760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710019.1|1384749_1384965_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169710020.1|1385003_1385741_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169710179.1|1386028_1386589_+	hypothetical protein	NA	C8CLG9	Xylella_phage	34.8	2.6e-08
WP_128283727.1|1386585_1387047_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_012337859.1|1387043_1387451_+	hypothetical protein	NA	C8CLG7	Xylella_phage	79.3	8.2e-52
WP_004086069.1|1387447_1387639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038233160.1|1387662_1387854_+	hypothetical protein	NA	C8CLG6	Xylella_phage	76.6	3.1e-17
WP_004086187.1|1387885_1388080_+	hypothetical protein	NA	C8CLG5	Xylella_phage	98.4	1.6e-26
WP_169709978.1|1388069_1388567_+	hypothetical protein	NA	C8CLG4	Xylella_phage	95.4	2.6e-52
WP_012337864.1|1388563_1389841_+	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	93.4	5.0e-228
WP_169710149.1|1389840_1390407_+	DUF2815 family protein	NA	C8CLG2	Xylella_phage	95.2	7.8e-101
WP_169710117.1|1390493_1391645_+	hypothetical protein	NA	C8CLG1	Xylella_phage	89.7	6.5e-195
WP_169710150.1|1391646_1393827_+	DNA polymerase	NA	C8CLG0	Xylella_phage	96.4	0.0e+00
WP_169710151.1|1393823_1394102_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	2.8e-43
WP_162522143.1|1394103_1394409_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_169710180.1|1394493_1395912_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.8	1.5e-270
WP_012337666.1|1395908_1396154_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	80.5	1.2e-29
WP_012337868.1|1396153_1397173_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	87.0	6.6e-167
1400344:1400360	attR	CGGCGCAAGCGCTAAAC	NA	NA	NA	NA
>prophage 8
NZ_CP052854	Xylella fastidiosa subsp. multiplex strain LM10 chromosome, complete genome	2669650	1495464	1516128	2669650	head,tail	Haemophilus_phage(36.84%)	24	NA	NA
WP_004084990.1|1495464_1496340_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	4.9e-09
WP_004084992.1|1496336_1497305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004084994.1|1497563_1498010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169710182.1|1498202_1499360_-|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.0	2.5e-08
WP_004084996.1|1499363_1499924_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	26.8	8.5e-07
WP_169709941.1|1501160_1501514_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	50.4	7.4e-25
WP_004084999.1|1501510_1502152_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	36.8	5.7e-31
WP_169709942.1|1502148_1502979_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.5	5.2e-77
WP_012382585.1|1502975_1503293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710078.1|1503292_1504063_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	34.1	2.6e-30
WP_024749166.1|1504150_1504450_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.5	3.9e-19
WP_004085003.1|1504453_1504762_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	46.7	1.4e-16
WP_169710183.1|1504835_1506725_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	27.7	3.1e-24
WP_169710028.1|1506872_1507295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085006.1|1507291_1507729_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	61.0	2.0e-43
WP_128283792.1|1507738_1509235_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	48.6	2.2e-126
WP_012337896.1|1509691_1510072_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	40.4	6.5e-19
WP_004085009.1|1510046_1510526_-	hypothetical protein	NA	M4SN98	Psychrobacter_phage	29.5	7.8e-09
WP_004085010.1|1510522_1510894_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	38.3	5.2e-13
WP_169710029.1|1510896_1511268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038231112.1|1511329_1512313_-	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.0	1.1e-49
WP_012337902.1|1512813_1514022_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	42.2	3.3e-40
WP_004087067.1|1514021_1514867_-|head	phage head morphogenesis protein	head	Q7Y5U5	Haemophilus_phage	33.5	1.2e-28
WP_080513457.1|1514778_1516128_-	DUF1073 domain-containing protein	NA	B5AX38	Iodobacteriophage	37.4	8.2e-64
>prophage 9
NZ_CP052854	Xylella fastidiosa subsp. multiplex strain LM10 chromosome, complete genome	2669650	1533948	1539918	2669650	integrase	Xylella_phage(50.0%)	9	1526111:1526127	1542944:1542960
1526111:1526127	attL	AACCGCGACATTACGTC	NA	NA	NA	NA
WP_004085696.1|1533948_1534287_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	54.9	1.0e-07
WP_004085695.1|1534273_1534534_-	BrnT family toxin	NA	K4NX81	Burkholderia_phage	40.7	5.7e-06
WP_004085694.1|1534722_1535421_-	hypothetical protein	NA	C8CLH7	Xylella_phage	81.7	4.8e-100
WP_169710031.1|1535549_1536011_-	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	42.1	3.6e-11
WP_004085691.1|1536007_1536772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337914.1|1537503_1538019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085686.1|1538392_1538632_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_038231301.1|1538650_1538899_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	86.6	1.9e-35
WP_169710032.1|1538898_1539918_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	88.5	2.4e-169
1542944:1542960	attR	AACCGCGACATTACGTC	NA	NA	NA	NA
>prophage 10
NZ_CP052854	Xylella fastidiosa subsp. multiplex strain LM10 chromosome, complete genome	2669650	1699951	1706073	2669650		Xylella_phage(50.0%)	7	NA	NA
WP_004083461.1|1699951_1700248_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	48.1	3.4e-07
WP_169710044.1|1700244_1700559_-	hypothetical protein	NA	C8CLF7	Xylella_phage	96.1	2.3e-33
WP_038230497.1|1702178_1702457_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	7.3e-44
WP_004085897.1|1702458_1702905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085894.1|1702989_1704402_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.2	2.7e-227
WP_169710045.1|1704741_1705473_+	site-specific DNA-methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	51.7	2.4e-62
WP_012337659.1|1705572_1706073_+	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	51.1	3.3e-26
>prophage 11
NZ_CP052854	Xylella fastidiosa subsp. multiplex strain LM10 chromosome, complete genome	2669650	2090017	2102136	2669650	portal,protease,terminase	Stenotrophomonas_phage(12.5%)	12	NA	NA
WP_004086806.1|2090017_2092333_-|protease	Clp protease ClpP	protease	B7SYD7	Stenotrophomonas_phage	42.3	8.8e-82
WP_004086805.1|2092329_2093892_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	39.0	1.6e-90
WP_004086802.1|2093888_2094263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004086800.1|2094201_2096301_-|terminase	phage terminase large subunit family protein	terminase	A0A1B2LRQ2	Wolbachia_phage	30.6	1.1e-75
WP_020851759.1|2096297_2096897_-	hypothetical protein	NA	A0A2I7S8M0	Vibrio_phage	39.8	5.0e-05
WP_004086794.1|2097293_2098760_-	virulence factor	NA	A0A2D1GN57	Marinobacter_phage	33.1	6.0e-60
WP_004086792.1|2098756_2099812_-	Zn-finger, CHC2 type	NA	A0A1S5RGL3	Helicobacter_phage	41.2	5.1e-13
WP_038231455.1|2099810_2100212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086790.1|2100313_2100937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038231453.1|2100994_2101345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004086788.1|2101331_2101628_-	transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	57.1	4.2e-13
WP_004086786.1|2101704_2102136_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	58.8	5.0e-15
