The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	168204	288472	2678425	integrase,holin,capsid,portal,terminase,tail,tRNA,plate,protease	Xylella_phage(30.91%)	107	171705:171722	263342:263359
WP_004085497.1|168204_169461_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
171705:171722	attL	TAGCTCAGCTGGTAGAGC	NA	NA	NA	NA
WP_004085053.1|176241_177039_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004085052.1|177536_179450_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_004085051.1|179849_180590_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004085050.1|181136_182741_+	peptide chain release factor 3	NA	NA	NA	NA	NA
WP_004085049.1|182823_183468_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_004085048.1|183692_184706_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	44.0	1.9e-73
WP_012337571.1|184994_185777_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_004085046.1|186125_186899_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_021358332.1|187726_188155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085045.1|189520_189916_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_004085044.1|190446_191553_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_021358331.1|191704_192136_-	NfeD family protein	NA	NA	NA	NA	NA
WP_004085042.1|192139_193096_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	28.5	8.2e-18
WP_004085041.1|193430_194264_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_021358329.1|194297_195098_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_004085039.1|195094_195643_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_004085038.1|195684_197142_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	21.8	1.5e-07
WP_169709882.1|197132_197867_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_004085036.1|199461_200802_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.0	1.4e-52
WP_004085035.1|200882_201239_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_004085034.1|202337_202862_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_004085033.1|203386_204016_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_004085032.1|204627_205335_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	27.2	6.3e-07
WP_169709883.1|205480_206500_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	97.3	3.6e-189
WP_169709884.1|206499_206748_-	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	84.1	1.0e-33
WP_169709885.1|206740_206905_-	hypothetical protein	NA	C8CLF6	Xylella_phage	94.4	7.4e-20
WP_169709886.1|206901_208320_-	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	97.0	2.6e-270
WP_169709887.1|208404_208830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086077.1|208831_209110_-	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	5.6e-44
WP_169709888.1|209106_211287_-	DNA polymerase	NA	C8CLG0	Xylella_phage	93.9	0.0e+00
WP_169710109.1|211288_212440_-	hypothetical protein	NA	C8CLG1	Xylella_phage	89.4	1.4e-194
WP_169709889.1|212526_213072_-	DUF2815 family protein	NA	C8CLG2	Xylella_phage	94.5	3.3e-96
WP_021358684.1|214363_214795_-	hypothetical protein	NA	C8CLG4	Xylella_phage	97.2	3.1e-49
WP_169709890.1|214837_215068_-	hypothetical protein	NA	C8CLG5	Xylella_phage	79.7	6.7e-19
WP_169709891.1|215099_215291_-	hypothetical protein	NA	C8CLG6	Xylella_phage	75.0	1.2e-16
WP_004086365.1|215314_215506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709892.1|215502_215904_-	hypothetical protein	NA	C8CLG7	Xylella_phage	88.0	6.6e-62
WP_169709893.1|215900_216371_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_169710110.1|216367_216811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709894.1|216915_217476_-	hypothetical protein	NA	C8CLG9	Xylella_phage	35.7	6.9e-09
WP_169709895.1|217656_218412_-	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	30.8	3.3e-30
WP_024748600.1|218494_218731_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169709896.1|218720_219050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012337854.1|219137_219521_+	hypothetical protein	NA	C8CLH2	Xylella_phage	89.7	3.6e-57
WP_169709897.1|219780_220389_+	hypothetical protein	NA	C8CLH5	Xylella_phage	55.4	4.5e-46
WP_169709898.1|220526_223058_+	DNA primase	NA	C8CLH6	Xylella_phage	73.7	0.0e+00
WP_169709899.1|223409_224027_+	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	52.2	4.0e-26
WP_169709900.1|223993_224488_+	lysozyme	NA	A0A2H5BQB7	Pseudomonas_phage	56.0	2.5e-26
WP_004086884.1|224480_224810_+|holin	phage holin family protein	holin	A0A172PZR6	Pseudomonas_phage	41.7	5.7e-19
WP_169709901.1|224799_225261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169709902.1|225262_225487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169709903.1|225617_226193_+|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	57.4	2.1e-45
WP_169709904.1|226185_228138_+|terminase	phage terminase large subunit family protein	terminase	D5LH04	Escherichia_phage	67.0	1.2e-249
WP_169709905.1|228141_228693_+	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.2	7.5e-40
WP_169709906.1|228689_230276_+|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	51.5	3.7e-132
WP_169709907.1|230272_232147_+|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	48.7	1.9e-164
WP_012337650.1|232164_232425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169709908.1|232424_232748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169709909.1|232744_233272_+	hypothetical protein	NA	D5LGZ7	Escherichia_phage	36.2	3.7e-12
WP_154436958.1|233247_233790_+	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	43.2	8.1e-39
WP_042836490.1|233786_234374_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_004085172.1|234378_234654_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_004085174.1|234664_234946_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	45.2	1.6e-14
WP_004088650.1|235143_235482_+	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	61.3	2.4e-33
WP_038284057.1|235481_236375_+|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	8.6e-70
WP_169709910.1|236367_236925_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	53.9	1.1e-51
WP_169709911.1|236932_238525_+|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	36.6	2.0e-85
WP_038230457.1|238589_239768_+|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	55.4	4.5e-135
WP_004086986.1|239767_240277_+|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	52.7	5.3e-48
WP_169709912.1|240279_240567_+|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	43.4	4.0e-13
WP_169710111.1|240693_242913_+|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	44.9	7.8e-96
WP_169709913.1|242909_243392_+|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	46.8	2.6e-28
WP_040123123.1|243388_243607_+|tail	tail protein	tail	A0A1W6JT40	Escherichia_phage	48.6	2.0e-12
WP_169709914.1|243597_244680_+	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.6	5.7e-92
WP_169709915.1|245098_246028_+|protease	serine protease	protease	NA	NA	NA	NA
WP_143704329.1|246237_246459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086316.1|246785_247385_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004086315.1|247449_247902_+	CopD family protein	NA	NA	NA	NA	NA
WP_012337572.1|248067_249027_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_128723644.1|249121_252703_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.4	5.3e-187
WP_012337574.1|252991_253918_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.7	7.4e-48
WP_004086308.1|254455_254785_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_004086307.1|254829_255501_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027700348.1|256403_257879_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	29.8	3.5e-36
WP_012337576.1|258032_258617_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.7	2.9e-66
WP_004086298.1|258685_259720_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.9	8.7e-74
WP_012337577.1|259804_260599_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	54.6	6.7e-66
WP_004086296.1|260595_261318_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_004086295.1|262302_262809_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004086294.1|264543_265746_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
263342:263359	attR	GCTCTACCAGCTGAGCTA	NA	NA	NA	NA
WP_004086293.1|265933_267760_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_004086289.1|270039_271194_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	6.1e-84
WP_027700344.1|271316_271667_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_004086285.1|271733_273578_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004086283.1|273597_274563_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.8	9.4e-30
WP_169709916.1|274898_276164_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.2	7.8e-24
WP_012337581.1|276163_276682_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004086274.1|276714_277533_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.9	2.2e-35
WP_004086273.1|277529_278375_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_004086272.1|278457_278838_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_004086271.1|278841_280350_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_021358323.1|282103_282703_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004086267.1|282699_284211_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004086265.1|284306_286985_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	21.9	7.6e-21
WP_004086263.1|287095_287473_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004086261.1|287569_288472_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	424526	549001	2678425	integrase,capsid,holin,portal,terminase,tail,plate,protease,tRNA	Escherichia_phage(20.0%)	105	469609:469629	559385:559405
WP_011097581.1|424526_425024_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	36.0	3.7e-06
WP_049756302.1|425031_425514_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_012337622.1|425713_427090_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_004085229.1|427620_428385_-	arginyltransferase	NA	NA	NA	NA	NA
WP_004085228.1|428808_429300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049756303.1|429303_430155_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_004085334.1|431069_431399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709920.1|432524_435401_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_004085225.1|436700_438683_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_004085224.1|439337_441929_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_004085223.1|443829_446856_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004085222.1|446961_448404_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.1	2.0e-47
WP_021358468.1|449553_450861_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_004085220.1|451731_452436_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	38.3	1.0e-25
WP_004085219.1|452492_453650_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011097591.1|453726_454518_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_004085217.1|454539_455022_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_004085216.1|455018_456035_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012337629.1|456222_458577_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_004085214.1|458675_460010_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_169710112.1|460036_461227_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_004085212.1|461223_462078_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004085211.1|462074_462842_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	34.8	1.6e-16
WP_004089320.1|462844_463402_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_004085207.1|465775_466456_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004085206.1|466567_466888_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_004085205.1|468098_468830_-	UMP kinase	NA	NA	NA	NA	NA
WP_004085344.1|469274_469523_+	hypothetical protein	NA	NA	NA	NA	NA
469609:469629	attL	TGCGTCTACCAATTCCGCCAC	NA	NA	NA	NA
WP_004085204.1|470223_470883_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_004085203.1|470979_472896_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_004085202.1|472994_473714_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_004085201.1|473710_474724_-	glucokinase	NA	NA	NA	NA	NA
WP_021358465.1|474720_476154_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.2	5.8e-68
WP_012337631.1|476482_477577_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	2.1e-25
WP_004085198.1|477721_478525_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_004085343.1|478837_479056_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_021358463.1|479113_479536_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004085197.1|479532_479916_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_169709921.1|479923_481714_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004085195.1|481734_482520_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004085194.1|482640_482889_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_012337633.1|482911_483292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085192.1|483317_484559_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004085191.1|484551_485274_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.2	1.6e-34
WP_012337634.1|485621_488099_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	34.3	1.4e-05
WP_004085189.1|488083_488746_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_004089267.1|488750_489188_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_004085187.1|489205_490954_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.8	5.7e-49
WP_004085186.1|490950_491970_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_012337635.1|492344_493427_-	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.6	5.7e-92
WP_004085341.1|493417_493636_-|tail	tail protein	tail	A0A1W6JT40	Escherichia_phage	50.0	3.1e-13
WP_169709922.1|493632_494115_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	47.6	8.9e-29
WP_012337638.1|496455_496743_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	44.6	1.4e-13
WP_128283754.1|496745_497255_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	53.9	1.4e-48
WP_154436952.1|497254_498433_-|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	55.2	1.7e-134
WP_169709923.1|498496_500089_-|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	35.7	1.0e-81
WP_004086970.1|500096_500654_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	6.6e-52
WP_004085178.1|500646_501540_-|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	8.6e-70
WP_004088650.1|501539_501878_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	61.3	2.4e-33
WP_004086967.1|502027_502291_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_004086966.1|502277_502559_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_128283746.1|502595_503183_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_154436958.1|503179_503722_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	43.2	8.1e-39
WP_154436960.1|503697_504219_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.5	1.3e-12
WP_169709908.1|504215_504539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337650.1|504538_504799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154436964.1|504816_506691_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	48.6	1.6e-163
WP_154436966.1|506687_508274_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	51.3	1.4e-131
WP_012337653.1|508270_508819_-	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.7	4.4e-40
WP_012337655.1|510766_511342_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	58.0	9.5e-46
WP_012337656.1|511472_511697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709924.1|511698_512160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085022.1|512149_512479_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_128382956.1|512471_512972_-	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	51.1	7.3e-26
WP_169709925.1|513071_513803_-	site-specific DNA-methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	53.0	8.4e-63
WP_004085025.1|513992_514328_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_004089517.1|514324_514579_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012337661.1|514631_515354_-	hypothetical protein	NA	C8CLH7	Xylella_phage	82.1	3.0e-105
WP_038230497.1|517096_517375_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	7.3e-44
WP_004085029.1|517376_517781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709926.1|517865_519284_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.4	7.1e-268
WP_004086189.1|519280_519445_+	hypothetical protein	NA	C8CLF6	Xylella_phage	96.3	6.7e-21
WP_004086191.1|519437_519686_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	89.0	2.2e-36
WP_169709927.1|519685_520705_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	90.6	2.4e-172
WP_004085684.1|521481_522123_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	40.7	3.4e-12
WP_004085683.1|522150_522627_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_004085682.1|522631_523204_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_038231298.1|523200_525159_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_071869548.1|526143_526536_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_154128479.1|526869_527118_+	hypothetical protein	NA	C8CLH6	Xylella_phage	45.5	9.2e-06
WP_004085680.1|527806_528292_-	asparaginase	NA	NA	NA	NA	NA
WP_004085679.1|528534_529134_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004085726.1|529535_529679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085678.1|529708_530893_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	34.3	1.4e-51
WP_004085677.1|531081_531657_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027700073.1|533010_533304_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_169709928.1|533388_536160_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.7	1.3e-63
WP_012337670.1|536816_537530_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_031345756.1|537727_538852_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	A0A0P0IKJ1	Acinetobacter_phage	25.1	1.8e-08
WP_004085673.1|539050_542293_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_027700071.1|542301_542766_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_004085671.1|542773_543694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161632202.1|543696_545505_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_169709929.1|546172_547297_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	3.4e-07
WP_004085668.1|547480_549001_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.1	5.0e-86
559385:559405	attR	TGCGTCTACCAATTCCGCCAC	NA	NA	NA	NA
>prophage 3
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	674597	692363	2678425	head,tail,plate	Haemophilus_phage(33.33%)	24	NA	NA
WP_169709939.1|674597_675761_-|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.0	2.5e-08
WP_004084996.1|675764_676325_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	26.8	8.5e-07
WP_169709940.1|676321_677467_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	49.2	2.8e-97
WP_004085590.1|677569_677866_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	54.7	9.0e-24
WP_004085592.1|677868_678162_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	37.9	6.2e-09
WP_169709941.1|678217_678571_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	50.4	7.4e-25
WP_004084999.1|678567_679209_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	36.8	5.7e-31
WP_169709942.1|679205_680036_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.5	5.2e-77
WP_012382585.1|680032_680350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709943.1|680349_681120_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	33.7	1.7e-29
WP_024749166.1|681207_681507_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.5	3.9e-19
WP_004085003.1|681510_681819_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	46.7	1.4e-16
WP_169709944.1|681892_683782_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	27.7	3.1e-24
WP_004085006.1|684347_684785_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	61.0	2.0e-43
WP_128283792.1|684794_686291_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	48.6	2.2e-126
WP_004085008.1|686291_686825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337896.1|686748_687129_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	40.4	6.5e-19
WP_004085009.1|687103_687583_-	hypothetical protein	NA	M4SN98	Psychrobacter_phage	29.5	7.8e-09
WP_004085010.1|687579_687951_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	38.3	5.2e-13
WP_038231112.1|688386_689370_-	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.0	1.1e-49
WP_004085013.1|689379_689862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337902.1|689871_691080_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	42.2	3.3e-40
WP_004087067.1|691079_691925_-|head	phage head morphogenesis protein	head	Q7Y5U5	Haemophilus_phage	33.5	1.2e-28
WP_169709875.1|691967_692363_-	DUF1073 domain-containing protein	NA	N0DQN3	Edwardsiella_phage	48.6	1.1e-21
>prophage 4
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	695918	701820	2678425	holin	Xylella_phage(33.33%)	8	NA	NA
WP_004086918.1|695918_696248_-|holin	phage holin family protein	holin	A0A172PZR6	Pseudomonas_phage	44.0	5.7e-19
WP_004086917.1|696240_696741_-	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	51.1	1.1e-26
WP_004086916.1|696906_697605_-	hypothetical protein	NA	C8CLH7	Xylella_phage	83.5	3.3e-101
WP_004085693.1|697733_698144_-	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	43.0	2.4e-11
WP_004086915.1|698149_699610_-	replicative DNA helicase	NA	O80281	Escherichia_phage	39.3	9.8e-71
WP_169709945.1|699606_700449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128283781.1|700450_700729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709946.1|700707_701820_-	hypothetical protein	NA	C8CLG1	Xylella_phage	60.0	5.1e-112
>prophage 5
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	707805	717739	2678425	integrase	Xylella_phage(27.27%)	15	711777:711790	716550:716563
WP_154128431.1|707805_708213_+	hypothetical protein	NA	C8CLG7	Xylella_phage	82.2	2.6e-53
WP_004086365.1|708209_708401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086367.1|708444_708972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169709948.1|709090_709282_+	hypothetical protein	NA	C8CLG6	Xylella_phage	71.9	1.3e-15
WP_169709949.1|709302_709665_+	hypothetical protein	NA	U5P4J6	Shigella_phage	43.8	1.7e-16
WP_004086371.1|709686_710508_+	DUF2303 family protein	NA	K7ZMK3	Xanthomonas_citri_phage	43.3	2.7e-54
WP_169709950.1|710564_711443_+	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	49.8	3.0e-59
WP_169709951.1|711439_713092_+	YqaJ viral recombinase family protein	NA	U6C712	Ralstonia_phage	37.1	4.2e-94
711777:711790	attL	TCAATGACACGATT	NA	NA	NA	NA
WP_038231394.1|713463_714099_+	phage antirepressor protein	NA	A4PE61	Ralstonia_virus	48.0	1.7e-19
WP_154128441.1|714165_714612_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	52.9	1.4e-33
WP_128723906.1|714630_714906_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	51.7	2.2e-08
WP_169709952.1|714905_716090_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	47.3	6.7e-94
WP_120279367.1|716825_716981_+	hypothetical protein	NA	NA	NA	NA	NA
716550:716563	attR	TCAATGACACGATT	NA	NA	NA	NA
WP_004084058.1|716977_717286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004084284.1|717601_717739_+	hypothetical protein	NA	C8CLI3	Xylella_phage	62.8	2.3e-06
>prophage 6
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	790373	798809	2678425	portal,transposase	Pseudomonas_phage(33.33%)	8	NA	NA
WP_004083947.1|790373_790889_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	32.8	7.3e-13
WP_004083943.1|791847_792084_+	hypothetical protein	NA	A0A0A1IV01	Pseudomonas_phage	53.0	6.3e-12
WP_169709956.1|792073_794899_+	hypothetical protein	NA	A0A1L2C8W7	Pseudomonas_phage	29.0	4.8e-58
WP_169709957.1|794891_795404_+	hypothetical protein	NA	G8CLC0	Synechococcus_phage	31.2	1.4e-08
WP_004083636.1|795407_795827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086766.1|795902_796598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038230952.1|796992_797619_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	62.9	1.4e-63
WP_004083925.1|797612_798809_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	38.9	4.5e-66
>prophage 7
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	927359	1018962	2678425	integrase,capsid,holin,terminase,tail,plate,protease,tRNA	Xylella_phage(31.25%)	95	977384:977400	1019065:1019081
WP_004083753.1|927359_928499_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004083752.1|928495_928954_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004083751.1|929133_929454_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.0	4.2e-11
WP_004083750.1|929586_931863_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.7	1.2e-168
WP_004083749.1|932205_932424_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004083748.1|932540_933275_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_012337768.1|933286_934423_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004083746.1|934851_935817_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.0	4.5e-64
WP_004083745.1|936085_938440_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.1	1.4e-82
WP_004083744.1|938624_940535_+	DUF3857 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_049756311.1|941097_941724_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_169709967.1|941855_943223_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	36.9	5.9e-70
WP_004083741.1|943383_943785_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_128283905.1|944460_945957_+	response regulator	NA	A0A2K9L0Z8	Tupanvirus	36.1	2.1e-07
WP_031345731.1|946082_946598_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004083738.1|946608_947346_-	pteridine reductase	NA	NA	NA	NA	NA
WP_004083737.1|947426_948611_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004083736.1|948598_949015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004083735.1|949034_950039_-	glucokinase	NA	NA	NA	NA	NA
WP_021358212.1|950465_950651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004083734.1|950742_952032_+	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
WP_004083733.1|952035_953112_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004083732.1|953108_954149_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_004083731.1|954148_955306_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_169709968.1|955982_956879_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_020852600.1|956875_958222_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_004083728.1|958305_959160_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004083727.1|959156_960302_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004083726.1|960816_961146_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_012337770.1|961249_962500_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	37.9	8.6e-84
WP_004083725.1|962487_963756_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_027699983.1|963755_964592_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.6	1.9e-10
WP_169709969.1|964738_966196_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004084097.1|966216_966678_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_004083722.1|966841_967309_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_004083721.1|968105_970259_+	S9 family peptidase	NA	F2Y2Z7	Organic_Lake_phycodnavirus	37.1	3.7e-26
WP_004083720.1|970361_970574_+	lipoprotein	NA	NA	NA	NA	NA
WP_004083719.1|970583_971438_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_004083718.1|971434_972106_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_021358210.1|972129_973014_+	tyrosine recombinase XerC	NA	A0A0K0N6I5	Gordonia_phage	33.8	7.1e-16
WP_004083716.1|973598_974150_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_012337775.1|974217_975597_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	30.2	1.7e-40
WP_012337776.1|975817_977173_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
977384:977400	attL	CTTATGATGGCGGTACA	NA	NA	NA	NA
WP_128283903.1|977788_978796_-	peptidase	NA	NA	NA	NA	NA
WP_012337635.1|979076_980159_-	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.6	5.7e-92
WP_004085341.1|980149_980368_-|tail	tail protein	tail	A0A1W6JT40	Escherichia_phage	50.0	3.1e-13
WP_169709922.1|980364_980847_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	47.6	8.9e-29
WP_169710116.1|980843_983033_-|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	47.2	1.9e-102
WP_012337638.1|983188_983476_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	44.6	1.4e-13
WP_128283754.1|983478_983988_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	53.9	1.4e-48
WP_004086970.1|986824_987382_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	6.6e-52
WP_004085178.1|987374_988268_-|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	8.6e-70
WP_004088650.1|988267_988606_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	61.3	2.4e-33
WP_004087029.1|988739_989054_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	O64357	Escherichia_phage	30.4	1.6e-07
WP_004087027.1|989055_989337_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_004087025.1|989348_989648_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	49.4	1.2e-15
WP_169709970.1|989652_990240_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	31.4	5.4e-20
WP_154436958.1|990236_990779_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	43.2	8.1e-39
WP_154436960.1|990754_991276_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.5	1.3e-12
WP_169709908.1|991272_991596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337650.1|991595_991856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154436964.1|991873_993748_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	48.6	1.6e-163
WP_012337653.1|995326_995875_-	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.7	4.4e-40
WP_169709971.1|995878_997831_-|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	66.9	4.9e-251
WP_012337655.1|997823_998399_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	58.0	9.5e-46
WP_012337656.1|998528_998753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709972.1|998754_999216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085022.1|999205_999535_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_169709973.1|999527_1000028_-	lysozyme	NA	I2GUG4	Acinetobacter_phage	52.1	8.6e-27
WP_169709899.1|999994_1000612_-	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	52.2	4.0e-26
WP_169709974.1|1001601_1004133_-	DNA primase	NA	C8CLH6	Xylella_phage	75.0	0.0e+00
WP_169709975.1|1004270_1004879_-	hypothetical protein	NA	C8CLH5	Xylella_phage	56.5	2.2e-48
WP_076613265.1|1004875_1005160_-	hypothetical protein	NA	C8CLH4	Xylella_phage	64.8	1.2e-22
WP_004085338.1|1005156_1005405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085135.1|1005401_1005590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709976.1|1005643_1005868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038231150.1|1005857_1006058_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_004085133.1|1006131_1006902_+	helix-turn-helix transcriptional regulator	NA	C8CLH0	Xylella_phage	40.7	5.6e-33
WP_004085336.1|1006935_1007532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169709977.1|1007712_1008273_+	hypothetical protein	NA	C8CLG9	Xylella_phage	34.8	2.6e-08
WP_128283727.1|1008269_1008731_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_012337859.1|1008727_1009135_+	hypothetical protein	NA	C8CLG7	Xylella_phage	79.3	8.2e-52
WP_004086069.1|1009131_1009323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038233160.1|1009346_1009538_+	hypothetical protein	NA	C8CLG6	Xylella_phage	76.6	3.1e-17
WP_004086187.1|1009569_1009764_+	hypothetical protein	NA	C8CLG5	Xylella_phage	98.4	1.6e-26
WP_169709978.1|1009753_1010251_+	hypothetical protein	NA	C8CLG4	Xylella_phage	95.4	2.6e-52
WP_012337864.1|1010247_1011525_+	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	93.4	5.0e-228
WP_169709979.1|1011524_1012091_+	DUF2815 family protein	NA	C8CLG2	Xylella_phage	95.7	3.5e-101
WP_169710117.1|1012177_1013329_+	hypothetical protein	NA	C8CLG1	Xylella_phage	89.7	6.5e-195
WP_169709980.1|1013330_1015511_+	DNA polymerase	NA	C8CLG0	Xylella_phage	96.3	0.0e+00
WP_169709981.1|1015507_1015786_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	8.1e-43
WP_162522143.1|1015787_1016093_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_169709982.1|1016177_1017596_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.6	9.9e-270
WP_169709983.1|1017592_1017889_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	48.1	4.5e-07
WP_169709984.1|1017900_1018962_+|integrase	integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	54.1	5.8e-97
1019065:1019081	attR	CTTATGATGGCGGTACA	NA	NA	NA	NA
>prophage 8
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	1103582	1123988	2678425	integrase,holin	Xylella_phage(72.22%)	20	1090319:1090332	1105670:1105683
1090319:1090332	attL	TTAGCGGGCAATAC	NA	NA	NA	NA
WP_004083657.1|1103582_1104602_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	90.0	1.5e-171
WP_049756312.1|1104909_1105350_+	SocA family protein	NA	K4NZT7	Burkholderia_phage	33.3	9.9e-11
WP_169709988.1|1105446_1105989_-	pilin	NA	NA	NA	NA	NA
1105670:1105683	attR	TTAGCGGGCAATAC	NA	NA	NA	NA
WP_004084093.1|1106228_1106582_-	hypothetical protein	NA	C8CLJ8	Xylella_phage	54.7	3.4e-22
WP_004083654.1|1106578_1107361_-	hypothetical protein	NA	C8CLJ7	Xylella_phage	66.0	4.5e-91
WP_080513455.1|1108029_1108419_-	hypothetical protein	NA	C8CLJ3	Xylella_phage	61.2	1.2e-28
WP_004083651.1|1108859_1110071_-	hypothetical protein	NA	C8CLJ2	Xylella_phage	61.7	1.6e-119
WP_012337788.1|1110074_1110830_-	hypothetical protein	NA	C8CLJ1	Xylella_phage	72.5	2.7e-56
WP_169709989.1|1110879_1111125_-	hypothetical protein	NA	C8CLJ0	Xylella_phage	79.2	2.9e-28
WP_004083648.1|1112759_1113167_-	hypothetical protein	NA	C8CLI8	Xylella_phage	60.3	2.5e-32
WP_004083647.1|1113170_1114400_-	hypothetical protein	NA	C8CLI7	Xylella_phage	71.8	3.0e-166
WP_004083646.1|1114437_1115295_-	hypothetical protein	NA	C8CLI6	Xylella_phage	49.3	1.7e-46
WP_004083645.1|1115314_1117336_-	hypothetical protein	NA	C8CLI5	Xylella_phage	77.7	3.2e-298
WP_004083644.1|1117338_1118757_-	DNA packaging protein	NA	C8CLI4	Xylella_phage	80.6	3.0e-234
WP_021358615.1|1118662_1118989_-	hypothetical protein	NA	C8CLI3	Xylella_phage	63.9	3.1e-33
WP_004083643.1|1119739_1120093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004083642.1|1120094_1120409_-|holin	phage holin family protein	holin	A0A172PZR6	Pseudomonas_phage	32.3	6.2e-07
WP_012337789.1|1120401_1120896_-	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	53.8	2.6e-28
WP_004083639.1|1120995_1121517_-	site-specific DNA-methyltransferase	NA	A0A097EWK8	Mycobacterium_phage	53.2	8.6e-38
WP_128283765.1|1121501_1123988_+	hypothetical protein	NA	A0A2D2W222	Stenotrophomonas_phage	31.1	3.8e-59
>prophage 9
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	1349631	1379847	2678425	holin	Xylella_phage(92.0%)	31	NA	NA
WP_145510549.1|1349631_1349886_+	hypothetical protein	NA	C8CLJ4	Xylella_phage	96.4	4.6e-37
WP_128283844.1|1352839_1353547_-	hypothetical protein	NA	C8CLJ1	Xylella_phage	71.5	2.8e-79
WP_071869785.1|1353577_1353823_-	hypothetical protein	NA	C8CLJ0	Xylella_phage	97.2	9.3e-35
WP_154128311.1|1353792_1355721_-	hypothetical protein	NA	C8CLI9	Xylella_phage	96.9	0.0e+00
WP_071869787.1|1355717_1356125_-	hypothetical protein	NA	C8CLI8	Xylella_phage	98.5	7.4e-69
WP_169710015.1|1356145_1357372_-	hypothetical protein	NA	C8CLI7	Xylella_phage	97.8	4.9e-225
WP_128283841.1|1357414_1358269_-	hypothetical protein	NA	C8CLI6	Xylella_phage	98.2	1.6e-126
WP_128283854.1|1358270_1360343_-	hypothetical protein	NA	C8CLI5	Xylella_phage	99.0	0.0e+00
WP_145510546.1|1360345_1361761_-	DNA packaging protein	NA	C8CLI4	Xylella_phage	99.4	8.6e-282
WP_071869792.1|1361669_1361996_-	hypothetical protein	NA	C8CLI3	Xylella_phage	99.1	7.8e-53
WP_128283839.1|1361995_1362310_-	hypothetical protein	NA	C8CLI2	Xylella_phage	99.0	4.8e-52
WP_038211741.1|1362637_1362967_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_169710016.1|1362959_1363460_-	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	51.1	3.3e-26
WP_154436993.1|1363559_1364291_-	site-specific DNA-methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	51.3	3.2e-62
WP_169710017.1|1364379_1365102_-	hypothetical protein	NA	C8CLH7	Xylella_phage	95.0	7.8e-122
WP_169710018.1|1366201_1368730_-	DNA primase	NA	C8CLH6	Xylella_phage	75.6	0.0e+00
WP_012337852.1|1368866_1369448_-	phage antirepressor	NA	C8CLH5	Xylella_phage	60.4	1.5e-30
WP_012337854.1|1369707_1370091_-	hypothetical protein	NA	C8CLH2	Xylella_phage	89.7	3.6e-57
WP_021358651.1|1370178_1370508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710019.1|1370497_1370713_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169710020.1|1370751_1371489_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169709977.1|1371776_1372337_+	hypothetical protein	NA	C8CLG9	Xylella_phage	34.8	2.6e-08
WP_128283727.1|1372333_1372795_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_012337859.1|1372791_1373199_+	hypothetical protein	NA	C8CLG7	Xylella_phage	79.3	8.2e-52
WP_004086069.1|1373195_1373387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038233160.1|1373410_1373602_+	hypothetical protein	NA	C8CLG6	Xylella_phage	76.6	3.1e-17
WP_004086187.1|1373633_1373828_+	hypothetical protein	NA	C8CLG5	Xylella_phage	98.4	1.6e-26
WP_169709978.1|1373817_1374315_+	hypothetical protein	NA	C8CLG4	Xylella_phage	95.4	2.6e-52
WP_169710021.1|1375607_1376153_+	DUF2815 family protein	NA	C8CLG2	Xylella_phage	95.0	3.0e-97
WP_169710117.1|1376239_1377391_+	hypothetical protein	NA	C8CLG1	Xylella_phage	89.7	6.5e-195
WP_169710022.1|1379568_1379847_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	94.5	7.3e-44
>prophage 10
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	1485111	1501701	2678425	head,plate	Haemophilus_phage(37.5%)	21	NA	NA
WP_004084996.1|1485111_1485672_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	26.8	8.5e-07
WP_169710027.1|1485668_1486814_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	49.5	9.6e-98
WP_169709941.1|1486906_1487260_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	50.4	7.4e-25
WP_004084999.1|1487256_1487898_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	36.8	5.7e-31
WP_169709942.1|1487894_1488725_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.5	5.2e-77
WP_012382585.1|1488721_1489039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169709943.1|1489038_1489809_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	33.7	1.7e-29
WP_004091377.1|1489919_1490147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004087087.1|1490130_1490397_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	41.9	2.3e-15
WP_169709944.1|1490407_1492297_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	27.7	3.1e-24
WP_169710028.1|1492444_1492867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085006.1|1492863_1493301_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	61.0	2.0e-43
WP_004085008.1|1494805_1495339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337896.1|1495262_1495643_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	40.4	6.5e-19
WP_004085009.1|1495617_1496097_-	hypothetical protein	NA	M4SN98	Psychrobacter_phage	29.5	7.8e-09
WP_004085010.1|1496093_1496465_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	38.3	5.2e-13
WP_169710029.1|1496467_1496839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038231112.1|1496902_1497886_-	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.0	1.1e-49
WP_012337902.1|1498386_1499595_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	42.2	3.3e-40
WP_004087067.1|1499594_1500440_-|head	phage head morphogenesis protein	head	Q7Y5U5	Haemophilus_phage	33.5	1.2e-28
WP_080513457.1|1500351_1501701_-	DUF1073 domain-containing protein	NA	B5AX38	Iodobacteriophage	37.4	8.2e-64
>prophage 11
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	1702335	1708457	2678425		Xylella_phage(50.0%)	7	NA	NA
WP_004083461.1|1702335_1702632_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	48.1	3.4e-07
WP_169710044.1|1702628_1702943_-	hypothetical protein	NA	C8CLF7	Xylella_phage	96.1	2.3e-33
WP_169710022.1|1704562_1704841_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	94.5	7.3e-44
WP_004085897.1|1704842_1705289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085894.1|1705373_1706786_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.2	2.7e-227
WP_169710045.1|1707125_1707857_+	site-specific DNA-methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	51.7	2.4e-62
WP_012337659.1|1707956_1708457_+	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	51.1	3.3e-26
>prophage 12
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	2361124	2379018	2678425	capsid,tail,plate	Haemophilus_phage(38.89%)	23	NA	NA
WP_169710075.1|2361124_2362288_-|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.0	2.5e-08
WP_169710076.1|2362291_2362852_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	26.1	5.5e-06
WP_004084997.1|2362848_2363994_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	49.2	7.4e-98
WP_004084998.1|2364086_2364440_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	50.4	5.7e-25
WP_169709942.1|2365073_2365904_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.5	5.2e-77
WP_169710077.1|2365900_2366218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169710078.1|2366217_2366988_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	34.1	2.6e-30
WP_024749166.1|2367075_2367375_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.5	3.9e-19
WP_004085003.1|2367378_2367687_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	46.7	1.4e-16
WP_169710079.1|2367760_2369650_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	27.1	5.8e-23
WP_169710080.1|2369797_2370220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085006.1|2370216_2370654_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	61.0	2.0e-43
WP_004085007.1|2370663_2372160_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	48.4	6.4e-126
WP_004085008.1|2372160_2372694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337896.1|2372617_2372998_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	40.4	6.5e-19
WP_004085009.1|2372972_2373452_-	hypothetical protein	NA	M4SN98	Psychrobacter_phage	29.5	7.8e-09
WP_004085010.1|2373448_2373820_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	38.3	5.2e-13
WP_169710081.1|2373822_2374158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038231112.1|2374221_2375205_-	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.0	1.1e-49
WP_004085013.1|2375214_2375697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337902.1|2375706_2376915_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	42.2	3.3e-40
WP_169710082.1|2376914_2377760_-|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	33.1	5.9e-28
WP_169710126.1|2377671_2379018_-	DUF1073 domain-containing protein	NA	B5AX38	Iodobacteriophage	37.1	1.8e-63
>prophage 13
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	2382075	2388794	2678425		Xylella_phage(42.86%)	9	NA	NA
WP_169710083.1|2382075_2382576_-	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	50.4	9.5e-26
WP_169710084.1|2382742_2383441_-	hypothetical protein	NA	C8CLH7	Xylella_phage	83.5	2.5e-101
WP_169710031.1|2383569_2384031_-	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	42.1	3.6e-11
WP_004086944.1|2384027_2384792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004086942.1|2384697_2385774_-	DUF1376 domain-containing protein	NA	A0A142K7R2	Mycobacterium_phage	60.3	5.4e-18
WP_004086949.1|2385829_2386120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004086911.1|2386240_2387353_-	hypothetical protein	NA	C8CLG1	Xylella_phage	58.6	2.1e-110
WP_169710085.1|2387382_2388195_-	hypothetical protein	NA	A4PE61	Ralstonia_virus	46.3	2.0e-20
WP_169710086.1|2388191_2388794_-	hypothetical protein	NA	C8CLH5	Xylella_phage	57.9	2.6e-30
>prophage 14
NZ_CP052853	Xylella fastidiosa subsp. multiplex strain RH1 chromosome, complete genome	2678425	2394116	2403285	2678425	integrase	Xylella_phage(45.45%)	14	2401776:2401789	2403392:2403405
WP_169710091.1|2394116_2394551_+	hypothetical protein	NA	C8CLG9	Xylella_phage	43.4	4.5e-16
WP_027700621.1|2394547_2395018_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_154437007.1|2395014_2395422_+	hypothetical protein	NA	C8CLG7	Xylella_phage	80.0	2.8e-52
WP_004086069.1|2395418_2395610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004086367.1|2395653_2396181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154128433.1|2396299_2396491_+	hypothetical protein	NA	C8CLG6	Xylella_phage	73.4	1.7e-15
WP_004086369.1|2396511_2396874_+	hypothetical protein	NA	U5P4J6	Shigella_phage	43.8	1.7e-16
WP_004086371.1|2396895_2397717_+	DUF2303 family protein	NA	K7ZMK3	Xanthomonas_citri_phage	43.3	2.7e-54
WP_004086373.1|2397732_2398653_+	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	49.8	4.1e-59
WP_169710092.1|2398649_2400284_+	YqaJ viral recombinase family protein	NA	U6C712	Ralstonia_phage	37.9	3.7e-95
WP_169710127.1|2400655_2401486_+	hypothetical protein	NA	Q3LZN7	Bacteriophage	47.5	3.6e-22
WP_154128441.1|2401552_2401999_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	52.9	1.4e-33
2401776:2401789	attL	AGTGCTACATAGAG	NA	NA	NA	NA
WP_020852417.1|2402017_2402266_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	93.9	1.2e-37
WP_154128443.1|2402265_2403285_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	97.6	2.8e-189
2403392:2403405	attR	AGTGCTACATAGAG	NA	NA	NA	NA
