The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048833	Pseudomonas multiresinivorans strain populi chromosome, complete genome	6517592	62888	86843	6517592	transposase,protease,tRNA	Lactococcus_phage(20.0%)	22	NA	NA
WP_169934947.1|62888_63425_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_169934948.1|63559_64459_+	acyltransferase	NA	NA	NA	NA	NA
WP_169934949.1|64465_65020_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_169934950.1|65117_65660_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_169934951.1|65948_67385_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_169934952.1|67385_67898_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_169934953.1|68009_68219_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	58.1	2.8e-16
WP_169934954.1|68542_69919_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	7.6e-49
WP_169934955.1|70128_72324_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_169934956.1|72443_73178_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_169934957.1|73242_74016_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_169934958.1|74196_75465_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_169934959.1|75568_77020_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_169934960.1|77016_77769_-	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	32.6	1.9e-06
WP_024766509.1|77845_78061_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_169934961.1|78236_80498_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_169934962.1|80703_82443_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	35.1	1.8e-87
WP_169934963.1|82449_83262_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_037013407.1|83396_83933_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_084358347.1|83962_85303_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.3	1.3e-45
WP_169934964.1|85396_85768_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_169934965.1|85901_86843_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP048833	Pseudomonas multiresinivorans strain populi chromosome, complete genome	6517592	607984	672318	6517592	protease,holin,tRNA	Bacillus_virus(30.0%)	59	NA	NA
WP_169935327.1|607984_609352_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_169935328.1|609898_611791_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_169935329.1|611790_612441_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_024765005.1|612459_613248_+	ParA family protein	NA	Q8JL10	Natrialba_phage	30.4	5.9e-22
WP_169935330.1|613265_614138_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.7	2.5e-13
WP_169935331.1|614288_614696_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_169935332.1|614712_615582_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003457994.1|615692_615950_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017518842.1|616002_616473_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_045213782.1|616485_617022_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017518840.1|617040_618585_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_017518839.1|618637_619498_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_045213787.1|619528_620905_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017518837.1|620945_621371_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_169935333.1|621482_622850_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L277	Tupanvirus	33.9	8.7e-29
WP_017518835.1|622968_623556_+	membrane protein	NA	NA	NA	NA	NA
WP_169935334.1|623578_624361_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_169935335.1|624357_626151_-	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	30.5	1.3e-19
WP_169935336.1|626147_627494_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_169935337.1|627721_628576_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_054907597.1|628608_629043_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_169935338.1|629321_629639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017518828.1|629813_629975_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_054907599.1|630015_630486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169935339.1|630675_631335_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_169935340.1|632000_633350_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_169935341.1|633458_634688_+	spore maturation protein	NA	NA	NA	NA	NA
WP_169942494.1|634669_635245_-|protease	serine protease	protease	NA	NA	NA	NA
WP_169935342.1|635751_637041_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	37.5	7.8e-72
WP_054907604.1|637165_637717_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_169935343.1|637740_639114_-	insulinase family protein	NA	NA	NA	NA	NA
WP_169935344.1|639320_640277_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_169935345.1|640347_641382_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_169935346.1|641478_643203_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_169935347.1|643558_644866_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_045213830.1|644883_645357_+	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_169935348.1|645443_646205_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-36
WP_054907612.1|646237_647542_-	CitMHS family transporter	NA	NA	NA	NA	NA
WP_169935349.1|647931_648894_-	AEC family transporter	NA	NA	NA	NA	NA
WP_169935350.1|648979_651385_-	carbohydrate-binding family V/XII	NA	NA	NA	NA	NA
WP_169935351.1|651703_652678_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024764976.1|652735_653542_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	33.6	8.1e-27
WP_024764975.1|653529_654363_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	2.3e-32
WP_169935352.1|654537_656166_+	alcohol dehydrogenase	NA	A0A1V0S9J5	Catovirus	27.6	4.2e-46
WP_169935353.1|656353_656824_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_169935354.1|657032_658010_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_169935355.1|658234_659173_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_169935356.1|659246_660131_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_169935357.1|660273_661239_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_169935358.1|661339_661813_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_169935359.1|661819_662749_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024766693.1|663015_663267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169935360.1|663291_664749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024766695.1|664908_666015_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_169935361.1|666400_667777_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_169935362.1|668125_669064_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_169935363.1|669302_670241_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_169935364.1|670294_671134_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_169935365.1|671139_672318_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.6	1.3e-25
>prophage 3
NZ_CP048833	Pseudomonas multiresinivorans strain populi chromosome, complete genome	6517592	1704857	1718743	6517592	capsid,integrase	Pseudomonas_phage(77.78%)	13	1697624:1697670	1720205:1720251
1697624:1697670	attL	ATGGTGGCTACACCGGGACTTGAACCTGGGACATCAGCATTATGAAT	NA	NA	NA	NA
WP_169942552.1|1704857_1705190_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	44.8	1.1e-17
WP_169936587.1|1705768_1706185_+	DNA-binding protein	NA	Q56VP5	Pseudomonas_phage	64.4	1.1e-40
WP_169936589.1|1706201_1706423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169936591.1|1706424_1706676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169936593.1|1706688_1706940_+|capsid	major capsid protein	capsid	Q56VP2	Pseudomonas_phage	81.9	6.6e-28
WP_169936594.1|1707086_1708397_+	attachment protein	NA	Q56VP1	Pseudomonas_phage	60.5	1.3e-21
WP_084358758.1|1708402_1708759_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	83.9	1.1e-49
WP_169936595.1|1708762_1710052_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	78.2	2.9e-191
WP_169936596.1|1710291_1711584_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	78.0	1.4e-209
WP_169936597.1|1711580_1712573_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	46.9	3.6e-77
WP_169936598.1|1712731_1713115_-	DUF4279 domain-containing protein	NA	NA	NA	NA	NA
WP_169936599.1|1713551_1714145_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_169936600.1|1714156_1718743_-	RHS repeat protein	NA	S5VY91	Leptospira_phage	32.6	2.8e-07
1720205:1720251	attR	ATGGTGGCTACACCGGGACTTGAACCTGGGACATCAGCATTATGAAT	NA	NA	NA	NA
>prophage 4
NZ_CP048833	Pseudomonas multiresinivorans strain populi chromosome, complete genome	6517592	2258923	2268391	6517592	capsid	Pseudomonas_phage(87.5%)	14	NA	NA
WP_169942603.1|2258923_2260081_+	DNA adenine methylase	NA	A0A1P8BMM5	Lactococcus_phage	24.6	9.0e-19
WP_169937364.1|2260077_2261262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169937366.1|2261354_2261627_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_169937368.1|2261752_2261968_+	DNA-binding protein	NA	Q56VP9	Pseudomonas_phage	53.5	2.4e-18
WP_169937370.1|2262008_2262215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937373.1|2262218_2262509_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	70.0	6.5e-35
WP_169937375.1|2262512_2262719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937377.1|2262943_2263243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937379.1|2263243_2263495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937381.1|2263507_2263759_+|capsid	major capsid protein	capsid	Q56VP2	Pseudomonas_phage	80.7	1.9e-27
WP_169937383.1|2263905_2265225_+	attachment protein	NA	Q56VP1	Pseudomonas_phage	45.6	2.5e-17
WP_084358758.1|2265230_2265587_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	83.9	1.1e-49
WP_169937385.1|2265590_2266877_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	79.9	7.0e-190
WP_169937387.1|2267116_2268391_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	49.3	4.0e-113
>prophage 5
NZ_CP048833	Pseudomonas multiresinivorans strain populi chromosome, complete genome	6517592	2338923	2348697	6517592	tail,integrase	Pseudomonas_phage(33.33%)	14	2333485:2333500	2344552:2344567
2333485:2333500	attL	GAGGGCTGGAAGCTGG	NA	NA	NA	NA
WP_169937512.1|2338923_2340693_-	N-acetylglutaminylglutamine amidotransferase	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	26.3	5.0e-29
WP_169937514.1|2340722_2341907_-|integrase	tyrosine-type recombinase/integrase	integrase	J7HXC4	Pseudomonas_phage	52.9	2.5e-109
WP_169937517.1|2342133_2342622_-	adenine methyltransferase	NA	M4QBY4	Dunaliella_viridis_virus	46.4	2.4e-29
WP_169937519.1|2342618_2343092_-	hypothetical protein	NA	A0A0U2QW67	Escherichia_phage	45.3	4.5e-09
WP_169937521.1|2343088_2343292_-	winged helix-turn-helix transcriptional regulator	NA	A0A127KNH7	Pseudomonas_phage	95.5	2.3e-31
WP_169937523.1|2343294_2343570_-	hypothetical protein	NA	H2BDE3	Pseudomonas_virus	69.1	2.8e-27
WP_169937525.1|2344318_2345599_-	hypothetical protein	NA	NA	NA	NA	NA
2344552:2344567	attR	CCAGCTTCCAGCCCTC	NA	NA	NA	NA
WP_169937527.1|2345595_2345892_-|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	38.2	7.1e-05
WP_169937529.1|2345888_2346116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169937531.1|2346112_2346292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169937534.1|2346272_2346758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169937536.1|2346819_2347170_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169937538.1|2347166_2347793_-	YqaJ viral recombinase family protein	NA	A0A0H5ARG7	Pseudomonas_phage	74.3	5.6e-84
WP_169937541.1|2347776_2348697_-	recombinase RecT	NA	H9C0R8	Aeromonas_phage	60.5	2.2e-68
>prophage 6
NZ_CP048833	Pseudomonas multiresinivorans strain populi chromosome, complete genome	6517592	2355117	2385610	6517592	terminase,capsid	Pseudomonas_phage(40.0%)	43	NA	NA
WP_169937568.1|2355117_2355900_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6Q0	uncultured_Caudovirales_phage	50.4	9.6e-65
WP_169942611.1|2356009_2356210_+	hypothetical protein	NA	A0A2H4J1L8	uncultured_Caudovirales_phage	74.2	3.4e-19
WP_169937570.1|2356466_2357060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937572.1|2357126_2357978_+	replication protein	NA	W6MYB0	Pseudomonas_phage	41.8	8.6e-43
WP_169937574.1|2357967_2358765_+	ATP-binding protein	NA	A0A2H4J3E5	uncultured_Caudovirales_phage	53.8	7.9e-75
WP_169937577.1|2358761_2358989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937579.1|2359102_2359303_+	TraR/DksA C4-type zinc finger protein	NA	H2BDI2	Pseudomonas_virus	60.6	8.4e-18
WP_169937581.1|2359295_2359697_+	recombination protein NinB	NA	A0A059VG13	Pseudomonas_phage	53.6	4.9e-33
WP_169937583.1|2359693_2360092_+	hypothetical protein	NA	A0A248SKX0	Klebsiella_phage	45.6	4.9e-25
WP_169937585.1|2360088_2360397_+	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	58.9	1.4e-24
WP_169937587.1|2360393_2360717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937589.1|2360713_2360983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937591.1|2360979_2361186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937593.1|2361182_2361647_+	hypothetical protein	NA	Q858D2	Salmonella_phage	74.7	6.7e-58
WP_169937595.1|2361643_2361937_+	hypothetical protein	NA	V5R6Z6	Pseudomonas_phage	72.0	9.8e-31
WP_169942613.1|2361894_2362419_+	hypothetical protein	NA	A0A291LAS9	Bordetella_phage	71.9	2.7e-55
WP_169937597.1|2362418_2363555_+	oxidoreductase	NA	A0A220IHC1	Escherichia_phage	42.7	2.8e-81
WP_169937599.1|2363551_2364121_+	hypothetical protein	NA	H2BDI9	Pseudomonas_virus	36.5	2.3e-28
WP_169937601.1|2364484_2364661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937603.1|2364846_2365248_+	hypothetical protein	NA	B5WZY9	Pseudomonas_phage	65.6	5.4e-40
WP_169937605.1|2365244_2365406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937607.1|2365405_2365606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937609.1|2365618_2366242_+	hypothetical protein	NA	A0A125RNL5	Pseudomonas_phage	75.4	8.6e-93
WP_169937612.1|2366273_2366735_+	DUF2280 domain-containing protein	NA	A0A0S2SY97	Pseudomonas_phage	76.6	9.6e-49
WP_169937614.1|2366721_2368017_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.1	1.4e-140
WP_169937616.1|2368021_2369416_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	58.0	3.3e-140
WP_169937618.1|2369402_2370491_+|capsid	minor capsid protein	capsid	A0A0H5BBX3	Pseudomonas_phage	46.1	1.5e-84
WP_169937620.1|2370500_2370749_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	54.2	8.0e-18
WP_169937622.1|2370745_2371009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937624.1|2371123_2371882_+	hypothetical protein	NA	A0A2H4J0I7	uncultured_Caudovirales_phage	36.2	1.2e-27
WP_169937626.1|2371901_2372894_+	hypothetical protein	NA	A0A0P1KKM6	Acinetobacter_phage	34.1	4.8e-37
WP_169937628.1|2372938_2373886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937630.1|2373888_2374386_+	hypothetical protein	NA	A0A2H4J970	uncultured_Caudovirales_phage	50.0	1.8e-32
WP_169937633.1|2374382_2374763_+	hypothetical protein	NA	A0A1B0VRJ4	Pseudomonas_phage	45.7	1.4e-21
WP_169937635.1|2374762_2375158_+	HK97 gp10 family phage protein	NA	A0A0H5AWD5	Pseudomonas_phage	56.5	3.0e-35
WP_169937637.1|2375161_2375581_+	hypothetical protein	NA	A0A2L0V141	Salmonella_phage	43.2	2.3e-17
WP_169937639.1|2375584_2376730_+	hypothetical protein	NA	A0A0A0RP46	Escherichia_phage	34.1	6.5e-38
WP_169937640.1|2377014_2377419_+	hypothetical protein	NA	A0A1B0Z0C9	Vibrio_phage	38.5	1.6e-18
WP_169937642.1|2377698_2380161_+	tape measure protein	NA	J7HXG0	Pseudomonas_phage	51.8	2.7e-89
WP_169937644.1|2380160_2381027_+	DUF2460 domain-containing protein	NA	NA	NA	NA	NA
WP_169937646.1|2381082_2381970_+	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_169937648.1|2381966_2382395_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_169937651.1|2382391_2385610_+	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	28.8	8.0e-49
>prophage 7
NZ_CP048833	Pseudomonas multiresinivorans strain populi chromosome, complete genome	6517592	3202621	3205783	6517592		uncultured_Caudovirales_phage(100.0%)	6	NA	NA
WP_169938633.1|3202621_3203620_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	72.2	7.5e-139
WP_169938635.1|3203616_3203952_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	4.1e-41
WP_169938636.1|3203948_3204251_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	57.0	4.1e-24
WP_169938638.1|3204250_3204610_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	58.3	7.5e-33
WP_169938640.1|3204609_3205002_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	73.6	2.2e-49
WP_024765156.1|3205117_3205783_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	80.7	6.8e-88
>prophage 8
NZ_CP048833	Pseudomonas multiresinivorans strain populi chromosome, complete genome	6517592	4878292	4917267	6517592	terminase,tail,holin,tRNA,protease,integrase	Pseudomonas_phage(25.71%)	62	4889877:4889893	4917612:4917628
WP_169940253.1|4878292_4880428_-	hypothetical protein	NA	G8GWG3	Rhodobacter_phage	38.9	6.5e-31
WP_169940255.1|4880424_4881030_-	hypothetical protein	NA	D6PEY1	uncultured_phage	32.3	2.6e-17
WP_169940257.1|4881026_4881320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169940258.1|4881319_4881634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169940261.1|4881674_4882097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169940263.1|4882155_4883079_-	DUF5309 domain-containing protein	NA	A0A0F7L5B1	uncultured_marine_virus	52.1	3.6e-79
WP_169942752.1|4883094_4883826_-	hypothetical protein	NA	A0A218MLX4	uncultured_virus	42.1	2.5e-19
WP_169940264.1|4884135_4884426_-	hypothetical protein	NA	A0A1B1ITG5	uncultured_Mediterranean_phage	41.6	5.5e-10
WP_169940265.1|4884412_4886683_-	hypothetical protein	NA	A0A218MLX1	uncultured_virus	39.3	5.3e-116
WP_169940266.1|4886690_4887950_-|terminase	PBSX family phage terminase large subunit	terminase	L7TP33	Pseudomonas_virus	52.3	2.3e-116
WP_169940267.1|4887946_4888405_-	DNA packaging protein	NA	F8TUR4	EBPR_podovirus	51.1	9.9e-30
WP_169942754.1|4888562_4888763_-|holin	holin	holin	NA	NA	NA	NA
WP_169940268.1|4888965_4889337_-	antitermination protein Q	NA	W6MVN8	Pseudomonas_phage	69.9	1.4e-42
WP_169940269.1|4889333_4890467_-	oxidoreductase	NA	A0A1P8L636	Pectobacterium_phage	40.8	9.9e-79
4889877:4889893	attL	GTCGGCATCCAGGTGAT	NA	NA	NA	NA
WP_169940270.1|4890466_4890643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169940271.1|4890642_4891026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169940273.1|4891225_4891441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169940275.1|4891437_4891671_-	hypothetical protein	NA	C8XUE3	Shigella_phage	43.4	1.1e-08
WP_169940277.1|4891667_4891907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169937587.1|4891903_4892227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169937585.1|4892223_4892532_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	58.9	1.4e-24
WP_169937583.1|4892528_4892927_-	hypothetical protein	NA	A0A248SKX0	Klebsiella_phage	45.6	4.9e-25
WP_169937581.1|4892923_4893325_-	recombination protein NinB	NA	A0A059VG13	Pseudomonas_phage	53.6	4.9e-33
WP_169937579.1|4893317_4893518_-	TraR/DksA C4-type zinc finger protein	NA	H2BDI2	Pseudomonas_virus	60.6	8.4e-18
WP_169940279.1|4893631_4893859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169940281.1|4893855_4894662_-	ATP-binding protein	NA	A0A059VK34	Pseudomonas_phage	52.5	1.9e-71
WP_169940283.1|4894651_4895452_-	phage replication protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	50.9	3.7e-64
WP_169940285.1|4895742_4895931_-	hypothetical protein	NA	B5WZX7	Pseudomonas_phage	66.1	2.8e-15
WP_169940287.1|4895943_4896141_-	hypothetical protein	NA	A0A1B0Z2M2	Pseudomonas_phage	63.1	9.5e-14
WP_169940289.1|4896214_4896907_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6J6	uncultured_Caudovirales_phage	55.6	2.1e-39
WP_169940291.1|4896933_4897440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937560.1|4897806_4898313_+	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	42.8	1.8e-27
WP_169937558.1|4898344_4898515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169934896.1|4898526_4898796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937556.1|4898829_4899072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937554.1|4899330_4899555_+	hypothetical protein	NA	A0A0U4JX53	Pseudomonas_phage	94.5	1.3e-35
WP_169937552.1|4899551_4899944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937550.1|4899940_4900279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937548.1|4900603_4900828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937546.1|4900824_4900968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937543.1|4901133_4901544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937541.1|4901595_4902516_+	recombinase RecT	NA	H9C0R8	Aeromonas_phage	60.5	2.2e-68
WP_169937538.1|4902499_4903126_+	YqaJ viral recombinase family protein	NA	A0A0H5ARG7	Pseudomonas_phage	74.3	5.6e-84
WP_169937536.1|4903122_4903473_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169937534.1|4903534_4904020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937531.1|4904000_4904180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937529.1|4904176_4904404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937527.1|4904400_4904697_+|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	38.2	7.1e-05
WP_169937525.1|4904693_4905974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169937523.1|4906722_4906998_+	hypothetical protein	NA	H2BDE3	Pseudomonas_virus	69.1	2.8e-27
WP_169937521.1|4907000_4907204_+	winged helix-turn-helix transcriptional regulator	NA	A0A127KNH7	Pseudomonas_phage	95.5	2.3e-31
WP_169937519.1|4907200_4907674_+	hypothetical protein	NA	A0A0U2QW67	Escherichia_phage	45.3	4.5e-09
WP_169937517.1|4907670_4908159_+	adenine methyltransferase	NA	M4QBY4	Dunaliella_viridis_virus	46.4	2.4e-29
WP_169940293.1|4908206_4908455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169940295.1|4908567_4908888_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169940297.1|4908773_4909871_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	71.5	1.4e-151
WP_169940299.1|4910464_4911319_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.2	3.5e-28
WP_169940301.1|4911382_4912771_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2L2DK39	Acanthamoeba_polyphaga_mimivirus	35.7	5.1e-45
WP_169942756.1|4912774_4914457_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	61.1	1.7e-199
WP_024765728.1|4914578_4915085_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	36.0	1.2e-15
WP_169940303.1|4915089_4915812_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_169940305.1|4915935_4917267_+|protease	membrane protease subunit, stomatin/prohibitin	protease	A0A0F6WCV7	Sinorhizobium_phage	28.4	1.8e-39
4917612:4917628	attR	GTCGGCATCCAGGTGAT	NA	NA	NA	NA
>prophage 9
NZ_CP048833	Pseudomonas multiresinivorans strain populi chromosome, complete genome	6517592	6448934	6482882	6517592	plate,holin,tail,tRNA	Pseudomonas_phage(27.27%)	39	NA	NA
WP_169942872.1|6448934_6450134_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_169942343.1|6450316_6451762_+	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	43.1	4.7e-17
WP_169942345.1|6451765_6452857_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_045212604.1|6452914_6453265_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	5.1e-26
WP_169942347.1|6453400_6454435_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_065085717.1|6454695_6455121_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_024763559.1|6455140_6456109_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_169942349.1|6456214_6457312_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_169942351.1|6457367_6458156_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_169942353.1|6458162_6459644_-	AAA family ATPase	NA	U5XGM6	Phormidium_phage	35.5	3.2e-69
WP_024763563.1|6459737_6460076_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_024763564.1|6460178_6460826_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_024763565.1|6460883_6461678_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_015475289.1|6461901_6462324_-	OsmC family protein	NA	NA	NA	NA	NA
WP_024763566.1|6462698_6463346_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_045212629.1|6463490_6464327_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	54.6	6.2e-70
WP_169942355.1|6464323_6465373_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	9.7e-113
WP_017517337.1|6465369_6465966_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.6	6.1e-72
WP_169942357.1|6466283_6466535_-	hypothetical protein	NA	A0A0S2SYC6	Pseudomonas_phage	52.4	4.3e-11
WP_169942359.1|6466531_6466888_-	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	42.1	4.0e-10
WP_169942361.1|6466884_6467514_-	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	63.9	1.4e-69
WP_169942363.1|6467515_6468520_-	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	58.2	2.7e-104
WP_024763574.1|6468584_6468794_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.8	5.7e-17
WP_169942365.1|6468765_6469671_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_169942367.1|6469680_6471636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763577.1|6471791_6472133_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_024763578.1|6472144_6472648_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	67.3	8.6e-59
WP_169942369.1|6472660_6473821_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	80.9	1.9e-173
WP_169942371.1|6473887_6474313_-|tail	tail fiber assembly protein	tail	A0A219Y8Y9	Aeromonas_phage	38.9	9.0e-17
WP_169942373.1|6476933_6477467_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	61.5	3.8e-57
WP_169942375.1|6477459_6478350_-|plate	baseplate J/gp47 family protein	plate	F1BUP3	Erwinia_phage	61.3	3.0e-91
WP_169942377.1|6478346_6478673_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	62.0	1.3e-31
WP_169942379.1|6478782_6479346_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	58.6	3.0e-44
WP_169942381.1|6479342_6479873_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	40.6	1.5e-24
WP_169942383.1|6479890_6480235_-|holin	holin	holin	B5TK61	Pseudomonas_phage	51.8	1.5e-25
WP_169942385.1|6480551_6481025_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_169942387.1|6481108_6481468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763589.1|6481487_6481697_-	TraR/DksA C4-type zinc finger protein	NA	Q9ZXI6	Pseudomonas_virus	45.2	1.7e-08
WP_169942389.1|6482111_6482882_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	56.7	1.8e-68
