The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	48057	58418	4933292	integrase	Enterobacteria_phage(100.0%)	11	48115:48128	63188:63201
WP_047615363.1|48057_50391_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
48115:48128	attL	CAGCGTCAGGTTGG	NA	NA	NA	NA
WP_000856729.1|50405_50726_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001357995.1|50861_51317_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244665.1|51309_51597_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_032226384.1|51589_52144_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_047650140.1|52140_52407_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	4.1e-44
WP_047615356.1|52958_53693_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	1.8e-129
WP_001583072.1|53689_54190_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_047615351.1|54263_54836_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_089563614.1|55190_57188_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_047615344.1|57239_58418_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	94.1	5.4e-213
63188:63201	attR	CAGCGTCAGGTTGG	NA	NA	NA	NA
>prophage 2
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	826546	889987	4933292	integrase,transposase,protease,tRNA	Enterobacteria_phage(20.0%)	56	862026:862041	900226:900241
WP_131501864.1|826546_826660_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_001043260.1|828317_829133_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|829219_829522_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|829415_829667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512463.1|830287_830554_-	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
WP_000930062.1|830988_831303_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_000271619.1|832168_833401_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_085948468.1|833551_834714_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000174035.1|834881_835862_+	thymidylate synthase	NA	A0A218MLB7	uncultured_virus	34.2	7.3e-22
WP_000820616.1|835858_836803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637419.1|836805_837888_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	5.5e-10
WP_032153698.1|838354_838621_+	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.6	1.0e-26
WP_000438165.1|840042_843456_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
WP_000627728.1|843519_845154_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
WP_000742120.1|845150_846293_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000778955.1|846301_847924_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000499115.1|847923_848820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001398114.1|849450_850188_+	porin family protein	NA	NA	NA	NA	NA
WP_000228490.1|850607_851504_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	27.3	2.1e-31
WP_001207396.1|851552_852632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100182.1|852678_854250_+	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_000766274.1|854246_854513_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001238004.1|854652_854850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025492097.1|854902_856576_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_032153697.1|856719_857754_-	tetratricopeptide repeat family protein	NA	NA	NA	NA	NA
WP_023181049.1|857803_858079_+|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.8e-45
WP_001037798.1|859018_860413_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_000813678.1|860607_862038_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
862026:862041	attL	GACGCTGTTTCATCAG	NA	NA	NA	NA
WP_001083368.1|862037_863315_-	MFS transporter	NA	NA	NA	NA	NA
WP_000253907.1|863377_865504_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_000053331.1|865599_866610_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001218742.1|866759_867944_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.7e-121
WP_000234494.1|868301_869009_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839792.1|869407_871543_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001298251.1|871591_872848_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000760323.1|873049_874129_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|874193_874469_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_085455525.1|874496_875549_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_085455524.1|875709_876429_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107565.1|876428_876755_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|876938_877658_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_085455523.1|877833_878880_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745232.1|878996_880004_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_044706006.1|880068_881205_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174738.1|881197_881791_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|881798_882089_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|882085_882652_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997807.1|882669_883374_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_085455522.1|883391_884372_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000399648.1|884621_885602_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000017111.1|885825_886242_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|886241_886805_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593259.1|886913_887864_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222509.1|887876_888608_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_001327408.1|888687_889395_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|889489_889987_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
900226:900241	attR	CTGATGAAACAGCGTC	NA	NA	NA	NA
>prophage 3
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	1118786	1125926	4933292		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1118786_1119425_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590385.1|1119421_1120684_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_000847985.1|1120680_1121589_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1121784_1122552_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141308.1|1122602_1123259_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	45.8	1.1e-48
WP_001272897.1|1123364_1125926_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 4
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	1330928	1337142	4933292	transposase	Escherichia_phage(66.67%)	7	NA	NA
WP_001299507.1|1330928_1332395_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138288.1|1332463_1334041_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755184.1|1334135_1334675_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	94.4	3.8e-44
WP_001317257.1|1334690_1335209_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_112026978.1|1335586_1336749_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000075997.1|1336795_1336972_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	96.4	3.8e-22
WP_000017552.1|1336989_1337142_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 5
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	1494679	1549901	4933292	integrase,transposase	Shigella_phage(28.57%)	35	1489694:1489712	1531526:1531544
1489694:1489712	attL	TGGTGTCCCCTGCAGGAAT	NA	NA	NA	NA
WP_001389101.1|1494679_1495831_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	6.8e-43
WP_000896261.1|1496601_1496808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001035793.1|1497177_1500675_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	3.5e-98
WP_087903688.1|1501751_1502965_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	8.9e-102
WP_000906844.1|1503469_1504141_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001361993.1|1504188_1504548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000186597.1|1505306_1505594_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000950719.1|1505587_1505926_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_087599334.1|1509502_1510658_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	4.7e-68
WP_000864948.1|1511202_1512228_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000824228.1|1512199_1513489_-	MFS transporter	NA	NA	NA	NA	NA
WP_123863910.1|1514722_1515013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001361538.1|1515136_1515295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424706.1|1515763_1518073_+	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000117529.1|1518076_1519393_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000093090.1|1519389_1521588_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_089541817.1|1522143_1523372_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_174243362.1|1523435_1524422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839828.1|1525065_1527426_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_072003506.1|1528738_1528894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131472.1|1530159_1531350_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	7.6e-130
WP_000368131.1|1531675_1532608_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1531526:1531544	attR	TGGTGTCCCCTGCAGGAAT	NA	NA	NA	NA
WP_000776768.1|1532901_1533657_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_001295701.1|1535263_1536604_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296869.1|1536975_1537260_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531954.1|1537439_1538750_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000425058.1|1538749_1540894_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|1541096_1541582_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_174243363.1|1542265_1542829_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|1545571_1546324_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000842082.1|1546298_1546847_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|1546843_1547314_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000730291.1|1547310_1547835_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001356216.1|1547821_1548694_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_174243356.1|1548920_1549901_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	1769986	1779427	4933292		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|1769986_1770913_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1770917_1771649_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1771629_1771737_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1771796_1772528_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1772749_1774435_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001326002.1|1774431_1775151_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1775197_1775668_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001378226.1|1775707_1776169_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
WP_001326004.1|1776293_1778294_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001292774.1|1778290_1779427_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 7
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	1791330	1863028	4933292	plate,portal,integrase,tRNA,head,capsid,holin,terminase,lysis,tail,transposase	Escherichia_phage(31.82%)	77	1806645:1806660	1830512:1830527
WP_001295427.1|1791330_1793364_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|1793495_1794605_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|1794867_1795149_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1795441_1795984_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|1796064_1796739_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945400.1|1796754_1799235_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405707.1|1799250_1800285_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1800366_1800705_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134569.1|1800923_1801748_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1801868_1802141_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000510000.1|1802395_1804624_+	hypothetical protein	NA	K4F5G3	Cronobacter_phage	28.0	4.7e-16
WP_000547316.1|1804739_1806068_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001011965.1|1806132_1806699_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1806645:1806660	attL	CAACCGCTACCGCTTT	NA	NA	NA	NA
WP_001058091.1|1807662_1807845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195605.1|1808182_1808971_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1808967_1809768_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_174243367.1|1809832_1810651_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.5e-23
WP_000434038.1|1810702_1811449_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|1811422_1812388_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|1812384_1813389_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|1813385_1814663_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1814919_1815972_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|1816281_1817136_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_174243368.1|1817164_1818427_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182914.1|1818436_1818889_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|1818919_1819204_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1819207_1820563_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844200.1|1820610_1821651_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1821750_1822530_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1822611_1823511_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001352710.1|1823916_1824234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985256.1|1824498_1825512_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|1825627_1825927_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1826041_1826317_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1826327_1826498_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|1826494_1826995_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|1827058_1827283_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277958.1|1827282_1827585_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_001113258.1|1827584_1827809_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	97.3	2.5e-34
WP_042075427.1|1827805_1828081_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.5e-44
WP_089502854.1|1828070_1830359_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	96.7	0.0e+00
WP_023146974.1|1830586_1832794_-	AAA family ATPase	NA	NA	NA	NA	NA
1830512:1830527	attR	CAACCGCTACCGCTTT	NA	NA	NA	NA
WP_075591749.1|1833267_1834302_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	7.1e-201
WP_001085948.1|1836247_1837102_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_001248583.1|1837160_1838234_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_096965633.1|1838237_1838975_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	98.0	1.3e-127
WP_000988633.1|1839074_1839584_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1839583_1839787_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123124.1|1839790_1840072_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001357049.1|1840071_1840569_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	6.9e-93
WP_072656875.1|1840583_1841009_+	protein lysA	NA	U5N096	Enterobacteria_phage	99.3	7.7e-61
WP_000040652.1|1840996_1841422_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	96.5	1.6e-66
WP_075591737.1|1841393_1841567_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	1.2e-23
WP_000917182.1|1841529_1841997_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_001001787.1|1841989_1842442_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_075591738.1|1842513_1843299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042076067.1|1843382_1844018_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	9.3e-111
WP_000127163.1|1844014_1844362_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121497.1|1844366_1845275_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_075591739.1|1845267_1845798_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.3	5.6e-101
WP_042073680.1|1845808_1848667_+|tail	phage tail protein	tail	A0A0A0YPY9	Escherichia_phage	76.9	0.0e+00
WP_052435487.1|1848876_1849995_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_023146626.1|1850809_1851160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089502862.1|1851239_1852430_+|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	98.0	1.3e-222
WP_001251408.1|1852442_1852961_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1853018_1853294_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_042076013.1|1853326_1853446_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	3.0e-15
WP_042076011.1|1853438_1855886_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	92.4	0.0e+00
WP_000978914.1|1855900_1856380_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	4.3e-84
WP_174243369.1|1856379_1857543_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	2.7e-204
WP_000468308.1|1857624_1857843_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1858115_1859477_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001220181.1|1859579_1859876_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1859877_1860174_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|1860382_1860715_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137891.1|1860905_1861628_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_000675150.1|1861624_1863028_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 8
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	2258846	2305430	4933292	plate,portal,integrase,tRNA,holin,head,capsid,terminase,tail	Enterobacteria_phage(73.91%)	60	2266182:2266206	2303004:2303028
WP_001144191.1|2258846_2260775_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	2.5e-130
WP_001700733.1|2260778_2261321_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2261417_2261615_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2261667_2262024_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2262146_2262191_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|2262474_2263458_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672349.1|2263472_2265860_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2265864_2266164_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2266182:2266206	attL	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_000078916.1|2266466_2266607_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488107.1|2266797_2267058_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000129162.1|2267234_2268059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132817.1|2268275_2269373_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	100.0	3.5e-206
WP_000005390.1|2269530_2270715_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.7	1.5e-226
WP_000290450.1|2270714_2271227_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|2271281_2271647_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333494.1|2271655_2271811_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_001299128.1|2271797_2274605_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.4	0.0e+00
WP_000979936.1|2274617_2275106_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
WP_000905075.1|2275132_2275732_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	1.2e-86
WP_032173126.1|2275759_2276161_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	37.7	1.0e-09
WP_000376429.1|2276164_2276584_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	54.4	5.0e-36
WP_001030525.1|2276555_2277158_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	91.3	9.5e-97
WP_174243378.1|2277157_2278798_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	57.0	1.1e-142
WP_000071724.1|2278794_2279403_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_001111951.1|2279395_2280292_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
WP_172944147.1|2280295_2280625_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	2.2e-55
WP_001343010.1|2280642_2281209_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	2.3e-100
WP_089597631.1|2281220_2281856_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	6.9e-114
WP_000920588.1|2281848_2282316_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	3.8e-85
WP_097474494.1|2282453_2282861_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.8	1.4e-64
WP_000072335.1|2282857_2283250_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	9.9e-71
WP_000104350.1|2283246_2283570_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2283572_2283773_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_063116040.1|2283772_2284267_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	6.0e-89
WP_001603076.1|2284369_2285170_-|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	1.1e-124
WP_057780952.1|2285215_2286268_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	2.5e-193
WP_001262688.1|2286291_2287128_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_000613782.1|2287282_2289034_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001545555.1|2289033_2290080_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.6e-206
WP_001140702.1|2290573_2292799_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000502620.1|2292822_2293944_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_097474495.1|2294124_2296908_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.8	0.0e+00
WP_000564228.1|2296904_2297294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985482.1|2297290_2297908_-	ash family protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000104303.1|2297919_2298219_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	8.2e-41
WP_000153700.1|2298215_2298482_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985163.1|2298478_2298682_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	1.9e-25
WP_001737203.1|2298705_2299122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001737202.1|2299214_2299328_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	7.3e-11
WP_000514277.1|2299324_2299567_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_063610847.1|2299578_2299857_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	1.4e-34
WP_001737200.1|2299867_2300206_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
WP_001151411.1|2300220_2300499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021113.1|2300594_2300906_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.5	1.2e-18
WP_174243427.1|2300994_2301948_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.0	1.7e-79
WP_126125411.1|2301934_2302333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001737198.1|2302444_2302894_+	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_000956518.1|2303086_2304067_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2303004:2303028	attR	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_001154187.1|2304129_2304681_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029479.1|2304680_2305430_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
>prophage 9
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	2664380	2673081	4933292	lysis	Enterobacteria_phage(55.56%)	10	NA	NA
WP_001228247.1|2664380_2664980_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	5.4e-100
WP_170940253.1|2665047_2665995_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	80.2	2.9e-132
WP_001291108.1|2666672_2667461_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	3.3e-49
WP_001697073.1|2667598_2669056_-	TrkG potassium ion Trk transporter	NA	NA	NA	NA	NA
WP_001228696.1|2669252_2669438_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135296.1|2669654_2670152_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_000839596.1|2670151_2670367_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000640107.1|2671652_2672195_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_000228032.1|2672191_2672482_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000940312.1|2672481_2673081_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	7.2e-105
>prophage 10
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	2676249	2693409	4933292	tRNA	Escherichia_phage(75.0%)	24	NA	NA
WP_001151415.1|2676249_2676672_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.9	2.2e-60
WP_000450652.1|2676688_2677414_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.8	6.1e-82
WP_000788982.1|2677436_2678183_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	1.3e-114
WP_001326319.1|2678189_2678978_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	1.4e-42
WP_000693800.1|2679055_2679478_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.1	5.0e-68
WP_001072342.1|2679474_2679729_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2679808_2680228_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2680470_2680650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2680660_2680816_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2680812_2681301_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2681742_2681964_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2681963_2682134_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2682208_2682484_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105139.1|2682585_2685186_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
WP_000166319.1|2685178_2685988_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2686044_2686239_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2686231_2686441_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2686519_2686735_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040858.1|2686736_2687972_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_001157408.1|2688023_2688959_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	7.7e-146
WP_000123719.1|2689087_2690461_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	5.6e-52
WP_001296046.1|2690490_2690664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387395.1|2690938_2691922_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001389212.1|2692176_2693409_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 11
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	3139059	3225869	4933292	plate,portal,integrase,protease,tRNA,head,capsid,terminase,lysis,tail	Salmonella_phage(59.32%)	92	3132020:3132035	3228814:3228829
3132020:3132035	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3139059_3140352_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|3140442_3141786_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_001295343.1|3141796_3142408_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077064.1|3142562_3146669_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3146803_3147298_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3147842_3148808_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043615.1|3148930_3150697_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202189.1|3150697_3152419_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001241678.1|3152460_3153165_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3153449_3153668_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3154351_3156628_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3156658_3156979_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3157301_3157526_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|3157598_3159545_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_044782102.1|3159541_3160657_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|3160807_3161764_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599806.1|3161760_3163419_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001297311.1|3163844_3164540_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3165034_3165934_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_174243391.1|3166077_3167730_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3167741_3168710_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815351.1|3168842_3170561_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.8e-31
WP_000566372.1|3170597_3171599_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3171609_3173040_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3173138_3174152_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|3174148_3174979_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3174975_3175299_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3175424_3175940_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3176157_3176886_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3176903_3177635_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3177641_3178358_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3178357_3179026_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3179316_3180048_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149732.1|3180222_3181350_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3181390_3181879_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3181938_3182784_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|3182780_3183734_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996018.1|3183743_3184877_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126084.1|3184971_3186084_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3186434_3186911_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3186998_3187901_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_174243392.1|3187961_3188684_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3188667_3188955_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3189114_3189372_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3189401_3189779_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|3190048_3191734_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3191969_3192188_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_174243393.1|3192278_3193379_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.0	6.5e-176
WP_000980413.1|3193375_3193861_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_174243394.1|3193857_3196935_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.7	0.0e+00
WP_000763311.1|3196927_3197047_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3197061_3197364_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3197418_3197934_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046122.1|3197943_3199116_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_000905009.1|3199258_3199825_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	3.2e-86
WP_001174919.1|3200253_3200694_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_032208832.1|3200665_3201268_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	1.3e-98
WP_174243395.1|3201267_3202824_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.9	3.4e-199
WP_001086824.1|3202820_3203426_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_174243396.1|3203418_3204327_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	3.9e-142
WP_000177580.1|3204313_3204673_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_021522008.1|3204669_3205248_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	1.5e-94
WP_032318553.1|3205316_3205763_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_001039944.1|3205755_3206187_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_032318552.1|3206282_3206711_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	9.9e-48
WP_000730951.1|3206707_3207085_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	1.8e-16
WP_174243397.1|3207086_3207599_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	6.9e-88
WP_000171568.1|3207579_3207795_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868192.1|3207798_3208002_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_000673523.1|3208001_3208466_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000059191.1|3208561_3209212_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742511.1|3209215_3210274_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_028985445.1|3210290_3211124_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	85.9	1.7e-123
WP_096985635.1|3211266_3213033_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_174243398.1|3213032_3214064_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.0	9.6e-182
WP_032344223.1|3214109_3214403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094249479.1|3214718_3215501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001292590.1|3215504_3215705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3215924_3216158_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3216168_3216357_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_174243399.1|3216510_3218883_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.1	0.0e+00
WP_001420002.1|3218882_3219704_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_000104146.1|3219709_3220564_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	90.1	2.9e-147
WP_000752619.1|3220560_3220788_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_174243400.1|3220787_3221021_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963472.1|3221088_3221430_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_170908225.1|3221393_3221594_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.0e-31
WP_000460901.1|3221601_3222111_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_000188448.1|3222143_3222365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107902.1|3222460_3223057_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
WP_174243401.1|3223077_3224754_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
WP_000290938.1|3224837_3225869_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.9e-105
3228814:3228829	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 12
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	3526924	3541328	4933292	portal,integrase,terminase,lysis,tail	Enterobacteria_phage(55.0%)	21	3528118:3528131	3542020:3542033
WP_044059726.1|3526924_3527458_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	2.1e-92
WP_001326104.1|3527552_3527912_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	96.2	1.6e-54
WP_000198146.1|3527908_3528115_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	1.3e-29
WP_001027290.1|3528111_3530037_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
3528118:3528131	attL	ATCCTCTCCGGATA	NA	NA	NA	NA
WP_000453623.1|3530011_3530557_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	5.2e-94
WP_001300120.1|3530945_3531140_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3531304_3531511_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_174243405.1|3531796_3532207_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	8.0e-71
WP_000738500.1|3532497_3532791_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3532881_3533064_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3533280_3533778_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|3533777_3533993_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|3534581_3535679_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|3535868_3536252_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000559922.1|3536377_3536893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3537363_3537726_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_174243406.1|3537791_3538616_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000008165.1|3538743_3539280_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|3539270_3539633_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206813.1|3539632_3539938_+	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001298992.1|3540164_3541328_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
3542020:3542033	attR	ATCCTCTCCGGATA	NA	NA	NA	NA
>prophage 13
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	3813376	3825435	4933292	integrase	Enterobacteria_phage(88.89%)	13	3808957:3808976	3825599:3825618
3808957:3808976	attL	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_001325785.1|3813376_3813973_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.4	7.7e-99
WP_174243410.1|3814775_3817109_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
WP_000856729.1|3817123_3817444_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001357995.1|3817579_3818035_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244665.1|3818027_3818315_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_039264337.1|3818307_3818907_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_174243411.1|3818903_3819161_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	96.6	8.3e-42
WP_001392508.1|3819712_3820447_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	6.1e-130
WP_000638629.1|3820443_3820944_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|3821017_3821590_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_174243412.1|3821892_3822633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064054.1|3822629_3824258_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001130497.1|3824250_3825435_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.4	3.2e-144
3825599:3825618	attR	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
>prophage 14
NZ_CP048290	Escherichia coli strain CVM N18EC0432 chromosome, complete genome	4933292	4142869	4165000	4933292	tail,transposase,integrase	Shigella_phage(36.36%)	25	4162070:4162083	4165714:4165727
WP_000490275.1|4142869_4143031_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4143157_4143763_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202562.1|4144155_4145742_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|4145961_4146210_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001372053.1|4146636_4146750_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_000836768.1|4146818_4147052_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086522.1|4147368_4147959_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000355601.1|4148186_4148480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235978.1|4148490_4149195_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000654139.1|4149204_4149486_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	3.1e-18
WP_089541817.1|4150467_4151695_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000767113.1|4153478_4153868_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000066920.1|4153864_4154518_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	98.6	2.8e-126
WP_001374384.1|4154612_4155605_-	hypothetical protein	NA	U5P0A0	Shigella_phage	97.0	3.6e-93
WP_001250270.1|4155561_4155774_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000526666.1|4155949_4156501_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	98.9	3.8e-100
WP_001191669.1|4156493_4156754_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001311077.1|4156851_4157544_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_000135680.1|4158265_4158628_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_021529750.1|4158693_4159518_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	1.5e-148
WP_021529726.1|4159645_4160182_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	1.5e-98
WP_001222409.1|4160172_4160523_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	92.2	1.8e-55
WP_001084860.1|4160883_4161279_+	hypothetical protein	NA	U5P0J0	Shigella_phage	77.6	4.7e-20
WP_021529725.1|4162013_4163609_+	hypothetical protein	NA	NA	NA	NA	NA
4162070:4162083	attL	ATCGGCATCATCAC	NA	NA	NA	NA
WP_001218290.1|4163761_4165000_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	97.8	8.5e-233
WP_001218290.1|4163761_4165000_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	97.8	8.5e-233
4165714:4165727	attR	GTGATGATGCCGAT	NA	NA	NA	NA
>prophage 1
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	0	7967	269306		Salmonella_phage(75.0%)	7	NA	NA
WP_001065778.1|599_1652_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	31.2	1.1e-12
WP_000594930.1|1671_1872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000838219.1|1868_2585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970401.1|2819_3674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121574.1|3682_4495_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	38.9	1.2e-46
WP_000114860.1|4864_6028_+	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
WP_000096325.1|6275_7967_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.1	5.8e-67
>prophage 2
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	13532	14621	269306		Salmonella_phage(100.0%)	1	NA	NA
WP_000159528.1|13532_14621_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	50.9	2.8e-83
>prophage 3
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	19583	23560	269306		Klebsiella_phage(25.0%)	6	NA	NA
WP_000491820.1|19583_20171_-	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.1e-09
WP_000149862.1|20214_20478_-	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
WP_001447802.1|20571_21333_-	methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	32.9	1.2e-19
WP_000277498.1|21413_22178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000803858.1|22500_23025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251242.1|23128_23560_+	hypothetical protein	NA	A0A1V0E5M6	Salmonella_phage	49.6	4.2e-22
>prophage 4
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	28014	31890	269306		Escherichia_phage(50.0%)	6	NA	NA
WP_000581857.1|28014_28311_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	35.1	3.2e-05
WP_011152995.1|28319_29501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645320.1|29906_30284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000069824.1|30375_30804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001290639.1|30868_31126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833775.1|31281_31890_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	38.5	4.4e-25
>prophage 5
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	36091	84796	269306	transposase,integrase	Escherichia_phage(35.0%)	56	45859:45918	67545:68903
WP_072223036.1|36091_37060_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.8e-185
WP_000140246.1|37176_37506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180999.1|39321_39561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172888.1|39623_39935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159617.1|39931_40126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|40641_41346_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|42979_43882_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|44143_44905_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|44925_45786_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
45859:45918	attL	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|45922_46627_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|46632_46773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|47258_47996_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|47992_48217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|48427_49921_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|49951_50203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|50096_50399_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|50485_51301_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|51630_51807_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|51988_52993_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138070.1|53071_56038_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_001067855.1|56158_56863_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376623.1|56938_57439_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|57566_58406_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|58399_58747_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_012695487.1|60056_60488_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012695486.1|60850_61264_-	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_012695485.1|61391_62201_-	AAC(3)-II family aminoglycoside N-acetyltransferase	NA	O64018	Bacillus_phage	29.3	1.2e-17
WP_006473457.1|62442_63798_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_012695484.1|64285_64867_-	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
WP_000845048.1|65029_66043_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001044210.1|66689_66830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|66835_67540_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000252081.1|67849_68743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371935.1|68914_69145_+	hypothetical protein	NA	NA	NA	NA	NA
67545:68903	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACAATGAGTTACTCCGTAGTAATGCAAAATTACTGCATCGCAATGCAGTAGAAACTATGAAAGCAAACCAACGGCTGGTTATTGATATAAGCACCCTTAAAGAGGTGCAGGATACGCTTATCCAGACGGTTGGCGATGTTGTTAAAATCCAGAGAGAAGGGGCTATTAAGCTCAGGGAAACAGAAAAACAGGTTCTTGCCATGCGTGAGAATTTGCGCACCCGACTGACACAAAAAGGGGTAGATCATGGTGCGTAACCTTAAGAGTAGTGACGATTTTTCCCGTGAACTGTCATTTCTTTTTCACCGGTCTATAAAGATTAGAAATTCAGGTTTCGCGATATTTGGTGCGGGCCTGCTGATAATGATTTTTGGTCTTTGCTTGTGGTTGCTGTCATTACACCTCTCACCTTCAGTTCTGGACTTTGATATTGATGTGCCCTTGTCATTCTTCAATTCATCTGAAGGTGAAGATAAGTTAGTGGTTTCGGATTTTGGCGATGCATTTGGAGGCTTCCTAACTACATATTCTAAGTTGCTATTAGGGATTATGGGGCTATTAGTAGTTTCTTCAACTGCCTTTAAAATTTTAAAGGGGGAGGAAATAGGTGAGATATTCCCGATGCTTCTAATTGCTGGCGCTTTTCTTATCGGCTTGTCAGTTTTTACATCTGCTTTAGGTTCGGAAGAGACTGATGCCACTTCAGCTTCGACTGTAAAGGTTATCAAGAAATATGTAAAACATGAAAAATACGATAAACTTGTCGCATATTTAAATGATAGTAATTGGCCCTCAGGCGAAGAGGTATCTGTAAACTATTTAAAGGCGCAACTACATATAAAACTCGGCAAGCCAGATGTGAAGTTAACACAGAATGTTGTTAGGGCGTATATGTCTGGTGTATTACAGTCAAATATTCCCGTGAAAGTTCGTTATGCATTGGAAAAGACAGCTTTAGATAAATCCGTCTCACCACTTGCGATTCGTTATGAGCAAAAACGTATGTCTAAATCACATACCTTTTCAAAAGCGTCGGTTAATTGTCTTAAAGTAGGTAGTCCCGTCGCATTCGTTGGCGTTTTGTTCGCTCTTCTTGGTATAAAAATCAGGCGGCGAGTCAGATTCTTAGAATCAAATTGAATGAAAGCCCGGTACGCTGGGCTTTTTTATTCAGTAACTTTTATCAAATATGTAGTAATTTACCGGAATCTGCTTCTCCAGCTTGTTAGCTGAAAAGCTTACTCAAGTATAATAATCTACTTCTGATTATGTTTTTTATGGTTTTATTTTTACACAACTT	NA	NA	NA	NA
WP_174243431.1|69323_69644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165367.1|70160_70472_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001371932.1|70476_70968_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000781547.1|71520_71724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|71778_72003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|72042_72243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|72465_72777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000802040.1|72830_73007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|73152_73434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000137794.1|73650_74256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949440.1|74588_75957_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_000589001.1|76132_77473_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000219087.1|77894_79133_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
WP_001515348.1|79608_80181_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_000167917.1|80380_81304_+	cation transporter	NA	NA	NA	NA	NA
WP_000534858.1|81566_81806_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|81805_82093_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_001447866.1|82164_82323_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000332796.1|82931_83252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015183.1|83533_83737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743059.1|83783_84134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695474.1|84193_84796_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
>prophage 6
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	94409	95591	269306		Erwinia_phage(100.0%)	1	NA	NA
WP_000952985.1|94409_95591_-	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	7.5e-13
>prophage 7
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	119300	123203	269306	transposase	Cronobacter_phage(66.67%)	3	NA	NA
WP_000281824.1|119300_120560_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.5	1.5e-96
WP_000111290.1|120543_120978_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_100185530.1|122288_123203_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
>prophage 8
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	127590	132859	269306		uncultured_Caudovirales_phage(100.0%)	6	NA	NA
WP_000130816.1|127590_128295_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|128381_128702_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|128747_130037_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|130049_130475_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|130534_131362_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|131380_132859_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
>prophage 9
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	136542	138928	269306		Pacmanvirus(33.33%)	3	NA	NA
WP_000464825.1|136542_137058_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833380.1|137272_138700_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|138760_138928_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
>prophage 10
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	145455	151040	269306	transposase	Bacillus_phage(33.33%)	5	NA	NA
WP_004248839.1|145455_146802_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_072196614.1|146840_147809_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
WP_001572373.1|147997_149617_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|149693_150170_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001067855.1|150335_151040_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 11
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	154439	155297	269306		Salmonella_phage(100.0%)	1	NA	NA
WP_000784387.1|154439_155297_-	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
>prophage 12
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	158947	210678	269306	protease,transposase,integrase	Escherichia_phage(21.43%)	52	189921:189935	207494:207508
WP_000209296.1|158947_160633_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|160650_161016_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|161012_161249_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000993245.1|161314_161527_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000118563.1|161535_162612_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_012695446.1|162608_165014_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.0	6.6e-141
WP_000405672.1|165099_165534_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|165624_166629_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000985909.1|167347_167758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|167858_168065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088044.1|168125_169451_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_012477377.1|169455_169749_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174243432.1|170149_171538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340139.1|171542_172040_-	membrane protein	NA	NA	NA	NA	NA
WP_000462754.1|172242_172899_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000341066.1|173557_173950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211823.1|174870_175857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166877.1|175853_177893_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.7e-25
WP_000880375.1|177895_178150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|179136_179478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|179569_179761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000374058.1|180001_180457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053340.1|180547_181789_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000301247.1|182217_182793_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_000116680.1|182861_183440_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|183488_184529_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|184551_185007_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054786.1|185029_186187_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254137.1|186186_186768_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_012695441.1|187088_188147_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280115.1|188156_189299_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_001040058.1|189291_190065_+	hypothetical protein	NA	NA	NA	NA	NA
189921:189935	attL	GGCTGAACGCGGAGT	NA	NA	NA	NA
WP_001585166.1|190066_191146_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_011152965.1|191145_192102_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_011152964.1|192112_193321_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|193338_193806_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_001253657.1|194268_194907_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|194929_195571_+	TerD family protein	NA	NA	NA	NA	NA
WP_001253658.1|195570_196209_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|196293_197334_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000081059.1|197333_198971_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001284318.1|198996_200496_+	kinase	NA	NA	NA	NA	NA
WP_001232447.1|200661_201744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285422.1|202104_202317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174243435.1|203293_204439_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WEY3	Macacine_betaherpesvirus	27.4	2.9e-17
WP_001424615.1|204460_204664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001198595.1|204740_205646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119428.1|205655_206618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|206907_207612_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
207494:207508	attR	ACTCCGCGTTCAGCC	NA	NA	NA	NA
WP_000027057.1|208067_208928_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|209110_209668_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|209973_210678_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 13
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	228064	229849	269306		Bacillus_virus(100.0%)	1	NA	NA
WP_000517885.1|228064_229849_-	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	23.1	6.0e-22
>prophage 14
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	243922	246635	269306	transposase	Salmonella_phage(50.0%)	3	NA	NA
WP_072201439.1|243922_244891_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
WP_012695436.1|244947_245586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818954.1|245597_246635_-	hypothetical protein	NA	A0A0A7NPX4	Enterobacteria_phage	35.0	3.6e-43
>prophage 15
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	249740	250745	269306		Aeromonas_phage(100.0%)	1	NA	NA
WP_001278838.1|249740_250745_-	ParB N-terminal domain-containing protein	NA	A0A1I9KFW9	Aeromonas_phage	33.8	2.7e-11
>prophage 16
NZ_CP048293	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence	269306	266571	268373	269306	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001323403.1|266571_267351_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001572805.1|267350_268373_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
>prophage 1
NZ_CP048296	Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence	137411	73522	121783	137411	transposase,protease	Escherichia_phage(20.0%)	36	NA	NA
WP_023153775.1|73522_74176_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|74268_74526_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|74458_74860_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001262766.1|75144_76917_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001214976.1|80547_80955_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|81092_81977_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|82008_83208_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|83313_83964_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|83995_84238_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067858.1|85475_86180_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_174243440.1|87766_89374_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	61.7	7.8e-162
WP_001067858.1|89350_90055_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_015011220.1|90140_90296_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000131886.1|90462_91362_+	aminoglycoside N-acetyltransferase AAC(3)-VIa	NA	NA	NA	NA	NA
WP_000535481.1|91568_91889_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	47.9	1.0e-17
WP_174243439.1|91944_92088_+	hypothetical protein	NA	A0A2I7SAK5	Vibrio_phage	70.0	8.7e-09
WP_001067858.1|92121_92826_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000612591.1|95540_95888_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|95884_96265_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001017346.1|96340_97321_-	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_000379710.1|97317_97587_-	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_001323890.1|98526_98763_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001259758.1|98740_99052_+	colicin V	NA	NA	NA	NA	NA
WP_001183604.1|99221_101336_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_000489609.1|101310_102585_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001324224.1|103266_103464_+	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_000969988.1|103460_103643_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000377483.1|103741_104050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001190234.1|104609_105644_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_001222186.1|106509_108687_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_000271274.1|108731_109688_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933678.1|109772_111002_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_001389363.1|111105_114765_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.6e-45
WP_001318220.1|114904_116020_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000738422.1|119165_119459_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_088846059.1|120620_121783_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
