The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050400	Acinetobacter baumannii strain VB11737 chromosome, complete genome	3982992	0	54224	3982992	tRNA,transposase,integrase	Vibriophage(14.29%)	52	5370:5429	17103:17299
WP_000736393.1|0_711_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	5.3e-06
WP_000573066.1|711_2622_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_085940413.1|3043_4134_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|4226_5042_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|5128_5431_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_071543477.1|5324_5618_-	hypothetical protein	NA	NA	NA	NA	NA
5370:5429	attL	CAACGTATAGGAAGAATAAACGCCCTTTTCACCCAAGTCCAACAGCTTTGGACCGCAGTT	NA	NA	NA	NA
WP_000736396.1|5822_6533_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
WP_000573060.1|6533_8444_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002020149.1|8448_9087_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000529372.1|9461_9833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095006.1|9905_10205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034564.1|10272_11124_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_000953322.1|11136_12624_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.4	8.3e-219
WP_001144964.1|12918_14715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001089073.1|14797_16015_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|16096_16720_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_000512977.1|16697_17102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|17339_18833_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
17103:17299	attR	CAACGTATAGGAAGAATAAACGCCCTTTTCACCCAAGTCCAACAGCTTTGGACCGCAGTTGACTCTTTCGACACCCCTGCGATGCAACCCAATCCGGCTGACGGGGAGCCAGCAACGCTGAAAATTTACCCTCCTCTTTCCCACTAGCGGCTCCTTTTCCGACAACCAGCACGGCGGATCCCTGCCGCGGCGCTGTG	NA	NA	NA	NA
WP_000743213.1|19043_19268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|19387_20224_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|20223_21027_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001144971.1|21409_23197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010465.1|23279_24137_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000894500.1|24202_24430_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000780326.1|24709_25048_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_000738520.1|25105_26503_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
WP_000543541.1|26660_27119_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_001292506.1|27134_28220_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.1e-48
WP_001083669.1|28216_29509_+	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_000493866.1|29551_30211_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
WP_000354154.1|30270_30489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001988710.1|30619_31258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151592.1|31296_31704_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000673449.1|31696_33145_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
WP_000586912.1|33288_34389_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000881094.1|34388_35459_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000128749.1|35584_37132_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000942504.1|37147_38332_+	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
WP_000840549.1|38335_39757_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_002001070.1|39781_41305_-	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.3	2.3e-06
WP_000633799.1|41360_41996_-	response regulator	NA	NA	NA	NA	NA
WP_003384760.1|42208_43255_+	D-alanyl-D-alanine endopeptidase PBP7/8	NA	NA	NA	NA	NA
WP_000063593.1|43361_44501_-	threonine synthase	NA	NA	NA	NA	NA
WP_000805827.1|44556_45858_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000011159.1|46102_46918_-	DsbC family protein	NA	NA	NA	NA	NA
WP_000608730.1|47064_47985_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	6.7e-33
WP_001991212.1|48128_48392_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_001278225.1|48388_50242_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_000942498.1|50262_50514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000908243.1|50674_52021_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000907680.1|52045_53242_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_000216739.1|53291_54224_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP050400	Acinetobacter baumannii strain VB11737 chromosome, complete genome	3982992	722298	741858	3982992	integrase	Acinetobacter_phage(40.0%)	33	720112:720126	735138:735152
720112:720126	attL	AATTTTATTTAATTC	NA	NA	NA	NA
WP_000947475.1|722298_723456_+|integrase	site-specific integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	63.0	4.9e-134
WP_001076477.1|723452_724337_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000549863.1|724327_724783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000527288.1|724897_725890_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000119264.1|725896_726067_-	hypothetical protein	NA	A0A2H4JBW6	uncultured_Caudovirales_phage	69.2	2.4e-13
WP_001292077.1|726067_726283_-	hypothetical protein	NA	I2GUB6	Acinetobacter_phage	92.9	8.5e-32
WP_000028957.1|726279_726489_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	6.3e-32
WP_000578497.1|726485_726995_-	phage protein	NA	A0A0P0I8H3	Acinetobacter_phage	87.8	1.6e-33
WP_000609004.1|726991_727528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464381.1|727520_727700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986115.1|727700_727991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805214.1|728131_729160_-	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	1.3e-13
WP_000644001.1|729172_729853_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_001260063.1|730023_730395_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	38.8	2.2e-11
WP_001072362.1|730391_730721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350172.1|730779_731040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290758.1|731124_731928_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	33.3	1.1e-26
WP_000105905.1|731967_732300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000922095.1|732515_732791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000550612.1|732802_733492_-	helix-turn-helix domain-containing protein	NA	A0A0R6PCY1	Moraxella_phage	37.1	5.0e-25
WP_000335919.1|733618_733852_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000818521.1|733884_734259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290738.1|734292_734493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200037.1|734489_734675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000575725.1|734671_735127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218432.1|735123_735771_+	hypothetical protein	NA	R9VWB9	Serratia_phage	38.6	2.0e-31
735138:735152	attR	AATTTTATTTAATTC	NA	NA	NA	NA
WP_000606801.1|735767_736742_+	phosphoadenosine phosphosulfate reductase family protein	NA	A4JX51	Burkholderia_virus	48.5	8.8e-76
WP_002029044.1|736747_737134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001055562.1|737130_738609_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	53.3	9.7e-135
WP_000124473.1|738612_739656_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_000994866.1|739652_740417_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	6.7e-63
WP_000990949.1|740413_740947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001136753.1|741402_741858_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
>prophage 3
NZ_CP050400	Acinetobacter baumannii strain VB11737 chromosome, complete genome	3982992	976472	988820	3982992		Acinetobacter_phage(95.65%)	24	NA	NA
WP_000004579.1|976472_977195_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
WP_000147323.1|977191_977599_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000654846.1|977599_977851_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000698529.1|977852_978785_-	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_169062440.1|978781_979903_-	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	99.2	8.2e-211
WP_000064472.1|979914_980238_-	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	97.2	2.8e-55
WP_000656410.1|980230_980521_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	99.0	1.6e-49
WP_001101038.1|980520_980964_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000051960.1|981157_981400_+	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_000845537.1|981406_981610_-	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_001129676.1|981748_982252_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000048052.1|982253_983261_-	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_000370485.1|983312_983528_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000052252.1|983542_984295_-	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000703023.1|984399_984588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000048916.1|984598_984919_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_001180660.1|984980_985253_+	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
WP_000602535.1|985324_985549_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_000064627.1|985541_986423_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_001003671.1|986425_987226_+	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000647826.1|987222_987561_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_000462878.1|987553_987946_+	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000100162.1|987945_988347_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_001277128.1|988343_988820_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
>prophage 4
NZ_CP050400	Acinetobacter baumannii strain VB11737 chromosome, complete genome	3982992	992778	1012579	3982992		Acinetobacter_phage(95.0%)	23	NA	NA
WP_001136773.1|992778_993234_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
WP_000378523.1|993294_993729_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
WP_162207452.1|994166_994553_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.8	2.2e-46
WP_000539749.1|994524_994893_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
WP_001984404.1|994849_995293_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
WP_001277696.1|995294_995513_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_000749909.1|995621_996143_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000064593.1|996239_996593_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000002408.1|996592_997771_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000094278.1|997823_998741_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_001185585.1|998810_999326_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000335868.1|999828_1000128_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_000274931.1|1000136_1000595_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000721572.1|1000699_1001380_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_001275792.1|1001381_1001645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|1001772_1006083_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_000721057.1|1006173_1006761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277448.1|1006853_1007252_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000368388.1|1007251_1007758_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000835160.1|1007754_1008117_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_105910231.1|1008109_1011535_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.3	0.0e+00
WP_000433907.1|1011602_1011992_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_001019739.1|1012033_1012579_+	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
>prophage 5
NZ_CP050400	Acinetobacter baumannii strain VB11737 chromosome, complete genome	3982992	2099759	2149256	3982992	transposase,terminase,integrase,capsid	Acinetobacter_phage(98.31%)	66	2099235:2099252	2149417:2149434
2099235:2099252	attL	ATAAAAGAAGTAGAATCC	NA	NA	NA	NA
WP_085942227.1|2099759_2100924_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
WP_000151893.1|2101170_2101764_-	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	5.1e-103
WP_001109862.1|2101770_2102418_-	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
WP_000999701.1|2102428_2103109_-	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	100.0	4.6e-116
WP_001019742.1|2103297_2103843_-	N-acetylmuramidase	NA	A0A0P0IW03	Acinetobacter_phage	96.7	2.7e-98
WP_000433918.1|2103885_2104275_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
WP_059273140.1|2104342_2107768_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	95.8	0.0e+00
WP_000835160.1|2107760_2108123_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000368388.1|2108119_2108626_-	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000277448.1|2108625_2109024_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000721057.1|2109116_2109704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070508488.1|2109794_2114105_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	97.9	0.0e+00
WP_000106804.1|2114182_2114458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000722131.1|2114476_2114998_-	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	67.8	7.8e-63
WP_000453244.1|2115084_2115321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065059.1|2115529_2116459_+	ORF6N domain-containing protein	NA	A0A0P0J0J7	Acinetobacter_phage	86.5	4.7e-87
WP_001258718.1|2116573_2117284_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_030423917.1|2117834_2118350_-	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	98.5	6.3e-73
WP_000094270.1|2118420_2119338_-	hypothetical protein	NA	A0A0D4DBN5	Acinetobacter_phage	100.0	2.6e-170
WP_000002419.1|2119390_2120746_-	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	97.6	1.6e-197
WP_000064602.1|2120745_2121099_-	hypothetical protein	NA	A0A0P0IY61	Acinetobacter_phage	96.6	1.0e-58
WP_000178914.1|2121167_2121566_-	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	95.5	4.2e-69
WP_000539746.1|2121567_2121936_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	85.2	6.1e-54
WP_000248222.1|2121907_2122312_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	90.2	9.3e-64
WP_002029757.1|2122340_2122493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000914808.1|2122532_2123201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002075957.1|2123238_2123607_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	95.9	4.2e-63
WP_000008496.1|2123608_2123998_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
WP_000692540.1|2124002_2124668_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
WP_000214198.1|2124733_2125690_-	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
WP_000770049.1|2125717_2126485_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_001139861.1|2126598_2126790_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000004363.1|2127007_2127250_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_000965231.1|2127348_2127777_-	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000179763.1|2127785_2128889_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
WP_001286355.1|2128890_2130342_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	100.0	1.0e-285
WP_000102080.1|2130338_2131766_-|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
WP_000212566.1|2131755_2132226_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_002001438.1|2132284_2132926_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	99.5	6.1e-126
WP_000341072.1|2132894_2133323_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	66.9	5.4e-46
WP_000134363.1|2133335_2133527_-	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	85.7	5.8e-24
WP_002001437.1|2133716_2134367_-	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
WP_000783470.1|2134562_2135063_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
WP_000100185.1|2135059_2135455_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
WP_001288422.1|2135454_2135679_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_095357150.1|2135671_2136034_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	3.3e-68
WP_000647820.1|2136083_2136506_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	100.0	2.9e-76
WP_000544510.1|2136502_2137252_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	100.0	9.6e-139
WP_001110399.1|2137244_2138195_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	63.3	1.6e-98
WP_001033653.1|2138191_2139238_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	1.7e-109
WP_001095606.1|2139234_2139525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049332.1|2139580_2139901_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	88.7	3.2e-43
WP_000996060.1|2139911_2140163_-	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	95.2	2.4e-38
WP_001093662.1|2140271_2141036_+	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	98.8	1.6e-144
WP_000370477.1|2141050_2141266_+	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	100.0	2.5e-31
WP_000065151.1|2141398_2143666_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	100.0	0.0e+00
WP_001101046.1|2143861_2144302_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	95.9	4.1e-73
WP_000181038.1|2144304_2144628_+	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	88.8	1.1e-48
WP_001207477.1|2144639_2145761_+	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	100.0	2.6e-212
WP_001061226.1|2145757_2146717_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	86.8	7.2e-155
WP_000654796.1|2146718_2146976_+	hypothetical protein	NA	A0A0P0I475	Acinetobacter_phage	100.0	2.0e-43
WP_000453807.1|2146966_2147176_+	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	100.0	7.4e-33
WP_000048755.1|2147172_2147457_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	100.0	2.3e-45
WP_000005650.1|2147460_2147718_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	100.0	5.9e-48
WP_000910238.1|2147718_2147988_+	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000773619.1|2147993_2149256_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	100.0	3.8e-249
2149417:2149434	attR	ATAAAAGAAGTAGAATCC	NA	NA	NA	NA
>prophage 6
NZ_CP050400	Acinetobacter baumannii strain VB11737 chromosome, complete genome	3982992	2492940	2561599	3982992	terminase,tail,integrase,capsid	Acinetobacter_phage(84.85%)	77	2496578:2496594	2546794:2546810
WP_000872622.1|2492940_2494482_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	100.0	3.9e-288
WP_000999148.1|2494478_2496281_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	100.0	0.0e+00
2496578:2496594	attL	ATGCTTCTAATGATCGA	NA	NA	NA	NA
WP_000947610.1|2496768_2497965_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0D4DBR3	Acinetobacter_phage	99.7	1.3e-225
WP_000098296.1|2497961_2498156_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	100.0	3.8e-31
WP_075703253.1|2498584_2499130_-	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	92.2	6.8e-94
WP_004714964.1|2499172_2499562_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	99.2	7.3e-66
WP_000371015.1|2499629_2500355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141976.1|2500354_2500678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162207447.1|2500678_2509159_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	35.9	3.0e-10
WP_000920736.1|2509225_2509897_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	46.8	1.2e-39
WP_000778488.1|2509880_2510636_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	57.4	4.5e-88
WP_000175075.1|2510642_2511341_-|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	68.1	4.8e-92
WP_000985763.1|2511350_2511701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281459.1|2511755_2512097_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000191303.1|2512214_2516183_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	44.3	1.4e-164
WP_053530939.1|2516279_2516798_-	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	41.5	5.8e-26
WP_000966689.1|2516893_2517298_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	88.8	1.0e-62
WP_000838146.1|2517362_2517545_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_001185622.1|2517876_2518410_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	59.9	6.3e-44
WP_000094300.1|2518454_2519384_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	40.8	5.3e-54
WP_000121166.1|2519492_2519705_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	75.4	1.3e-21
WP_001132270.1|2519706_2520105_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	71.2	4.0e-51
WP_000539752.1|2520106_2520475_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	4.8e-51
WP_000248324.1|2520446_2520851_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	92.5	4.9e-65
WP_001197735.1|2520859_2521273_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	76.6	5.6e-56
WP_032041498.1|2521229_2521619_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	95.3	8.9e-64
WP_000767881.1|2521623_2522289_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	67.4	5.2e-72
WP_053530938.1|2522353_2523310_-	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	94.0	1.5e-168
WP_000770060.1|2523337_2524105_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	94.1	8.1e-117
WP_000159880.1|2524218_2524533_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	48.5	3.4e-13
WP_000166323.1|2524601_2525114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114226350.1|2525406_2526510_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	97.5	2.4e-202
WP_001286362.1|2526511_2527963_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.8	8.5e-285
WP_071543448.1|2527959_2529387_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	90.3	6.1e-259
WP_053530951.1|2529376_2529847_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	92.3	1.6e-75
WP_000372128.1|2529905_2530547_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	99.1	1.4e-125
WP_000377939.1|2530515_2530983_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	76.8	4.4e-65
WP_000359988.1|2530972_2531146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000837652.1|2531460_2532231_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	60.8	1.4e-89
WP_001989822.1|2532416_2532647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214487.1|2532827_2533391_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	52.5	3.2e-46
WP_001279874.1|2533412_2533697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203140.1|2533706_2534114_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	4.0e-22
WP_001293626.1|2534110_2534512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039747.1|2534498_2534681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000779000.1|2534677_2535076_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.5	1.5e-26
WP_000755976.1|2535087_2535954_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	43.7	1.4e-72
WP_000049976.1|2536405_2537509_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	56.1	1.4e-29
WP_000612880.1|2537505_2538360_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_039105851.1|2538356_2538668_-	hypothetical protein	NA	A0A0D4DCL5	Acinetobacter_phage	62.0	3.8e-25
WP_033503108.1|2538664_2538937_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	91.1	6.5e-37
WP_000166124.1|2538984_2539251_-	hypothetical protein	NA	A0A0D4DBY7	Acinetobacter_phage	100.0	1.6e-43
WP_001068174.1|2539287_2539518_-	hypothetical protein	NA	A0A0D4DBS7	Acinetobacter_phage	100.0	6.1e-36
WP_000605245.1|2539644_2540370_+	LexA family transcriptional regulator	NA	A0A0D4DBI5	Acinetobacter_phage	100.0	1.8e-134
WP_000562174.1|2540409_2540709_+	hypothetical protein	NA	A0A0D4DCL0	Acinetobacter_phage	100.0	1.5e-47
WP_001037047.1|2540748_2541039_+	hypothetical protein	NA	A0A0D4DCB9	Acinetobacter_phage	100.0	7.9e-49
WP_001169164.1|2541096_2541312_+	KTSC domain-containing protein	NA	A0A0D4DBY2	Acinetobacter_phage	100.0	5.0e-32
WP_000276791.1|2541362_2541653_+	hypothetical protein	NA	A0A0D4DBS2	Acinetobacter_phage	100.0	1.5e-44
WP_001101038.1|2542145_2542589_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000656410.1|2542588_2542879_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	99.0	1.6e-49
WP_000064472.1|2542871_2543195_+	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	97.2	2.8e-55
WP_053530958.1|2543206_2544328_+	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	99.5	3.7e-211
WP_075703273.1|2544324_2545401_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	72.3	6.4e-136
WP_053530945.1|2545402_2545648_+	hypothetical protein	NA	A0A0P0I475	Acinetobacter_phage	98.8	2.5e-40
WP_023188241.1|2545651_2546059_+	phage protein	NA	A0A0P0I8H3	Acinetobacter_phage	97.0	1.3e-12
WP_016062494.1|2546055_2546409_+	hypothetical protein	NA	J7I0Y4	Acinetobacter_phage	100.0	1.2e-62
WP_000529848.1|2546409_2546679_+	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
WP_000566784.1|2546802_2547378_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
2546794:2546810	attR	ATGCTTCTAATGATCGA	NA	NA	NA	NA
WP_000960548.1|2547473_2550173_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
WP_000281127.1|2550252_2552985_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
WP_001982145.1|2553340_2554390_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608304.1|2554399_2555206_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_000066126.1|2555215_2555911_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_001164226.1|2555921_2556905_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
WP_001076817.1|2556911_2559287_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
WP_000893683.1|2559288_2560788_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
WP_001187844.1|2561050_2561599_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 7
NZ_CP050400	Acinetobacter baumannii strain VB11737 chromosome, complete genome	3982992	3930136	3976898	3982992	transposase,integrase	uncultured_Caudovirales_phage(36.36%)	43	3971829:3971844	3980287:3980302
WP_085940413.1|3930136_3931226_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001098168.1|3931530_3932016_-	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
WP_000351002.1|3932097_3932502_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000039483.1|3932649_3933909_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000102049.1|3934123_3936502_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	79.2	2.8e-115
WP_000291529.1|3936815_3937316_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000216805.1|3937461_3937815_-	RidA family protein	NA	NA	NA	NA	NA
WP_001226146.1|3938135_3939191_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000163501.1|3939192_3939951_-	glycoside hydrolase family 25 protein	NA	NA	NA	NA	NA
WP_000994598.1|3940028_3941420_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_001986939.1|3941628_3942234_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.8	2.5e-12
WP_000575778.1|3942578_3944171_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	8.8e-41
WP_000193996.1|3944242_3944710_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000927792.1|3944755_3945400_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000364292.1|3945482_3946802_+	MFS transporter	NA	NA	NA	NA	NA
WP_000202252.1|3946955_3949175_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.9	3.2e-81
WP_000411991.1|3949472_3951152_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	1.7e-34
WP_001187001.1|3951190_3951574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001985514.1|3951668_3952079_+	MAPEG family protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	43.8	2.4e-14
WP_000122443.1|3952206_3952734_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.2	9.6e-61
WP_000910004.1|3952840_3954157_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_001985635.1|3955066_3955894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772971.1|3955936_3956815_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000845026.1|3956830_3957607_-	aldolase	NA	NA	NA	NA	NA
WP_001131945.1|3959167_3959851_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000736396.1|3959975_3960686_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
WP_000573060.1|3960686_3962597_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000417085.1|3962601_3963522_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000081835.1|3963551_3964667_+	TniQ family protein	NA	NA	NA	NA	NA
WP_002017214.1|3964659_3966090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529372.1|3966464_3966836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095006.1|3966908_3967208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034564.1|3967275_3968127_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_001277980.1|3968139_3969606_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.6	2.3e-213
WP_085947913.1|3969609_3970700_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000262332.1|3970801_3971134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001992510.1|3971141_3971696_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
3971829:3971844	attL	ATGCTGAAGATGAAAA	NA	NA	NA	NA
WP_001046004.1|3972360_3973182_-	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_085947913.1|3973287_3974377_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000168733.1|3974716_3974986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000798673.1|3975039_3975396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001006517.1|3975441_3975759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886984.1|3975965_3976898_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.8	1.7e-23
3980287:3980302	attR	ATGCTGAAGATGAAAA	NA	NA	NA	NA
