The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051749	Escherichia coli strain SCU-486 chromosome, complete genome	5198439	176577	186020	5198439		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001551350.1|176577_177714_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
WP_001551351.1|177710_179711_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|179835_180297_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551352.1|180338_180809_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001308766.1|180855_181575_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|181571_183257_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_169062332.1|183478_184210_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	8.2e-111
WP_001216963.1|184269_184377_+	protein YohO	NA	NA	NA	NA	NA
WP_000783134.1|184357_185089_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|185093_186020_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 2
NZ_CP051749	Escherichia coli strain SCU-486 chromosome, complete genome	5198439	822687	829827	5198439		Escherichia_phage(83.33%)	6	NA	NA
WP_001272891.1|822687_825249_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
WP_001141345.1|825354_826011_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|826061_826829_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847985.1|827024_827933_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001551546.1|827929_829192_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_001278994.1|829188_829827_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 3
NZ_CP051749	Escherichia coli strain SCU-486 chromosome, complete genome	5198439	2328777	2372303	5198439	integrase,head,tail	Enterobacteria_phage(45.71%)	41	2328726:2328753	2375488:2375515
2328726:2328753	attL	ATTTGTGTACCAAATTGTGTACCAATTT	NA	NA	NA	NA
WP_001196928.1|2328777_2329986_+|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	74.9	4.7e-180
WP_001354056.1|2329943_2330174_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	55.7	2.9e-14
WP_000488401.1|2330264_2330543_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.4e-47
WP_000763364.1|2330590_2330809_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_001386642.1|2330907_2331189_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|2331199_2331391_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682318.1|2331363_2331546_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186804.1|2331542_2332223_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000100847.1|2332219_2333005_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995443.1|2333010_2333307_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_023148105.1|2333382_2333673_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000259990.1|2334184_2334940_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|2334978_2335209_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182891.1|2335278_2335818_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_001551200.1|2335904_2336834_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_000788813.1|2336830_2337532_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_000145915.1|2337528_2337831_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070450.1|2337898_2338231_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001356997.1|2338304_2338427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001445652.1|2340464_2341016_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|2341025_2341823_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|2341939_2342041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054342.1|2342037_2342493_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_000224916.1|2342492_2342663_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|2342655_2342946_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000971055.1|2343302_2343443_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204777.1|2343528_2343906_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|2344061_2344586_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592546.1|2344778_2345738_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_169062365.1|2347235_2347733_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	6.0e-89
WP_169062366.1|2348211_2348511_-	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	90.3	1.4e-40
WP_169062367.1|2350213_2350444_+	hypothetical protein	NA	A0A2I6TC92	Escherichia_phage	97.1	2.5e-34
WP_000198149.1|2351617_2351824_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000158895.1|2356181_2356577_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
WP_000847339.1|2362058_2362388_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
WP_001551186.1|2362387_2363086_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000090872.1|2363771_2364404_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	1.2e-94
WP_019843055.1|2364464_2367863_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_001563781.1|2367930_2368530_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.4	8.6e-98
WP_001518417.1|2370971_2371253_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_016247637.1|2371262_2372303_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	66.1	3.0e-122
2375488:2375515	attR	ATTTGTGTACCAAATTGTGTACCAATTT	NA	NA	NA	NA
>prophage 4
NZ_CP051749	Escherichia coli strain SCU-486 chromosome, complete genome	5198439	2746710	2774218	5198439	tail,terminase,lysis	Escherichia_phage(33.33%)	25	NA	NA
WP_169062373.1|2746710_2749059_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
WP_169062374.1|2749795_2753275_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	90.2	0.0e+00
WP_050496112.1|2753335_2753938_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	83.7	3.4e-86
WP_021520058.1|2753874_2754618_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	4.0e-145
WP_001578255.1|2754623_2755322_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	1.9e-128
WP_000024051.1|2755321_2755660_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_169062375.1|2755652_2758889_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	8.7e-112
WP_141010409.1|2759362_2759722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2759872_2760835_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000144678.1|2760861_2761254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001405084.1|2761250_2761631_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.6	5.5e-18
WP_000524262.1|2761631_2762015_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	40.2	4.4e-15
WP_000634214.1|2762014_2762410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|2762413_2762590_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000918483.1|2762632_2763772_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	3.3e-159
WP_000770038.1|2763870_2764635_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
WP_001317036.1|2764739_2765852_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
WP_000763709.1|2765835_2767242_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	8.8e-186
WP_001578252.1|2767244_2768546_-	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	59.8	1.8e-148
WP_000089446.1|2768526_2769621_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	4.5e-113
WP_000126788.1|2769624_2769834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204032.1|2769811_2770744_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
WP_001291102.1|2770736_2771525_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.9	7.4e-49
WP_001228696.1|2773315_2773501_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135296.1|2773720_2774218_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
>prophage 5
NZ_CP051749	Escherichia coli strain SCU-486 chromosome, complete genome	5198439	2780355	2796047	5198439	tRNA	Escherichia_phage(57.89%)	20	NA	NA
WP_169062376.1|2780355_2780598_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	56.7	4.8e-15
WP_169062377.1|2780702_2781014_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.3	2.3e-06
WP_072664904.1|2781778_2782201_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.9	1.2e-61
WP_045145123.1|2782216_2782978_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.8e-116
WP_072664903.1|2783000_2783747_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.6	1.1e-113
WP_021542964.1|2783753_2784542_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	3.0e-42
WP_045145118.1|2784620_2785043_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	6.5e-68
WP_045145116.1|2785039_2785282_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.6	5.1e-17
WP_000410102.1|2785378_2785798_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001169151.1|2786245_2786401_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2786397_2786886_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2787327_2787549_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2787548_2787719_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2787793_2788069_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105139.1|2788170_2790771_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
WP_000166319.1|2790763_2791573_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000079604.1|2792105_2792321_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040858.1|2792322_2793558_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_001157407.1|2793609_2794545_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_001551034.1|2794673_2796047_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
>prophage 6
NZ_CP051749	Escherichia coli strain SCU-486 chromosome, complete genome	5198439	3006617	3074613	5198439	tail,terminase,lysis,capsid,tRNA,integrase,head,portal,holin	Enterobacteria_phage(40.0%)	92	3025692:3025706	3074715:3074729
WP_001295972.1|3006617_3007724_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3007759_3008401_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|3008404_3009775_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|3009943_3010615_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|3010614_3012075_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133413.1|3012629_3012911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565609.1|3013076_3013511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001403033.1|3013786_3014200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380877.1|3014212_3014548_-|head	head decoration protein	head	NA	NA	NA	NA
WP_001403032.1|3014559_3015615_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	44.0	7.1e-71
WP_000796959.1|3015614_3015821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180518.1|3016075_3016324_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126698.1|3016334_3016745_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000557475.1|3016741_3017020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169062384.1|3017308_3019063_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.8	1.0e-90
WP_000770153.1|3019059_3019359_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000549005.1|3019364_3019592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551676.1|3019584_3019815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064735217.1|3019804_3020005_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_064735216.1|3020198_3020504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169062385.1|3021004_3021193_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.7	7.0e-14
WP_032180526.1|3021556_3022786_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_001295435.1|3023033_3024155_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3024203_3025430_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3025679_3026816_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
3025692:3025706	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|3026799_3027663_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000937496.1|3027894_3028161_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_001550976.1|3028229_3028886_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071586406.1|3028940_3029039_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000355700.1|3029078_3029372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204582.1|3029381_3029660_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_021553086.1|3031872_3032472_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	89.4	5.4e-100
WP_021519674.1|3032539_3036232_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.9	0.0e+00
WP_072258937.1|3036576_3037209_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	92.3	1.7e-96
WP_001576728.1|3037154_3037898_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	8.3e-143
WP_001327694.1|3037903_3038602_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_000847298.1|3038601_3038931_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_169062386.1|3039621_3040107_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.4	1.4e-74
WP_169062387.1|3040305_3041493_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.1	1.4e-187
WP_000533402.1|3041473_3041887_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|3041913_3042345_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235037.1|3042363_3043110_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_000683079.1|3043117_3043513_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974995.1|3043509_3044043_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.1	1.2e-55
WP_001204571.1|3044058_3044412_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000201498.1|3044404_3044788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522583.1|3044839_3045868_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	8.6e-114
WP_000256835.1|3045925_3046273_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_001253953.1|3046309_3047815_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	2.7e-100
WP_001537684.1|3047804_3049397_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.9e-185
WP_000258993.1|3049393_3049600_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001537733.1|3049583_3051512_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.5	9.4e-263
WP_000235436.1|3051483_3051993_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001322427.1|3052475_3052829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3052951_3053278_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_032196491.1|3053589_3054057_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	83.8	1.5e-65
WP_001280932.1|3054059_3054191_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001446668.1|3054205_3054388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001545912.1|3054544_3055078_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.6	3.3e-101
WP_001545911.1|3055114_3056005_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.6	4.7e-108
WP_000284506.1|3056009_3056225_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001545910.1|3056374_3056536_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	3.5e-14
WP_001309419.1|3056532_3056736_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_169062388.1|3056981_3057317_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.5e-43
WP_001438304.1|3057597_3057729_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_001545909.1|3058621_3059443_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000139998.1|3059457_3059820_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001545908.1|3059820_3060879_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	4.9e-88
WP_023141427.1|3060880_3061153_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|3061320_3061476_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001529162.1|3062084_3062399_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	71.6	3.0e-25
WP_000753058.1|3062395_3062572_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	4.3e-26
WP_001224662.1|3062564_3062747_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|3062840_3063197_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001529163.1|3063174_3063798_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	93.5	5.4e-103
WP_001545907.1|3064054_3064357_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	89.9	1.6e-47
WP_072146789.1|3064353_3064635_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	78.5	3.4e-33
WP_001545906.1|3064667_3065384_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	1.3e-71
WP_001545904.1|3065405_3066152_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.4	2.6e-112
WP_000095671.1|3066158_3067121_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693943.1|3067143_3067569_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001517935.1|3067565_3067781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103685.1|3067830_3068547_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.0e-52
WP_000379589.1|3068819_3068975_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001545903.1|3069134_3069353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394528.1|3069375_3069750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023148810.1|3069735_3069882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3070290_3070479_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3070475_3070664_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102132.1|3070756_3073195_+	exonuclease	NA	V5UQJ3	Shigella_phage	45.0	2.3e-112
WP_000003742.1|3073256_3073526_+	excisionase	NA	NA	NA	NA	NA
WP_001545902.1|3073494_3074613_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
3074715:3074729	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 7
NZ_CP051749	Escherichia coli strain SCU-486 chromosome, complete genome	5198439	3984910	4044745	5198439	integrase,plate,transposase	Ralstonia_phage(15.38%)	51	3982336:3982352	4055323:4055339
3982336:3982352	attL	AAATTAATGAGCGACTC	NA	NA	NA	NA
WP_072130023.1|3984910_3986311_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	29.1	1.6e-06
WP_032186138.1|3986427_3986868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021515894.1|3986864_3987089_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032186134.1|3989073_3989700_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_032186132.1|3994710_3995586_+	GTPase family protein	NA	NA	NA	NA	NA
WP_032186131.1|3995799_3996507_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001458941.1|3996508_3996658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032186130.1|3996669_3996885_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000642925.1|3996975_3997386_+	hypothetical protein	NA	G5DES5	Salmonella_phage	42.6	2.1e-26
WP_032186128.1|3997451_3998390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032186126.1|3998479_3999298_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	6.7e-45
WP_032186124.1|3999389_3999872_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	3.4e-12
WP_032186123.1|3999887_4000364_+	RadC family protein	NA	NA	NA	NA	NA
WP_039264365.1|4000426_4000648_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	5.5e-10
WP_000942525.1|4001931_4003002_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_001444700.1|4002980_4003640_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001550659.1|4004158_4005412_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_001285288.1|4005423_4006527_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4006813_4007869_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174684.1|4007907_4008309_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|4008366_4009611_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4009702_4010161_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4010421_4011879_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023063669.1|4011935_4012076_-	peptide chain release factor	NA	NA	NA	NA	NA
WP_001521905.1|4012235_4012490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019842500.1|4012735_4013188_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263491.1|4013197_4013596_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554755.1|4013598_4013892_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001550655.1|4013943_4014999_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_019842510.1|4015069_4015855_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001550652.1|4015799_4017539_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000598760.1|4017643_4017922_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|4017914_4018271_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001550651.1|4018327_4019086_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001225679.1|4019377_4020118_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4020088_4020856_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4020960_4021539_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973092.1|4021778_4024223_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4024265_4024739_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000015781.1|4024892_4025663_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_153269353.1|4027835_4029248_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.5e-23
WP_001550647.1|4032411_4034553_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_001550646.1|4035979_4036480_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001521869.1|4036514_4036739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550644.1|4036789_4038265_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521866.1|4038271_4038685_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001521865.1|4038688_4040539_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348804.1|4040502_4041585_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001550643.1|4041609_4042890_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4042886_4043411_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246418.1|4043413_4044745_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
4055323:4055339	attR	AAATTAATGAGCGACTC	NA	NA	NA	NA
>prophage 8
NZ_CP051749	Escherichia coli strain SCU-486 chromosome, complete genome	5198439	4298413	4380405	5198439	tail,terminase,tRNA,integrase,head,portal,holin	Enterobacteria_phage(38.0%)	86	4341052:4341066	4382386:4382400
WP_021519915.1|4298413_4299100_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4299499_4299640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4299735_4300452_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920350.1|4300511_4301864_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219577.1|4301921_4303346_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	1.2e-09
WP_001188679.1|4303345_4304035_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4304047_4304521_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4304731_4305601_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4305597_4306245_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001545810.1|4306296_4306812_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000068678.1|4306805_4307132_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|4307221_4309159_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046743.1|4309369_4311037_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.2	8.3e-42
WP_000566334.1|4311191_4312079_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000023622.1|4312212_4313223_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001550574.1|4313242_4314040_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001140838.1|4314065_4314482_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_000848792.1|4314639_4314852_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_071591563.1|4314900_4315086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000093813.1|4315311_4316544_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029698.1|4316564_4317947_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132956.1|4317995_4318964_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001550573.1|4319069_4319714_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001550572.1|4319741_4320758_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566139.1|4320789_4321053_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224877.1|4321213_4321933_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4321989_4323213_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477829.1|4323264_4324587_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	5.2e-79
WP_001550571.1|4324664_4325444_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001550570.1|4325701_4327252_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001550569.1|4327223_4328087_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001550568.1|4328120_4328900_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001550567.1|4328896_4329970_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4330091_4330253_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4330379_4330985_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4331377_4332964_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217539.1|4333183_4333432_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_120795384.1|4333858_4333972_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000086527.1|4334661_4335252_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_169062409.1|4335479_4335773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060579084.1|4335783_4336488_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_001550853.1|4336497_4336779_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.2e-17
4341052:4341066	attL	ATTGATACTGGCGGC	NA	NA	NA	NA
WP_071591506.1|4343444_4344077_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000194780.1|4344013_4344757_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001563779.1|4344761_4345460_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_001563778.1|4345459_4345789_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	1.4e-57
WP_001563777.1|4345785_4348365_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.1	0.0e+00
WP_000459472.1|4348357_4348792_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	3.8e-63
WP_001563776.1|4348773_4349187_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	93.6	5.4e-67
WP_001563775.1|4349202_4349943_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	2.5e-131
WP_169062410.1|4352812_4353145_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	98.2	2.7e-53
WP_001563772.1|4354455_4356057_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.2e-309
WP_000198149.1|4356053_4356260_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000867489.1|4358157_4358703_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	1.2e-79
WP_001307652.1|4359090_4359285_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000548594.1|4359535_4359742_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	80.9	2.6e-22
WP_001443523.1|4360383_4360539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|4360687_4360876_-	cold-shock protein	NA	NA	NA	NA	NA
WP_001071778.1|4361471_4361969_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|4361965_4362499_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001557934.1|4362612_4362873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072201599.1|4362820_4363372_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.3e-36
WP_000839581.1|4363376_4363592_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000066482.1|4364345_4364561_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_001589622.1|4364863_4365076_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122990953.1|4365130_4365220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001589621.1|4365497_4366250_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.6	7.1e-134
WP_001589620.1|4366263_4367253_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001072669.1|4367260_4368076_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_000767110.1|4368238_4368634_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210181.1|4368630_4368957_-	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
WP_021518588.1|4368953_4369607_-	phage N-6-adenine-methyltransferase	NA	S5M7S1	Escherichia_phage	99.1	4.3e-127
WP_001305611.1|4369606_4370101_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_060579161.1|4370097_4371039_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	95.8	1.2e-135
WP_071789194.1|4371028_4371208_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	4.6e-15
WP_060579163.1|4371383_4371941_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	93.5	1.0e-92
WP_000205494.1|4371978_4372179_-	cell division protein	NA	NA	NA	NA	NA
WP_000450737.1|4372276_4372903_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_000357060.1|4373270_4373774_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	47.6	1.2e-31
WP_000135680.1|4374235_4374598_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081305.1|4374663_4375488_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	2.3e-149
WP_000008178.1|4375615_4376152_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_001242716.1|4376142_4376505_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	5.8e-65
WP_023154558.1|4376504_4377125_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	93.2	2.5e-116
WP_029402496.1|4377124_4377373_+	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	98.4	1.7e-31
WP_001218280.1|4379181_4380405_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	97.8	1.5e-234
4382386:4382400	attR	GCCGCCAGTATCAAT	NA	NA	NA	NA
>prophage 1
NZ_CP051750	Escherichia coli strain SCU-486 plasmid pSCU-486-1, complete sequence	84296	1262	58099	84296	tRNA,transposase,integrase	Escherichia_phage(23.53%)	47	NA	NA
WP_001066954.1|1262_2003_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_032141192.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|2679_3849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|4695_4968_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|5934_6639_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|8094_8799_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000911324.1|10023_10422_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450532.1|10421_10649_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_011117356.1|10730_16001_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205777.1|16020_16767_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.2	6.0e-08
WP_000139359.1|16821_17382_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_012311405.1|17519_17732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233871.1|17974_18436_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.7	5.5e-20
WP_001333231.1|18481_18691_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000083818.1|19540_19801_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|20026_20101_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130940.1|20093_20951_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_166740453.1|21652_21811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012881119.1|21865_22135_+	ABC transporter ATPase	NA	NA	NA	NA	NA
WP_012881118.1|22131_22413_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012881117.1|22458_23307_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	38.5	5.0e-27
WP_001311056.1|23423_23906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169062429.1|23934_25464_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.3	7.6e-82
WP_001617865.1|25498_26374_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_014342101.1|26353_26476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000608644.1|26623_27886_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_025999368.1|28229_29417_-	MFS transporter	NA	NA	NA	NA	NA
WP_000020504.1|29473_30235_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.7	8.0e-16
WP_001545318.1|30234_31272_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000466682.1|32714_33131_-	SdiA-regulated domain-containing protein	NA	NA	NA	NA	NA
WP_106378881.1|33342_34570_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.9e-168
WP_169062430.1|34868_35318_-	Dr family adhesin structural subunit	NA	NA	NA	NA	NA
WP_000243157.1|35460_35883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000471454.1|38480_39233_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000845048.1|44633_45647_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|45802_46276_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_000679427.1|46459_46807_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|46800_47640_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|47767_47971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|48126_49332_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|49342_49648_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|49874_50639_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|51131_51716_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219391.1|52948_53854_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_002063889.1|55658_56201_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_165587319.1|56292_57448_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	30.6	1.3e-17
WP_001067855.1|57394_58099_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
