The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051744	Escherichia coli strain SCU-484 chromosome, complete genome	5139277	1192511	1199651	5139277		Escherichia_phage(83.33%)	6	NA	NA
WP_001279001.1|1192511_1193150_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_000590417.1|1193146_1194409_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847998.1|1194405_1195314_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_001350157.1|1195509_1196277_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	3.7e-69
WP_001141289.1|1196327_1196984_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_000103863.1|1197089_1199651_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 2
NZ_CP051744	Escherichia coli strain SCU-484 chromosome, complete genome	5139277	1873199	1880934	5139277		Enterobacteria_phage(33.33%)	8	NA	NA
WP_001115964.1|1873199_1874594_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	3.7e-19
WP_000183037.1|1874768_1875662_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	5.1e-46
WP_000699401.1|1876034_1877120_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.7e-99
WP_001023616.1|1877119_1878019_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000857505.1|1878077_1878953_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.0e-107
WP_001350333.1|1878970_1879381_+	FdtA/QdtA family cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001219875.1|1879367_1879835_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001033088.1|1879827_1880934_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.9	2.7e-44
>prophage 3
NZ_CP051744	Escherichia coli strain SCU-484 chromosome, complete genome	5139277	2717469	2765720	5139277	transposase,integrase,tRNA	Escherichia_phage(23.08%)	41	2744344:2744358	2769836:2769850
WP_001111619.1|2717469_2718669_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.2	9.6e-141
WP_001160110.1|2718721_2719399_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571684.1|2719398_2720109_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702647.1|2720105_2721644_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
WP_000032955.1|2721640_2725384_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000019827.1|2725776_2727168_-	nitrate transporter NarK	NA	NA	NA	NA	NA
WP_000918044.1|2727506_2729303_+	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_000070491.1|2729295_2729946_+	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_000086196.1|2729946_2731341_-	inverse autotransporter invasin YchO	NA	NA	NA	NA	NA
WP_001169659.1|2731525_2731879_+	DsrE/F sulfur relay family protein YchN	NA	NA	NA	NA	NA
WP_001370799.1|2731922_2732618_-	glutathione-specific gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001146435.1|2732775_2733006_-	putative cation transport regulator ChaB	NA	NA	NA	NA	NA
WP_000063608.1|2733275_2734376_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001441942.1|2734785_2734893_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000811065.1|2735041_2735896_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257054.1|2735931_2736741_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200375.1|2736744_2737137_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456476.1|2737133_2737967_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|2737966_2739049_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_001313766.1|2739090_2740347_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130679.1|2740560_2741184_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260347.1|2741183_2742035_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2742185_2743133_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033350.1|2743257_2744937_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
2744344:2744358	attL	GCCCTGCTGGTACTG	NA	NA	NA	NA
WP_000823885.1|2744991_2745270_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2745547_2746132_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505872.1|2746248_2747340_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_019841501.1|2747554_2748754_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.6	4.5e-74
WP_001443045.1|2749711_2750863_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
WP_000015526.1|2750782_2751121_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001297096.1|2751762_2752542_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2752541_2753564_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_019841764.1|2754471_2755869_+	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_000151475.1|2755869_2756535_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_001087212.1|2756544_2758230_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_169057872.1|2758551_2761086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169057873.1|2761230_2762457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000468111.1|2762815_2763688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2763689_2763884_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000870315.1|2764148_2764595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029130942.1|2764808_2765720_-|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	7.8e-10
2769836:2769850	attR	GCCCTGCTGGTACTG	NA	NA	NA	NA
>prophage 4
NZ_CP051744	Escherichia coli strain SCU-484 chromosome, complete genome	5139277	2831532	2877710	5139277	head,capsid,integrase,portal,lysis,tail,terminase,tRNA	Enterobacteria_phage(61.11%)	62	2823713:2823728	2885061:2885076
2823713:2823728	attL	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
WP_000654168.1|2831532_2831811_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_001230375.1|2833936_2834536_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_000515311.1|2834605_2838019_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000090899.1|2838079_2838712_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	95.7	4.2e-95
WP_001337536.1|2838648_2839392_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_001152626.1|2839396_2840095_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847379.1|2840094_2840424_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840215.1|2840420_2842982_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.5	0.0e+00
WP_000459457.1|2842974_2843409_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|2843390_2843813_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001350276.1|2843828_2844569_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	1.5e-131
WP_000683157.1|2844576_2844972_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	1.2e-68
WP_000985128.1|2844968_2845547_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	4.3e-78
WP_000752962.1|2845558_2845912_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	6.4e-61
WP_000158881.1|2845923_2846319_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.6e-55
WP_000118193.1|2846360_2847386_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_000201478.1|2847441_2847774_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_169057874.1|2847783_2849115_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	96.1	2.8e-226
WP_169057875.1|2849095_2850697_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.1	3.0e-307
WP_000198149.1|2850693_2850900_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_169057876.1|2850896_2852822_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453576.1|2852796_2853342_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_000881610.1|2853905_2854088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2854294_2854621_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2855101_2855395_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_071527053.1|2855426_2855534_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	97.1	8.2e-12
WP_001228695.1|2855485_2855668_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001101164.1|2855884_2856418_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.8e-98
WP_001168526.1|2856552_2856792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000737271.1|2857918_2859001_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204794.1|2859189_2859573_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000971073.1|2859658_2859799_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	3.2e-08
WP_001099712.1|2859795_2860158_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774484.1|2860154_2860445_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_000224914.1|2860437_2860608_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053011.1|2860607_2861063_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072142085.1|2861059_2861161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000622059.1|2861252_2861735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371307.1|2861990_2862743_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	36.5	3.9e-31
WP_000145920.1|2863031_2863325_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	90.3	2.3e-40
WP_000788891.1|2863321_2864023_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.3	7.1e-128
WP_032150144.1|2864019_2864949_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	65.0	5.6e-112
WP_001182881.1|2865035_2865575_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000184665.1|2865605_2865833_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|2865943_2866636_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000414677.1|2866717_2867191_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	61.6	1.3e-53
WP_001616716.1|2867187_2868120_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	54.4	3.6e-87
WP_000233575.1|2868604_2868811_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.4e-28
WP_000995436.1|2868886_2869183_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001350280.1|2869188_2869974_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	99.6	3.1e-148
WP_000186789.1|2869970_2870651_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	7.9e-132
WP_000682312.1|2870647_2870806_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	98.1	1.5e-22
WP_000581109.1|2870802_2871555_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	100.0	6.4e-151
WP_000151206.1|2871562_2871778_+	hypothetical protein	NA	M1FPM2	Enterobacteria_phage	97.2	6.5e-32
WP_000763364.1|2871876_2872095_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488402.1|2872142_2872382_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	92.4	2.0e-37
WP_000088653.1|2872521_2872758_+	excisionase	NA	NA	NA	NA	NA
WP_169057877.1|2872747_2873890_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.7	1.1e-205
WP_000444487.1|2874003_2875254_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248679.1|2875425_2876079_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2876088_2876550_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|2876603_2877710_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2885061:2885076	attR	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
>prophage 5
NZ_CP051744	Escherichia coli strain SCU-484 chromosome, complete genome	5139277	2884783	2936461	5139277	head,capsid,integrase,portal,holin,tail,terminase	Escherichia_phage(37.5%)	66	2884796:2884810	2936563:2936577
WP_000531578.1|2884783_2885920_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2884796:2884810	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2885903_2886767_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000937481.1|2886998_2887265_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000240997.1|2887321_2887990_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001545928.1|2888044_2888629_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.0e-104
WP_094315386.1|2888628_2891655_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.4	4.5e-54
WP_001228261.1|2891806_2892406_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_032198501.1|2892473_2896166_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_072037205.1|2896509_2897142_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.4e-103
WP_000194711.1|2897087_2897831_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
WP_032346844.1|2897841_2898540_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	4.2e-128
WP_000847298.1|2898539_2898869_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_169057878.1|2898865_2901427_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.2	0.0e+00
WP_000533401.1|2901407_2901821_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
WP_001309426.1|2901847_2902279_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
WP_000235047.1|2902297_2903047_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
WP_000683079.1|2903054_2903450_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974996.1|2903446_2903980_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_001204533.1|2903995_2904349_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000201530.1|2904341_2904716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001573716.1|2904767_2905796_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
WP_000256814.1|2905853_2906201_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_001253888.1|2906237_2907743_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_001322425.1|2907732_2909325_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_000258993.1|2909321_2909528_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_060624626.1|2909511_2911440_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.0e-261
WP_000235436.1|2911411_2911921_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012816791.1|2912431_2912617_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_032140280.1|2912838_2912925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092910.1|2913479_2914013_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_000551290.1|2914141_2914456_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_021534707.1|2914465_2915272_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	95.5	8.1e-144
WP_000284506.1|2915276_2915492_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001538590.1|2915568_2915814_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_023143432.1|2915851_2916034_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_001538589.1|2916170_2918132_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	4.3e-239
WP_001336019.1|2918392_2918728_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.4e-44
WP_000562553.1|2919008_2919140_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000762915.1|2920035_2920857_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.6e-78
WP_000904112.1|2920853_2921228_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_001554968.1|2921240_2922287_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.3	1.2e-110
WP_001405664.1|2922288_2922567_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	5.1e-05
WP_000980988.1|2922633_2922885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2923101_2923257_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001289993.1|2923815_2924331_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
WP_000753058.1|2924327_2924504_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	4.3e-26
WP_021572854.1|2924496_2924679_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.3e-25
WP_000403778.1|2924772_2925129_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_001209471.1|2925106_2925568_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	91.7	3.8e-37
WP_001266130.1|2925564_2925861_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_021524280.1|2925857_2926250_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	3.8e-38
WP_001702777.1|2926265_2927036_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	5.1e-87
WP_001309414.1|2927069_2927612_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000020541.1|2927523_2928564_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_000705383.1|2928535_2929087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476988.1|2929070_2929298_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|2929375_2929783_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379587.1|2929972_2930125_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000394541.1|2930136_2930475_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_001295058.1|2930463_2930658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935597.1|2931237_2932092_+	Rha family transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_001405662.1|2932102_2932291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199480.1|2932287_2932476_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032284123.1|2932571_2935043_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000003742.1|2935104_2935374_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|2935342_2936461_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2936563:2936577	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
NZ_CP051744	Escherichia coli strain SCU-484 chromosome, complete genome	5139277	3218708	3313427	5139277	head,capsid,integrase,portal,plate,lysis,tail,terminase,tRNA,protease	Salmonella_phage(56.9%)	92	3281243:3281269	3313502:3313528
WP_000886683.1|3218708_3220001_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3220091_3221435_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3221445_3222057_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077099.1|3222215_3226283_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3226417_3226912_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3227455_3228421_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043561.1|3228543_3230310_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202198.1|3230310_3232032_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241673.1|3232073_3232778_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3233062_3233281_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000350184.1|3234739_3235294_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001029749.1|3235304_3236306_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	39.9	2.1e-48
WP_000120901.1|3236316_3237240_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_000415799.1|3237236_3238544_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001101561.1|3238873_3242107_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.1	1.3e-83
WP_000097883.1|3242103_3243087_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	3.4e-43
WP_000934041.1|3244100_3246377_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3246407_3246728_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3247050_3247275_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188133.1|3247347_3249294_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746478.1|3249290_3250406_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_162829749.1|3250562_3251513_+	DUF535 family protein	NA	NA	NA	NA	NA
WP_000599806.1|3251509_3253168_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3253593_3254289_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491135.1|3254611_3255511_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458845.1|3255654_3257307_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178690.1|3257318_3258287_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_169057885.1|3258419_3260138_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000566398.1|3260174_3261176_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001305933.1|3262714_3263728_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255185.1|3263724_3264555_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3264551_3264875_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001295906.1|3265000_3265516_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3265733_3266462_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756578.1|3266479_3267211_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001692.1|3267217_3267934_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3267933_3268602_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3268826_3269558_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149693.1|3269586_3270714_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	7.9e-28
WP_000389260.1|3270754_3271243_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|3271302_3272148_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105432.1|3272144_3273098_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_128880846.1|3273107_3274241_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126095.1|3274335_3275448_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3275797_3276274_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3276361_3277264_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189176.1|3277324_3278047_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201570.1|3278030_3278318_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|3278477_3278735_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681104.1|3278764_3279142_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|3279411_3281097_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3281243:3281269	attL	ATGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
WP_000972391.1|3281333_3281552_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_053885094.1|3281642_3282743_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980413.1|3282739_3283225_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_169057886.1|3283221_3286299_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.6	0.0e+00
WP_000763311.1|3286291_3286411_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3286425_3286728_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3286782_3287298_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046126.1|3287307_3288480_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_000356478.1|3288614_3289217_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.9	3.6e-88
WP_000104760.1|3289216_3290842_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	66.2	6.4e-188
WP_001086836.1|3290838_3291444_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000268284.1|3291436_3292345_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_001522712.1|3292331_3292691_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	88.2	5.0e-53
WP_033555171.1|3292687_3293266_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_169057887.1|3293515_3294055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169057888.1|3294093_3294540_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	1.1e-60
WP_101356903.1|3294532_3294964_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.2e-71
WP_000196202.1|3295059_3295488_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	92.2	8.6e-60
WP_101356902.1|3295484_3296000_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.2	2.4e-88
WP_000171568.1|3295980_3296196_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3296199_3296403_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673520.1|3296402_3296867_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_169057889.1|3296962_3297613_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.4	2.8e-110
WP_000742511.1|3297616_3298675_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216237.1|3298691_3299525_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098431.1|3299667_3301434_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000520349.1|3301433_3302468_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.4	6.5e-170
WP_000008839.1|3302515_3303925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3304246_3304480_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3304490_3304679_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_169057890.1|3304832_3307247_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_169057891.1|3307243_3308101_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	8.1e-158
WP_156650054.1|3308097_3308325_-	TraR/DksA C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244163.1|3308324_3308558_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_000963473.1|3308625_3308967_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956182.1|3308930_3309131_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_016529334.1|3309138_3309648_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	97.6	2.9e-86
WP_155852070.1|3309680_3309902_-	regulator	NA	NA	NA	NA	NA
WP_000107904.1|3309997_3310594_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.4	3.6e-40
WP_025649891.1|3310614_3312291_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	7.5e-83
WP_000290937.1|3312374_3313427_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3313502:3313528	attR	ATGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
>prophage 7
NZ_CP051744	Escherichia coli strain SCU-484 chromosome, complete genome	5139277	3860443	3876813	5139277	integrase	Sodalis_phage(15.38%)	20	3848463:3848476	3880513:3880526
3848463:3848476	attL	GTAAACTGGCAGGT	NA	NA	NA	NA
WP_000246955.1|3860443_3861763_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	44.2	2.4e-36
WP_000909177.1|3861762_3862440_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000420671.1|3862433_3862895_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.5	2.9e-61
WP_001018524.1|3862911_3863073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244111.1|3863667_3866424_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	5.2e-299
WP_001208877.1|3866410_3866782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628966.1|3866774_3867116_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001058743.1|3867126_3867729_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.0e-25
WP_000181940.1|3867721_3867943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024679.1|3867939_3868203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065661.1|3868199_3868394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958749.1|3868386_3869454_-	ash family protein	NA	NA	NA	NA	NA
WP_000476150.1|3869447_3869630_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001019374.1|3869622_3870456_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	2.6e-20
WP_000412531.1|3870468_3870900_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
WP_000035054.1|3870899_3871103_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772643.1|3871530_3872745_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000893298.1|3873100_3874354_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_001285288.1|3874365_3875469_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749898.1|3875757_3876813_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	1.7e-117
3880513:3880526	attR	GTAAACTGGCAGGT	NA	NA	NA	NA
>prophage 8
NZ_CP051744	Escherichia coli strain SCU-484 chromosome, complete genome	5139277	4690984	4734217	5139277	integrase,portal,lysis,tail,terminase,tRNA,protease	Enterobacteria_phage(58.0%)	52	4682091:4682106	4739410:4739425
4682091:4682106	attL	CGCAACGTCAGCAAGT	NA	NA	NA	NA
WP_000543841.1|4690984_4692022_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|4692110_4693208_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217553.1|4693269_4693518_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000654168.1|4693934_4694213_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_169057827.1|4700318_4700486_-	homoserine acetyltransferase	NA	A0A291AWT4	Escherichia_phage	100.0	1.7e-16
WP_001152385.1|4701834_4702533_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447253.1|4702542_4702872_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372033.1|4702871_4705928_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	97.6	0.0e+00
WP_001161009.1|4705899_4706229_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|4706237_4706624_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211128.1|4706684_4707428_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001079419.1|4707438_4707840_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000677106.1|4707836_4708415_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|4708426_4708702_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|4708694_4709018_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_021538845.1|4709104_4711132_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.7	0.0e+00
WP_011478361.1|4711076_4712657_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|4712584_4712797_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934130.1|4712793_4714896_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
WP_000349509.1|4714895_4715387_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_029404485.1|4716162_4716630_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	91.0	3.4e-70
WP_001274714.1|4716626_4717160_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_029404484.1|4717215_4717530_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	97.1	5.4e-51
WP_000839596.1|4717534_4717750_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4717817_4718870_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|4719020_4719224_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001038608.1|4719495_4719942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204819.1|4720026_4720392_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_021538841.1|4720409_4721399_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001061380.1|4721406_4722216_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
WP_001402832.1|4722235_4722625_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	4.6e-68
WP_000210170.1|4722621_4722948_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_021551567.1|4722944_4723598_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	4.3e-127
WP_001305611.1|4723597_4724092_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_021527492.1|4724088_4724907_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
WP_000620698.1|4724903_4725128_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_023145337.1|4725124_4726276_-	Rha family transcriptional regulator	NA	K7PLX4	Enterobacteria_phage	99.5	3.1e-213
WP_000515849.1|4726272_4726824_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	100.0	2.6e-101
WP_001191669.1|4726816_4727077_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001345148.1|4727174_4727867_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_000135680.1|4728589_4728952_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081270.1|4729017_4729842_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000008177.1|4729970_4730507_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
WP_001242718.1|4730497_4730860_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_000111289.1|4730856_4731060_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476209.1|4731052_4731301_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	94.8	5.5e-35
WP_021529121.1|4731287_4732073_+	ead/Ea22-like family protein	NA	A0A2R2Z312	Escherichia_phage	76.1	8.0e-104
WP_000212745.1|4732074_4732362_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	98.9	3.5e-49
WP_023145274.1|4732365_4733106_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	77.6	1.3e-76
WP_023145273.1|4733105_4733678_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	5.5e-110
WP_001093916.1|4733714_4733996_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_021538831.1|4734043_4734217_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	96.5	1.7e-22
4739410:4739425	attR	ACTTGCTGACGTTGCG	NA	NA	NA	NA
