The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051694	Escherichia coli strain SCU-313 chromosome, complete genome	5087909	1834685	1844128	5087909		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569372.1|1834685_1835612_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	1.1e-22
WP_000783145.1|1835616_1836348_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1836328_1836436_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1836495_1837227_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001309587.1|1837448_1839134_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|1839130_1839850_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1839896_1840367_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1840408_1840870_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001309586.1|1840994_1842995_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001292789.1|1842991_1844128_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.3e-163
>prophage 2
NZ_CP051694	Escherichia coli strain SCU-313 chromosome, complete genome	5087909	1972019	2068628	5087909	transposase,integrase	Escherichia_phage(17.65%)	65	1990044:1990059	2065619:2065634
WP_000086752.1|1972019_1972664_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|1972682_1972904_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|1972966_1973443_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|1973458_1973932_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|1974025_1974271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1974270_1975089_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|1975309_1975720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|1976168_1976915_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|1976929_1978471_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001542273.1|1978585_1978999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102633.1|1979134_1980205_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203551.1|1980201_1981107_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_001531797.1|1981103_1983488_-	dynamin family protein	NA	NA	NA	NA	NA
WP_001069649.1|1983705_1984140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000856948.1|1984568_1986734_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000778018.1|1986744_1987734_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000217077.1|1987752_1988811_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000016207.1|1988807_1989575_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_001163787.1|1989628_1989886_+	hypothetical protein	NA	NA	NA	NA	NA
1990044:1990059	attL	GTTCAGCCGCTCCGGC	NA	NA	NA	NA
WP_001296206.1|1990416_1991562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089438313.1|1992761_1992941_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000255956.1|1993086_1994109_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_000970353.1|1994108_1994801_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_001327829.1|1995137_1995353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|1995826_1996429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304240.1|1996522_1996801_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001336659.1|2000148_2000325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169062203.1|2001703_2002105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221618.1|2002092_2002503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656349.1|2004817_2005852_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_000739817.1|2005854_2006820_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001066372.1|2006873_2007632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000667429.1|2007645_2008860_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001322394.1|2009784_2010801_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_001542270.1|2010954_2012178_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	2.0e-61
WP_000502870.1|2012162_2012807_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_000966628.1|2013177_2015325_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000973199.1|2016996_2017542_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001296197.1|2017538_2018282_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001166163.1|2018293_2019373_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986344.1|2019434_2020370_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011491.1|2020827_2021745_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011024.1|2021846_2022797_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122984588.1|2022914_2024558_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|2025187_2025904_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060231.1|2026246_2027701_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378563.1|2027802_2029119_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480517.1|2029433_2030486_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001360219.1|2030613_2031090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000646566.1|2031309_2032572_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_000039780.1|2032704_2033454_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000784549.1|2034103_2036125_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_001088830.1|2036255_2037833_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_160342141.1|2037836_2038574_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_000982870.1|2038636_2039737_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_169062204.1|2049308_2055413_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000140402.1|2055603_2056563_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_001330751.1|2056819_2058532_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.8e-31
WP_000654452.1|2058518_2060321_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001286284.1|2060313_2061594_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703040.1|2061621_2062926_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_000060157.1|2063119_2064382_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
WP_001311896.1|2064719_2065517_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001007778.1|2066369_2067020_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
2065619:2065634	attR	GCCGGAGCGGCTGAAC	NA	NA	NA	NA
WP_106422270.1|2067280_2068628_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 3
NZ_CP051694	Escherichia coli strain SCU-313 chromosome, complete genome	5087909	2436385	2500280	5087909	integrase,tail,portal,lysis,protease,terminase	Enterobacteria_phage(40.91%)	71	2443961:2443976	2474665:2474680
WP_001260856.1|2436385_2437207_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233092.1|2437306_2437390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743947.1|2437482_2437818_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091836.1|2438214_2439468_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019558.1|2439574_2440468_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225257.1|2440602_2441823_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2441947_2442643_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000546460.1|2442595_2443888_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2443961:2443976	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148697.1|2444045_2444660_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	7.3e-28
WP_000526517.1|2444702_2445557_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2445558_2446176_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_012602795.1|2446186_2448610_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	1.4e-207
WP_000041650.1|2448670_2451097_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.3e-213
WP_001295396.1|2451295_2451601_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001309527.1|2451708_2452419_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2452421_2452982_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2453016_2453358_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001306081.1|2453492_2453819_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_138375394.1|2454024_2455239_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.8	1.2e-45
WP_000836037.1|2455250_2456270_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001513307.1|2456327_2456438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876984.1|2456457_2457738_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.9e-155
WP_000005552.1|2457772_2458024_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_169062207.1|2458096_2460568_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001083276.1|2460661_2460853_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2460849_2461038_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344958.1|2461524_2462100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2462101_2462257_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001003381.1|2462449_2462857_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2462934_2463162_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2463145_2463667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|2463647_2464613_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001151189.1|2464653_2465055_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_000340970.1|2465273_2467061_-	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.1	9.3e-15
WP_000887485.1|2467678_2467891_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.7e-24
WP_000980991.1|2468107_2468359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309521.1|2468425_2468704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513304.1|2468705_2469755_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	56.7	6.9e-111
WP_001047132.1|2469768_2470521_+	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	2.5e-131
WP_120795389.1|2470798_2470888_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2470942_2471155_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2471455_2471671_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2473137_2473353_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_001309518.1|2473336_2473669_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.3	1.1e-25
WP_001092971.1|2473665_2474199_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2474195_2474693_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2474665:2474680	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2475056_2475269_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2475279_2475468_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2475470_2475536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2475615_2475771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2475942_2476116_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035574.1|2476267_2476678_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
WP_001031431.1|2476978_2477185_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000373425.1|2477747_2478242_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934101.1|2478241_2480344_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.9	0.0e+00
WP_001072975.1|2480340_2480553_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_011478361.1|2480480_2482061_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001136587.1|2482005_2484033_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|2484119_2484443_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|2484435_2484711_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677108.1|2484722_2485301_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|2485297_2485699_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|2485710_2486454_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001297778.1|2486514_2486901_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_001161009.1|2486909_2487239_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372011.1|2487210_2490276_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_000447253.1|2490275_2490605_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152385.1|2490614_2491313_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_169062208.1|2492739_2493108_+	hypothetical protein	NA	K7PKJ2	Enterobacteria_phage	87.4	1.8e-42
WP_001230343.1|2496129_2496729_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.0	6.7e-111
WP_000885596.1|2499704_2500280_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.9e-103
>prophage 4
NZ_CP051694	Escherichia coli strain SCU-313 chromosome, complete genome	5087909	2585841	2625915	5087909	integrase,tail,transposase,capsid,plate	Burkholderia_virus(43.9%)	58	2580351:2580366	2624535:2624550
2580351:2580366	attL	CAATTGATTATTGCCG	NA	NA	NA	NA
WP_000904922.1|2585841_2586414_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_064767240.1|2586473_2586914_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_001491734.1|2586924_2587386_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.6	1.4e-34
WP_000072165.1|2587392_2588007_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_169062209.1|2588006_2589638_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.5e-40
WP_000138756.1|2589640_2590219_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|2590211_2591315_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|2591305_2591653_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148265.1|2591707_2592304_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_000808007.1|2592300_2593455_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|2593442_2593658_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|2593654_2594539_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|2594538_2597490_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|2597565_2597724_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|2597647_2597983_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|2598080_2598362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|2598364_2598889_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000729834.1|2598885_2600313_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|2600302_2600557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|2600553_2601018_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|2601017_2601464_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|2601465_2601804_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|2601813_2602767_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|2602781_2603897_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|2604111_2604570_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|2604572_2605394_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|2605374_2606871_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_001295924.1|2606870_2608403_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000124060.1|2608462_2609008_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227701.1|2609007_2609319_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175097.1|2609318_2609645_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000264665.1|2609641_2610292_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|2610275_2611016_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_001381525.1|2611018_2611369_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	2.0e-22
WP_000194951.1|2611499_2612228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|2612203_2612608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|2612606_2612822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|2613012_2613777_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|2613893_2614250_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|2614343_2614532_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|2614584_2614893_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|2614903_2615824_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|2615823_2616141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|2616156_2617926_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|2617936_2619103_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|2619105_2619375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|2619402_2619933_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|2620221_2620494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|2620503_2620800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|2620814_2621030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|2621026_2621710_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|2621706_2621937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|2621926_2622133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|2622134_2622584_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|2622555_2622945_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_000979593.1|2623116_2624013_+	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_000193511.1|2624009_2624996_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.1e-17
2624535:2624550	attR	CAATTGATTATTGCCG	NA	NA	NA	NA
WP_001285562.1|2624988_2625915_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	4.5e-13
>prophage 5
NZ_CP051694	Escherichia coli strain SCU-313 chromosome, complete genome	5087909	2798792	2863193	5087909	integrase,tail,portal,lysis,terminase,holin,capsid,protease,head	Enterobacteria_phage(40.0%)	73	2814607:2814641	2863330:2863364
WP_000422053.1|2798792_2799842_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	3.5e-22
WP_000559257.1|2800061_2800820_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	9.7e-06
WP_001278887.1|2800816_2801407_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|2801446_2802322_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001309470.1|2802532_2804428_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2804455_2805076_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285692.1|2805072_2805954_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2806091_2806136_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194627.1|2806227_2807790_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763518.1|2807789_2809385_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.3e-52
WP_001309469.1|2809388_2810747_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209502.1|2810758_2811952_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443081.1|2811951_2812758_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2813138_2813318_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2813403_2813904_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079489.1|2813949_2814456_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2814607:2814641	attL	GTGGTATCGATATCCATGTACCAGACTGACATGTT	NA	NA	NA	NA
WP_072256401.1|2814826_2815102_+	ash family protein	NA	S5MQL6	Escherichia_phage	54.4	4.3e-12
WP_001348267.1|2815098_2815656_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000251936.1|2815782_2815953_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000937495.1|2816067_2816337_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_122134665.1|2816393_2817062_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885577.1|2817116_2817701_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_169062210.1|2817700_2820727_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	55.3	1.9e-60
WP_001230343.1|2820791_2821391_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.0	6.7e-111
WP_169062211.1|2824406_2824850_-	hypothetical protein	NA	K7PKJ2	Enterobacteria_phage	100.0	9.2e-65
WP_001332187.1|2824916_2825255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090880.1|2825327_2825930_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	4.0e-87
WP_014639158.1|2825866_2826610_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	2.0e-144
WP_000533402.1|2830182_2830596_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479111.1|2830622_2831054_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000235110.1|2831067_2831820_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|2831827_2832223_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975009.1|2832219_2832795_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	2.1e-48
WP_001204198.1|2832809_2833163_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000201508.1|2833155_2833524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522596.1|2833575_2834604_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000256823.1|2834661_2835009_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_016239005.1|2835045_2836551_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.1	7.9e-100
WP_016239004.1|2836540_2838133_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	9.3e-184
WP_016239003.1|2838129_2838336_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.9e-10
WP_001304453.1|2838319_2840248_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000867569.1|2840219_2840768_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001329960.1|2841163_2841349_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|2841481_2841622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082539.1|2841972_2842440_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.3	9.1e-71
WP_016239002.1|2842738_2843272_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.6e-100
WP_000369850.1|2843377_2843650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|2843615_2843960_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|2843964_2844180_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016239001.1|2844329_2846183_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000935516.1|2847457_2848507_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.0	2.3e-199
WP_001532433.1|2848657_2848855_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	1.8e-28
WP_001532434.1|2849079_2849901_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	9.3e-79
WP_000140012.1|2849897_2850278_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.5e-34
WP_001265085.1|2850278_2851334_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|2851335_2851608_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2851775_2851988_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2852168_2852834_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|2853008_2853434_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|2853449_2854220_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|2854241_2854988_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095673.1|2854994_2855957_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_000693888.1|2855979_2856405_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|2856388_2856670_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|2856771_2857191_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_001725971.1|2857456_2857609_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.1e-06
WP_001339605.1|2857620_2858022_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_016239000.1|2857981_2858260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2858831_2859020_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199473.1|2859016_2859205_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_142975762.1|2859300_2861772_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000113189.1|2861836_2862085_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2862062_2863193_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2863330:2863364	attR	GTGGTATCGATATCCATGTACCAGACTGACATGTT	NA	NA	NA	NA
>prophage 6
NZ_CP051694	Escherichia coli strain SCU-313 chromosome, complete genome	5087909	3564486	3633652	5087909	integrase,tail,portal,lysis,transposase,terminase,tRNA,capsid,protease,head	Enterobacteria_phage(48.28%)	75	3575359:3575405	3621901:3621947
WP_000420757.1|3564486_3565623_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001057457.1|3566443_3566890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169380.1|3566917_3567346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829608.1|3567565_3567736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322695.1|3570507_3573480_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224568.1|3573480_3574371_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|3574553_3575315_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3575359:3575405	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201810.1|3575828_3576782_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3577031_3577781_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_000355607.1|3578456_3578750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235985.1|3578760_3579465_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.1	6.6e-57
WP_000654147.1|3579474_3579756_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.2e-17
WP_000290535.1|3579752_3582122_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	43.7	9.3e-87
WP_000515681.1|3582182_3585680_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.5	0.0e+00
WP_000090891.1|3585739_3586372_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194783.1|3586308_3587052_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152511.1|3587057_3587756_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	1.2e-130
WP_000847366.1|3587755_3588085_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.6e-56
WP_169062218.1|3588081_3590637_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.8	0.0e+00
WP_000459479.1|3590629_3591064_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	2.2e-63
WP_000479145.1|3591045_3591468_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	9.1e-70
WP_001309909.1|3591483_3592224_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	2.5e-131
WP_000683122.1|3592231_3592627_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	3.2e-69
WP_000975078.1|3592623_3593202_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752994.1|3593213_3593567_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000160184.1|3593578_3593974_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	1.8e-56
WP_000118196.1|3594015_3595041_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.3	1.2e-184
WP_000201478.1|3595096_3595429_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_001542142.1|3595438_3596770_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	96.8	6.7e-228
WP_016238988.1|3596750_3598352_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
WP_000198149.1|3598348_3598555_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_016238987.1|3598551_3600477_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453611.1|3600451_3600997_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001309326.1|3601385_3601619_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079510.1|3601676_3602087_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	9.8e-53
WP_001139678.1|3602438_3602591_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000092273.1|3602578_3603046_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001135256.1|3603042_3603540_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
WP_000839596.1|3603539_3603755_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|3604328_3605411_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204780.1|3605600_3605984_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971055.1|3606069_3606210_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099522.1|3606206_3606569_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
WP_000774491.1|3606565_3606856_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.7e-46
WP_000224914.1|3606848_3607019_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053016.1|3607018_3607474_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.2	2.2e-61
WP_001309322.1|3607470_3607572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309958.1|3607668_3607920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211451.1|3608413_3609022_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	42.1	6.3e-32
WP_000348712.1|3610115_3611339_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	53.7	3.1e-62
WP_000145913.1|3611587_3611890_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	96.8	2.7e-44
WP_000788915.1|3611886_3612588_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	97.9	9.3e-128
WP_024185956.1|3612584_3613514_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.0e-111
WP_001182772.1|3613600_3614140_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_001067458.1|3614209_3614440_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|3614478_3615234_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000414677.1|3615315_3615789_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	61.6	1.3e-53
WP_001288169.1|3615785_3616718_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	54.4	2.8e-87
WP_001309317.1|3617116_3617407_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.0e-27
WP_000995439.1|3617482_3617779_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3617784_3618570_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186792.1|3618566_3619247_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_000149534.1|3619243_3619426_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	9.1e-27
WP_000548530.1|3619398_3619590_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_077252933.1|3619600_3619888_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.6e-47
WP_000763385.1|3619980_3620199_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3620246_3620525_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001299447.1|3620723_3621887_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000691065.1|3624159_3625167_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
3621901:3621947	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_000988368.1|3628596_3629289_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3629508_3630051_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729161.1|3630521_3631388_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3631389_3631602_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143546.1|3631709_3632231_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912355.1|3632266_3633652_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	5.1e-45
>prophage 7
NZ_CP051694	Escherichia coli strain SCU-313 chromosome, complete genome	5087909	4398916	4464833	5087909	transposase,holin	Stx2-converting_phage(25.0%)	57	NA	NA
WP_001322394.1|4398916_4399933_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_001323209.1|4400083_4401070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001054376.1|4402061_4402319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309181.1|4402330_4402876_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000354251.1|4402931_4403678_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000010829.1|4404463_4405585_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_000722973.1|4405581_4405860_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000460843.1|4405871_4407185_+	PTS system EIIC permease component	NA	NA	NA	NA	NA
WP_000118626.1|4407197_4408004_+	BtpA family protein SgcQ	NA	NA	NA	NA	NA
WP_000606406.1|4408134_4408566_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000600622.1|4408577_4409210_+	ribulose-phosphate 3 epimerase family protein	NA	NA	NA	NA	NA
WP_000082780.1|4409226_4410009_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_169062224.1|4410311_4411082_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000714563.1|4411881_4412787_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000116326.1|4412797_4414765_+	xylonate dehydratase YjhG	NA	NA	NA	NA	NA
WP_001128363.1|4414871_4416221_+	GntP family permease	NA	NA	NA	NA	NA
WP_000373366.1|4416567_4417554_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000471147.1|4417594_4418599_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_000439687.1|4418702_4419344_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001022014.1|4419374_4420490_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000132327.1|4420499_4421759_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_001295723.1|4422686_4423055_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|4423217_4423439_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|4423501_4423978_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855064.1|4423993_4424467_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_016234192.1|4424560_4424806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234653.1|4424805_4425624_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	6.1e-46
WP_001323397.1|4425778_4425937_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000820498.1|4426007_4429127_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|4429498_4430371_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001297234.1|4431601_4433086_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000813451.1|4433407_4434010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322501.1|4434104_4434383_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000221515.1|4435834_4436404_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|4436663_4437065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|4437052_4437487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|4437841_4438222_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|4438218_4438566_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998017.1|4438615_4440001_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.5	6.9e-260
WP_000823243.1|4440239_4441598_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555337.1|4442330_4442588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4444338_4444860_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4444856_4445810_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000879155.1|4448264_4449167_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|4449163_4450162_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684852.1|4450158_4451115_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
WP_000175457.1|4451115_4451883_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4452439_4452697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|4453955_4455107_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001293436.1|4456163_4458161_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625671.1|4458223_4458637_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085948656.1|4458571_4459739_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000254999.1|4460052_4460310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594405.1|4460362_4460488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611568.1|4460530_4461649_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000179691.1|4461660_4462878_-	MFS transporter	NA	NA	NA	NA	NA
WP_000483767.1|4463486_4464833_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP051695	Escherichia coli strain SCU-313 plasmid pSCU-313-1, complete sequence	105394	1262	62223	105394	integrase,transposase,protease	Escherichia_phage(40.0%)	54	NA	NA
WP_001066942.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_042065278.1|2123_2306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|3448_4618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|4813_5107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|5212_5488_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|5487_5772_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|6376_7129_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001022265.1|7174_8140_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000710783.1|8172_8553_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001077068.1|8577_9468_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000796505.1|9700_9895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338039.1|10439_11318_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000922702.1|12206_13031_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000950177.1|13036_14110_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|14102_15413_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_169062237.1|17332_18037_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.4e-138
WP_000874189.1|18746_19232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267177.1|19256_19742_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|19728_20424_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729220.1|20428_21559_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|21548_22832_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|22834_24214_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|24317_24845_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|24885_26772_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|27118_27934_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|28116_28623_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|28612_28771_-	DsbA family protein	NA	NA	NA	NA	NA
WP_154074773.1|30230_30914_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.1e-130
WP_001389366.1|31876_32350_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|32480_33269_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|33474_33822_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|33815_34655_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|34782_34986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|35141_36347_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|36357_36663_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|36889_37654_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|38146_38731_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169062238.1|38730_39897_-	MFS transporter	NA	NA	NA	NA	NA
WP_024192851.1|41719_41932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|42239_43055_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|43115_43919_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|43918_44755_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000804064.1|45815_47015_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_065897011.1|47046_47958_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001067858.1|48474_49179_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_014342212.1|50505_50655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|50621_51758_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|51808_52036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|52059_52251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110074664.1|52732_53266_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
WP_001262765.1|59290_60601_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001398199.1|60885_61287_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|61219_61477_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|61569_62223_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
