The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	0	44057	5053537	head,tRNA,terminase,tail,capsid	Enterobacteria_phage(38.46%)	33	NA	NA
WP_016234515.1|0_1662_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_000173094.1|1725_3663_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	97.8	0.0e+00
WP_001063027.1|3707_3929_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125990.1|6455_6782_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|6791_7142_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573362.1|7138_7585_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|7581_7926_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275451.1|7991_8705_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	95.8	4.1e-123
WP_015674697.1|8718_9093_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	91.9	2.9e-59
WP_021517447.1|9188_9398_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	94.2	4.8e-32
WP_169063481.1|9445_12712_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	80.2	0.0e+00
WP_000807940.1|12704_13046_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001348269.1|13045_13744_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	1.1e-128
WP_001405642.1|13754_14498_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.6e-147
WP_128972936.1|14443_15076_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.6	4.2e-103
WP_169063482.1|15419_19112_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.6	0.0e+00
WP_001228259.1|19179_19779_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	5.2e-103
WP_169063483.1|19930_21988_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	64.8	2.3e-150
WP_001204583.1|21984_22263_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	46.2	3.0e-21
WP_000355615.1|22272_22569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261928.1|22686_22935_-	DinI-like family protein	NA	H6WZN4	Escherichia_phage	84.0	1.8e-30
WP_021524325.1|23460_25146_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_000598641.1|25142_25862_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_169063484.1|25908_26379_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	8.8e-82
WP_001296231.1|26419_26881_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_021538060.1|27005_29006_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_021524322.1|29002_30139_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.0	2.6e-164
WP_021524321.1|30131_32411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313986.1|32421_33510_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_021524320.1|34086_34392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169063485.1|34452_38085_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_021513713.1|38094_41883_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001538964.1|42023_44057_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 2
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	54706	58263	5053537		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001297940.1|54706_55525_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434049.1|55576_56323_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011945.1|56296_57262_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846206.1|57258_58263_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	1.7e-13
>prophage 3
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	67404	70898	5053537	tRNA	Catovirus(50.0%)	3	NA	NA
WP_000807341.1|67404_68304_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_001441996.1|68719_69037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476019.1|69536_70898_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
>prophage 4
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	76737	78860	5053537		Bacillus_phage(100.0%)	2	NA	NA
WP_000137877.1|76737_77460_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675178.1|77456_78860_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 5
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	91967	93320	5053537		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469705.1|91967_93320_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 6
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	98046	108614	5053537		Catovirus(20.0%)	9	NA	NA
WP_001295424.1|98046_98688_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_021524310.1|98779_99361_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_021524309.1|99382_101236_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_021524308.1|101687_103271_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	9.4e-35
WP_162829205.1|103471_103621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978094.1|103928_105068_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482904.1|105073_105517_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_021524307.1|105519_107682_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|107774_108614_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 7
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	112858	119652	5053537		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|112858_113980_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043619.1|113982_114948_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.4	2.2e-87
WP_001346880.1|114950_115430_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699726.1|115426_116650_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_021538055.1|116652_118089_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	2.2e-46
WP_001405650.1|118281_119652_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	9.9e-33
>prophage 8
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	125653	141900	5053537		Enterobacteria_phage(20.0%)	15	NA	NA
WP_021524303.1|125653_127048_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	29.6	1.7e-19
WP_021524302.1|127222_128116_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.2	3.9e-46
WP_021524300.1|128487_129573_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.5e-100
WP_001023610.1|129572_130472_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000783975.1|130529_131411_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001100981.1|131410_131968_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_001393538.1|131964_133212_+	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000272486.1|133219_134323_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_000639866.1|134322_135489_+	O16 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_001407542.1|135491_136484_+	beta-1,6-galactofuranosyltransferase	NA	NA	NA	NA	NA
WP_000601187.1|136464_137055_+	LPS biosynthesis protein	NA	A0A1V0SJ47	Klosneuvirus	32.6	2.6e-06
WP_100272968.1|137039_138158_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_021538634.1|138159_138951_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000043484.1|139078_140485_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000704857.1|140733_141900_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.0e-110
>prophage 9
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	149255	150155	5053537		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|149255_150155_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 10
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	156352	157519	5053537		Stx2-converting_phage(100.0%)	1	NA	NA
WP_100272967.1|156352_157519_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	1.7e-227
>prophage 11
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	175006	175816	5053537		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000047.1|175006_175816_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.0	7.7e-09
>prophage 12
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	200726	301163	5053537	head,terminase,holin,integrase,tail,capsid,lysis	Escherichia_phage(31.88%)	103	236398:236413	302545:302560
WP_021524285.1|200726_210218_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_021524284.1|210305_216413_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000140400.1|216603_217563_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_001327262.1|217819_219532_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.8e-31
WP_001304269.1|219518_221321_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001286281.1|221313_222594_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703042.1|222621_223926_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_000060158.1|224119_225382_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.3	1.3e-71
WP_021524282.1|225719_226517_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_059338095.1|226752_227778_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_000096344.1|227777_227981_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_169063490.1|228039_230514_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_169063491.1|230606_230798_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_169063492.1|230794_230983_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|230993_231848_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000389971.1|232402_232588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169063493.1|232667_233069_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	6.5e-09
WP_000379609.1|233080_233233_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.1e-06
WP_001003379.1|233422_233830_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|233907_234135_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|234118_234670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|234641_235682_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001309414.1|235593_236136_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450708.1|236169_236940_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	1.5e-86
236398:236413	attL	GAGGTCGAACAAAAAG	NA	NA	NA	NA
WP_001141099.1|236955_237348_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|237344_237641_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_032284122.1|237637_238099_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	5.9e-38
WP_000403780.1|238076_238376_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.3e-50
WP_001224665.1|238528_238711_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000753053.1|238703_238880_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001289989.1|238876_239236_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000510387.1|239236_239452_+	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001142588.1|239453_239672_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000224216.1|239673_239937_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_000207997.1|239947_240115_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000350274.1|240222_240456_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000967408.1|240690_240903_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001004956.1|241068_241719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|241699_242803_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687431.1|242960_243134_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001403449.1|243193_243466_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|243467_244514_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_000904114.1|244526_244901_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_021524063.1|244897_245719_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	5.5e-79
WP_001536853.1|245945_246143_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	8.0e-29
WP_000935524.1|246293_247352_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.9	5.2e-207
WP_001304604.1|247815_248247_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.1	8.1e-66
WP_000216690.1|248243_248408_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_000874509.1|249388_251350_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	3.3e-239
WP_001304601.1|251486_251669_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_001304600.1|251706_251952_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284510.1|252028_252244_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731249.1|252248_252599_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	93.0	4.0e-55
WP_000992075.1|252662_253196_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
WP_172885491.1|253494_253989_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	88.9	9.3e-74
WP_001304598.1|254408_254609_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829186.1|254650_255016_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	1.7e-61
WP_169063495.1|255306_255870_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_169063496.1|255866_257528_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.4	0.0e+00
WP_000173054.1|257592_259530_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	97.8	0.0e+00
WP_001063027.1|259574_259796_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125984.1|262322_262649_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_169063497.1|262662_263013_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	98.3	3.0e-58
WP_000573362.1|263009_263456_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|263452_263797_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275433.1|263862_264576_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	2.3e-126
WP_000710952.1|264593_264968_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001538679.1|265063_265273_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	2.0e-33
WP_000212987.1|265320_268563_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.0	0.0e+00
WP_000807940.1|268555_268897_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001348269.1|268896_269595_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	1.1e-128
WP_001405642.1|269605_270349_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.6e-147
WP_128972936.1|270294_270927_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.6	4.2e-103
WP_169063482.1|271270_274963_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.6	0.0e+00
WP_001228259.1|275030_275630_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	5.2e-103
WP_169063483.1|275781_277839_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	64.8	2.3e-150
WP_001204581.1|277835_278114_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_016240857.1|278123_278411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524272.1|279100_279937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001607582.1|280152_280371_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_021524271.1|280452_280743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091322.1|280795_281092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000564593.1|281165_281408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524270.1|281516_281867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287374.1|281930_282335_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001233369.1|282493_282973_-	DUF4756 family protein	NA	NA	NA	NA	NA
WP_021524269.1|283146_283878_+	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	41.4	8.7e-44
WP_021524268.1|283962_284544_-	replication/maintenance protein RepL	NA	NA	NA	NA	NA
WP_021524266.1|285897_286860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524265.1|286920_288093_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021524264.1|288184_288562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298513.1|288593_289067_-	DUF4755 domain-containing protein	NA	NA	NA	NA	NA
WP_000722536.1|289499_290030_+	lipoprotein	NA	NA	NA	NA	NA
WP_021524263.1|290040_290316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151469.1|290375_291212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122165.1|291348_291858_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_032147728.1|291989_292853_-	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	36.4	3.2e-21
WP_000964096.1|292969_294472_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_000368352.1|295117_295423_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_021524261.1|295820_296378_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_021524260.1|296430_297894_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_021524259.1|298008_299829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021524258.1|299942_301163_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	42.1	3.3e-80
302545:302560	attR	CTTTTTGTTCGACCTC	NA	NA	NA	NA
>prophage 13
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	305214	315298	5053537		Bacillus_phage(40.0%)	10	NA	NA
WP_001347103.1|305214_305886_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826711.1|305885_307244_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001330593.1|308136_308502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524254.1|308541_309237_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001157268.1|309303_310722_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000228686.1|310702_311173_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_021524253.1|311161_312082_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922688.1|312254_313172_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009302.1|313250_313433_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001351132.1|313603_315298_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	1.5e-17
>prophage 14
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	331616	332699	5053537		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000737290.1|331616_332699_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.1	6.0e-166
>prophage 15
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	346039	346792	5053537		Bacillus_virus(100.0%)	1	NA	NA
WP_001273000.1|346039_346792_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 16
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	358784	360299	5053537		Staphylococcus_phage(100.0%)	1	NA	NA
WP_169063498.1|358784_360299_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	5.7e-13
>prophage 17
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	370386	374655	5053537		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_001313042.1|370386_372048_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|372338_373199_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_169063499.1|373201_374251_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763860.1|374265_374655_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
>prophage 18
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	379178	380912	5053537	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|379178_380912_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 19
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	387528	389579	5053537		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|387528_388272_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|388312_388708_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000639284.1|388760_389579_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	3.2e-71
>prophage 20
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	393472	400534	5053537		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|393472_393994_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024939.1|393995_394598_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|394668_394734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|394872_395484_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|395492_396503_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571478.1|396647_397433_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|397429_398185_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001347089.1|398263_399196_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|399211_400534_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 21
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	404532	406008	5053537		Cyanophage(100.0%)	1	NA	NA
WP_021524238.1|404532_406008_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 22
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	414064	418533	5053537		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|414064_414727_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011664.1|414750_415407_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|415508_415739_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|415877_416252_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879320.1|416255_417128_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|417140_417482_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812743.1|417876_418533_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.5	1.0e-56
>prophage 23
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	426025	428074	5053537		Moraxella_phage(100.0%)	1	NA	NA
WP_021524233.1|426025_428074_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	2.3e-86
>prophage 24
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	433406	433616	5053537		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|433406_433616_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 25
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	439257	440814	5053537		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|439257_440814_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 26
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	444672	452778	5053537	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854994.1|444672_446034_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	34.7	8.6e-45
WP_000457334.1|446107_446287_+	YoaH family protein	NA	NA	NA	NA	NA
WP_015912513.1|446385_446766_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001351125.1|447127_447472_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|447603_449514_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220976.1|449571_450267_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|450306_450888_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|451092_452778_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 27
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	461745	466322	5053537		Bacillus_phage(100.0%)	3	NA	NA
WP_000766137.1|461745_463236_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_100272957.1|463416_464892_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219684.1|465038_466322_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 28
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	469640	470495	5053537		Indivirus(100.0%)	1	NA	NA
WP_001337804.1|469640_470495_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	8.7e-11
>prophage 29
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	479308	483394	5053537		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723717.1|479308_480289_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	3.0e-07
WP_000719088.1|480425_481184_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000438809.1|481301_482660_+	MFS transporter	NA	NA	NA	NA	NA
WP_021535906.1|482752_483394_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
>prophage 30
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	488320	490276	5053537		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235807.1|488320_490276_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 31
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	494666	495320	5053537		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|494666_495320_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 32
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	502083	503304	5053537		Klosneuvirus(100.0%)	1	NA	NA
WP_000081990.1|502083_503304_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.7e-26
>prophage 33
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	510780	511608	5053537		Bacillus_virus(100.0%)	1	NA	NA
WP_000175018.1|510780_511608_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.7e-73
>prophage 34
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	517735	519997	5053537		Tupanvirus(100.0%)	1	NA	NA
WP_000077890.1|517735_519997_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.4	2.3e-143
>prophage 35
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	529373	548912	5053537	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144202.1|529373_531302_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|531305_531848_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|531944_532142_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|532194_532551_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|532673_532718_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|533001_533985_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_021524221.1|533999_536387_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|536391_536691_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956528.1|536791_537772_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154199.1|537833_538385_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029464.1|538384_539134_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209783.1|539211_539676_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.8e-11
WP_001298229.1|539922_540636_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175635.1|540698_542135_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001313872.1|542138_542330_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|542461_543508_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|543664_544498_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069409.1|544830_547209_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_001296108.1|547265_548912_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.7e-31
>prophage 36
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	567384	572468	5053537		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367158.1|567384_567753_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
WP_001304330.1|567761_569249_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948882.1|569258_570005_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_000907963.1|569979_571251_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144571.1|571247_572468_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	2.6e-93
>prophage 37
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	580759	583026	5053537		Escherichia_phage(50.0%)	3	NA	NA
WP_001518634.1|580759_581428_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_021524196.1|581424_582210_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587583.1|582213_583026_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 38
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	588530	597334	5053537		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|588530_589172_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|589211_590360_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182336.1|590650_591862_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269494.1|591974_592907_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190985.1|592903_593929_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_001563420.1|594227_594317_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701049.1|594482_595652_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|595797_596379_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101209.1|596506_597334_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 39
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	601750	603249	5053537		Indivirus(50.0%)	2	NA	NA
WP_021524194.1|601750_602647_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	31.3	8.0e-07
WP_001298528.1|602727_603249_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
>prophage 40
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	610159	611434	5053537	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|610159_611434_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 41
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	631224	633036	5053537		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945913.1|631224_633036_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 42
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	642931	644233	5053537		Bacillus_phage(100.0%)	1	NA	NA
WP_169063507.1|642931_644233_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.1	3.2e-17
>prophage 43
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	654333	725360	5053537	protease,head,terminase,holin,portal,transposase,tail,capsid,lysis	Escherichia_phage(42.37%)	85	NA	NA
WP_001260853.1|654333_655155_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|655254_655338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|655430_655766_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091847.1|656163_657417_-	MFS transporter	NA	NA	NA	NA	NA
WP_021524186.1|657523_658417_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|658551_659772_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|659896_660592_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_169063508.1|660544_661837_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148695.1|661996_662611_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
WP_000526507.1|662653_663508_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_169063509.1|663509_664127_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	4.0e-74
WP_001468025.1|664137_666561_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
WP_021524185.1|666621_669048_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	3.5e-214
WP_000778146.1|669246_669552_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072251714.1|669659_670370_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|670372_670933_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705201.1|670967_671309_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001304355.1|671443_671770_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_001298659.1|671975_673190_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_169063510.1|673201_674221_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001531709.1|674278_674383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024188207.1|674408_675704_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	7.4e-155
WP_021538003.1|675723_675975_-	excisionase family protein	NA	S4TND0	Salmonella_phage	47.4	5.5e-14
WP_021538002.1|676044_678519_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	3.6e-57
WP_000560212.1|678642_678864_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_021538001.1|679406_679877_+	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	42.0	8.4e-16
WP_021538000.1|680161_680317_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.8e-07
WP_000381212.1|680485_680893_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_001594109.1|680973_681201_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_021537999.1|681184_681694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021537998.1|681674_682640_+	phage replication protein O	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_001151189.1|682680_683082_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_000782641.1|683278_683917_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_050517950.1|683940_684585_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000887491.1|685076_685289_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|685504_685756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|685822_686101_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_021521352.1|686102_687149_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	2.9e-109
WP_000904114.1|687161_687536_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_021537995.1|687532_688354_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	3.6e-78
WP_000562553.1|689250_689382_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000871291.1|689662_689998_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|690258_690447_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001323614.1|690443_690605_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_113263695.1|690621_690681_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000372595.1|690754_690970_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_021537993.1|691328_691862_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	2.0e-98
WP_001082537.1|692160_692625_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000079508.1|692932_693343_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001331705.1|693400_693634_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000453576.1|694022_694568_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027268.1|694542_696468_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|696464_696671_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_021538605.1|696667_698269_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.1e-309
WP_021537990.1|698249_699569_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.2e-232
WP_021537989.1|699578_699911_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_021537988.1|699965_700991_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	1.2e-189
WP_021537987.1|701032_701428_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	92.4	3.5e-55
WP_000753019.1|701439_701793_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_021537986.1|701804_702383_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683128.1|702379_702775_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001467857.1|702782_703523_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.2	3.8e-132
WP_000479162.1|703538_703961_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.8e-71
WP_000459474.1|703942_704377_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_125093572.1|705290_705785_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	93.9	9.3e-74
WP_021537984.1|705810_706869_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.6	4.9e-165
WP_000847339.1|706865_707195_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
WP_021537983.1|707194_707893_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	2.0e-130
WP_024188206.1|707898_708642_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_071778932.1|708578_709211_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.5e-95
WP_169063511.1|709271_712484_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	94.8	0.0e+00
WP_000654813.1|712529_713498_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	2.5e-184
WP_077626742.1|713577_713817_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	98.7	6.7e-38
WP_021541891.1|713884_714484_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	1.4e-100
WP_169063512.1|714635_717008_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	2.2e-168
WP_000654140.1|717007_717289_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	7.0e-18
WP_021537977.1|717298_718003_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.1	3.9e-57
WP_021537976.1|718013_718307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021537975.1|718398_719256_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101732.1|719252_720110_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_001576746.1|720106_720934_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	1.5e-07
WP_000555630.1|720933_721848_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000347484.1|722288_723572_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000526706.1|723660_725121_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	5.1e-43
WP_000214712.1|725156_725360_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 44
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	729746	730637	5053537		Bacillus_phage(100.0%)	1	NA	NA
WP_021524182.1|729746_730637_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
>prophage 45
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	738139	740269	5053537		Pandoravirus(50.0%)	3	NA	NA
WP_000012593.1|738139_739579_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.8e-30
WP_021524179.1|739635_739854_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091198.1|739885_740269_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 46
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	748119	749538	5053537		Bacillus_phage(100.0%)	1	NA	NA
WP_021524178.1|748119_749538_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 47
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	771175	778111	5053537		Bacillus_phage(50.0%)	3	NA	NA
WP_001304373.1|771175_772861_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	3.8e-10
WP_000832485.1|772898_775271_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_021524168.1|775327_778111_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	4.4e-19
>prophage 48
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	783588	785988	5053537		Klosneuvirus(100.0%)	1	NA	NA
WP_021524166.1|783588_785988_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	3.5e-09
>prophage 49
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	789395	791154	5053537		Escherichia_phage(66.67%)	3	NA	NA
WP_000642412.1|789395_790406_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
WP_000605675.1|790591_790870_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_000781370.1|790869_791154_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 50
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	802578	804123	5053537		Escherichia_phage(100.0%)	1	NA	NA
WP_000702528.1|802578_804123_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 51
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	811590	813996	5053537		Ralstonia_phage(100.0%)	1	NA	NA
WP_021535880.1|811590_813996_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.6	5.6e-23
>prophage 52
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	818668	820741	5053537		Salmonella_phage(100.0%)	1	NA	NA
WP_171937708.1|818668_820741_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	3.6e-135
>prophage 53
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	826237	827251	5053537		Mycoplasma_phage(100.0%)	1	NA	NA
WP_021524156.1|826237_827251_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	6.6e-26
>prophage 54
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	830880	832842	5053537		Phage_TP(100.0%)	1	NA	NA
WP_001313806.1|830880_832842_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
>prophage 55
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	844692	845641	5053537		Moraxella_phage(50.0%)	2	NA	NA
WP_000731859.1|844692_844866_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001350640.1|845110_845641_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 56
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	849581	853484	5053537		Klosneuvirus(100.0%)	1	NA	NA
WP_021524150.1|849581_853484_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 57
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	872137	873127	5053537		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|872137_873127_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 58
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	878086	887507	5053537	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_000837933.1|878086_879220_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
WP_001295593.1|879360_879795_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157412.1|882121_883057_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_001591989.1|883185_884559_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	3.3e-52
WP_000387388.1|885036_886020_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_012601490.1|886274_887507_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
>prophage 59
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	892248	892764	5053537		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945020.1|892248_892764_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	8.3e-25
>prophage 60
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	909988	911071	5053537		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057991.1|909988_911071_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-23
>prophage 61
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	930412	932430	5053537		Bacillus_virus(50.0%)	2	NA	NA
WP_000573407.1|930412_931219_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000135020.1|931266_932430_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	1.6e-28
>prophage 62
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	941363	943298	5053537		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485012.1|941363_943298_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 63
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	951110	951701	5053537		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|951110_951701_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 64
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	956611	1080144	5053537	protease,head,terminase,holin,portal,integrase,tail,capsid,lysis	Escherichia_phage(43.93%)	150	964593:964608	1087512:1087527
WP_001682840.1|956611_959209_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|959588_959840_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422056.1|959875_960925_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	30.9	1.5e-20
WP_021524077.1|961144_961903_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278741.1|961899_962490_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|962529_963405_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_024187957.1|963617_965507_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
964593:964608	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
WP_001295575.1|965534_966155_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_021524075.1|966151_967033_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|967170_967215_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194639.1|967306_968869_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_021537922.1|968868_970464_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983889.1|970464_971826_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209513.1|971837_973031_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443050.1|973030_973837_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_072145561.1|974181_974664_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079498.1|974709_975216_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001304589.1|975847_976300_-	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_001304590.1|976485_976818_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000355614.1|976935_977232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|977241_977520_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_169063517.1|977516_979580_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	64.2	1.2e-151
WP_169063518.1|979731_980331_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	2.9e-106
WP_169063519.1|980398_984094_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	73.5	0.0e+00
WP_071778932.1|984154_984787_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.5e-95
WP_097760928.1|984723_985467_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	3.1e-150
WP_169063520.1|985471_986170_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.8e-131
WP_000847355.1|986169_986499_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_016231007.1|986495_989570_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	94.4	0.0e+00
WP_001161009.1|989541_989871_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_169063639.1|989879_990266_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	99.2	9.5e-66
WP_000211128.1|990326_991070_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001079411.1|991080_991482_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.4e-72
WP_001520733.1|991478_992069_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.6	2.1e-80
WP_001283153.1|992080_992356_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|992348_992672_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_169063521.1|992758_994786_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
WP_169063522.1|994730_996311_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.8	2.8e-289
WP_001072975.1|996238_996451_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001759004.1|997806_998292_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	64.6	7.8e-49
WP_169063523.1|998550_1000467_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	S5M7Q8	Escherichia_phage	57.1	8.0e-214
WP_047090435.1|1000463_1000673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169063524.1|1001098_1001521_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_169063525.1|1001517_1001769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169063526.1|1001969_1003385_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	57.9	2.9e-112
WP_169063527.1|1003381_1003681_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_169063528.1|1003872_1004244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169063529.1|1004236_1004440_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000094457.1|1004645_1004843_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	43.1	9.5e-06
WP_126722946.1|1005467_1006046_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	63.6	1.6e-56
WP_001095276.1|1006105_1006309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126722947.1|1006321_1007560_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	34.7	4.6e-61
WP_000349509.1|1008716_1009208_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001028468.1|1009882_1010404_-	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	99.4	7.2e-101
WP_040075028.1|1010608_1010761_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	96.0	4.7e-21
WP_001228702.1|1010789_1010996_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_000675927.1|1011217_1011331_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	91.9	4.3e-11
WP_169063530.1|1011552_1012086_-	glycoside hydrolase family protein	NA	Q6H9V6	Enterobacteria_phage	95.5	1.6e-100
WP_000193280.1|1012149_1012500_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000839572.1|1012504_1012720_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_100272964.1|1013436_1014150_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917753.1|1014286_1014484_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	3.4e-27
WP_000211988.1|1014708_1015269_-	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	57.2	5.8e-40
WP_157911653.1|1015403_1015547_-	ash family protein	NA	NA	NA	NA	NA
WP_059338046.1|1015551_1015938_-	antitermination protein	NA	Q5MBW8	Stx1-converting_phage	81.5	4.7e-57
WP_059338047.1|1015927_1016305_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	1.2e-36
WP_059338048.1|1016305_1017364_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	3.1e-90
WP_001405664.1|1017365_1017644_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	5.1e-05
WP_000980988.1|1017710_1017962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1018177_1018333_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_059338087.1|1018891_1019407_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
WP_000753058.1|1019403_1019580_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	4.3e-26
WP_001224662.1|1019572_1019755_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|1019848_1020205_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_032284122.1|1020182_1020644_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	5.9e-38
WP_001266130.1|1020640_1020937_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141099.1|1020933_1021326_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_000450708.1|1021341_1022112_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	1.5e-86
WP_001309414.1|1022145_1022688_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_001262415.1|1022599_1023640_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_000702041.1|1023711_1024137_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001053425.1|1024120_1024396_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000753626.1|1024503_1024965_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_000379612.1|1025218_1025374_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001304608.1|1025533_1025773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394526.1|1025775_1026096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351093.1|1026073_1026511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449191.1|1026911_1027100_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1027096_1027288_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_169063531.1|1027380_1029852_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|1029916_1030165_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|1030142_1031273_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000251936.1|1031746_1031917_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000937495.1|1032031_1032301_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240997.1|1032357_1033026_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885577.1|1033080_1033665_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_021537919.1|1033664_1036835_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	58.6	2.0e-81
WP_021535892.1|1036899_1037499_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	1.2e-104
WP_169063532.1|1037566_1041046_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_001332187.1|1041112_1041451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|1041523_1042126_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_021537917.1|1042062_1042806_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	3.0e-145
WP_021535895.1|1042810_1043509_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_021535896.1|1043508_1043838_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.4e-56
WP_032218216.1|1043834_1046408_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	0.0e+00
WP_000533402.1|1046388_1046802_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|1046828_1047260_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_021537915.1|1047273_1048026_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000683079.1|1048033_1048429_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974994.1|1048425_1049001_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_021535871.1|1049016_1049370_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	5.1e-42
WP_021535870.1|1049362_1049731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021535869.1|1049782_1050811_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	1.6e-112
WP_000256823.1|1050868_1051216_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001556921.1|1051252_1052758_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_021535868.1|1052747_1054340_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.2e-185
WP_021535867.1|1054336_1054540_-|head	head-stabilizing protein	head	K7PM10	Enterobacteria_phage	54.1	2.1e-08
WP_021535866.1|1054523_1056452_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.4e-258
WP_001405844.1|1056423_1056930_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.5	1.6e-33
WP_001329960.1|1057365_1057551_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|1057683_1057824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082539.1|1058174_1058642_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.3	9.1e-71
WP_000992075.1|1058940_1059474_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
WP_000369850.1|1059579_1059852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|1059817_1060162_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|1060166_1060382_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_160800041.1|1060532_1062386_-	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	88.0	0.0e+00
WP_001536853.1|1064859_1065057_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	8.0e-29
WP_021524063.1|1065283_1066105_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	5.5e-79
WP_021524062.1|1066101_1066482_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.9e-34
WP_169063533.1|1066482_1067538_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|1067539_1067812_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|1067979_1068192_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|1068372_1069038_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|1069212_1069638_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_169063534.1|1069653_1070424_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	4.6e-80
WP_000788950.1|1070445_1071192_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095673.1|1071198_1072161_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_000693888.1|1072183_1072609_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|1072592_1072874_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|1072974_1073394_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379586.1|1073659_1073812_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394541.1|1073823_1074162_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_001295058.1|1074150_1074345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935597.1|1074917_1075772_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_169063492.1|1075782_1075971_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_169063491.1|1075967_1076159_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_169063535.1|1076251_1078723_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	55.5	4.0e-56
WP_000113189.1|1078787_1079036_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|1079013_1080144_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
1087512:1087527	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
>prophage 65
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1088078	1090093	5053537		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|1088078_1089083_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110954.1|1089079_1090093_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 66
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1099659	1109667	5053537		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068076.1|1099659_1100277_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_001287378.1|1100880_1101294_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|1101437_1102346_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_021524050.1|1102547_1103561_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|1103652_1104558_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001362934.1|1104670_1105129_+	YchJ family protein	NA	NA	NA	NA	NA
WP_021524049.1|1105178_1106021_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|1106744_1107422_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571684.1|1107421_1108132_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_021524048.1|1108128_1109667_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	1.1e-19
>prophage 67
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1120799	1127068	5053537		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
WP_001146444.1|1120799_1121030_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_000063608.1|1121299_1122400_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170963.1|1122804_1122912_+	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_000811065.1|1123060_1123915_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257054.1|1123950_1124760_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200375.1|1124763_1125156_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456474.1|1125152_1125986_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|1125985_1127068_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 68
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1130204	1132956	5053537		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|1130204_1131152_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033350.1|1131276_1132956_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
>prophage 69
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1145398	1146157	5053537		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173310.1|1145398_1146157_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 70
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1162185	1163873	5053537		Salmonella_phage(50.0%)	2	NA	NA
WP_000457587.1|1162185_1163454_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.0	6.9e-206
WP_000897378.1|1163453_1163873_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 71
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1178077	1180946	5053537		Enterobacteria_phage(50.0%)	4	NA	NA
WP_000332310.1|1178077_1178809_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	9.3e-54
WP_000373104.1|1179029_1179434_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_001445545.1|1179486_1179612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000444487.1|1179695_1180946_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 72
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1184082	1185453	5053537		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423737.1|1184082_1185453_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
>prophage 73
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1190475	1192453	5053537		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531578.1|1190475_1191612_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|1191595_1192453_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 74
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1195725	1199448	5053537		Vibrio_phage(50.0%)	4	NA	NA
WP_000952746.1|1195725_1196547_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291300.1|1196562_1197474_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251365.1|1197502_1198747_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033695.1|1198746_1199448_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 75
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1206735	1206993	5053537		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1206735_1206993_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 76
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1219316	1220959	5053537		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267922.1|1219316_1220321_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257002.1|1220317_1220959_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 77
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1224231	1225413	5053537		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|1224231_1224468_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|1224678_1225413_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 78
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1237767	1238709	5053537		Brevibacillus_phage(100.0%)	1	NA	NA
WP_012601461.1|1237767_1238709_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	4.7e-10
>prophage 79
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1254589	1254835	5053537		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1254589_1254835_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 80
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1259497	1260418	5053537		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|1259497_1260418_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 81
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1269725	1270259	5053537		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1269725_1270259_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 82
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1274396	1278195	5053537		Pelagibacter_phage(50.0%)	5	NA	NA
WP_001189321.1|1274396_1275230_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
WP_001297187.1|1275293_1275785_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_021523973.1|1275886_1276441_-	molecular chaperone YcdY	NA	NA	NA	NA	NA
WP_021523972.1|1276464_1277202_-	zinc-binding phosphatase	NA	NA	NA	NA	NA
WP_021523971.1|1277256_1278195_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	30.2	2.7e-05
>prophage 83
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1286806	1287595	5053537		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533536.1|1286806_1287595_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
>prophage 84
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1302708	1304293	5053537		Enterobacteria_phage(100.0%)	2	NA	NA
WP_021523919.1|1302708_1304037_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	8.2e-234
WP_001273658.1|1304119_1304293_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 85
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1307323	1319841	5053537		Klosneuvirus(20.0%)	13	NA	NA
WP_000420625.1|1307323_1308244_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024569.1|1308243_1308549_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209904.1|1308904_1309504_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063134.1|1309500_1312047_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.8	2.6e-71
WP_001230247.1|1312046_1313219_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_169063538.1|1313348_1314041_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	2.3e-17
WP_001264953.1|1314013_1315042_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001054737.1|1315124_1317857_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	1.4e-38
WP_021523916.1|1317939_1319013_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1319061_1319235_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|1319224_1319455_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|1319429_1319618_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1319628_1319841_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 86
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1330834	1331494	5053537	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1330834_1331494_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 87
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1335728	1337783	5053537		Bacillus_phage(100.0%)	1	NA	NA
WP_021523911.1|1335728_1337783_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	3.8e-20
>prophage 88
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1350382	1352290	5053537		Tupanvirus(100.0%)	1	NA	NA
WP_000053063.1|1350382_1352290_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 89
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1361045	1371848	5053537	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_021523907.1|1361045_1361813_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	8.3e-29
WP_021523906.1|1361854_1364467_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	1.2e-18
WP_001298298.1|1364732_1365935_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|1366103_1367504_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_021523905.1|1368106_1369195_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	7.0e-98
WP_000462681.1|1369385_1370576_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109453.1|1370625_1371273_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1371299_1371848_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 90
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1386553	1391093	5053537		Bacillus_phage(100.0%)	3	NA	NA
WP_000551259.1|1386553_1388302_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705728.1|1388338_1390603_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1390808_1391093_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 91
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1396180	1397269	5053537		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057124.1|1396180_1397269_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	9.2e-82
>prophage 92
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1401367	1404582	5053537		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|1401367_1403650_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|1403841_1404582_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 93
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1407667	1431391	5053537	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
WP_000213106.1|1407667_1408285_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	61.1	1.3e-77
WP_000850284.1|1408295_1410740_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	4.6e-222
WP_000886683.1|1410978_1412271_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|1412361_1413705_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|1413715_1414327_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_059328688.1|1414485_1418514_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1418648_1419143_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_024187964.1|1419686_1420652_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	6.5e-63
WP_001043638.1|1420774_1422541_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_001202198.1|1422541_1424263_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001241673.1|1424304_1425009_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1425293_1425512_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1426197_1428474_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1428504_1428825_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1429147_1429372_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188147.1|1429444_1431391_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 94
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1440687	1442406	5053537		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815372.1|1440687_1442406_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 95
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1445993	1448731	5053537		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255186.1|1445993_1446824_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1446820_1447144_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001313703.1|1447269_1447785_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1448002_1448731_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 96
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1451856	1460996	5053537		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149694.1|1451856_1452984_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	4.6e-28
WP_000389260.1|1453024_1453513_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|1453572_1454418_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105415.1|1454414_1455359_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996010.1|1455368_1456502_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126098.1|1456596_1457709_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1458058_1458535_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1458622_1459525_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_021523878.1|1459585_1460308_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201575.1|1460291_1460579_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195230.1|1460738_1460996_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
>prophage 97
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1469563	1470766	5053537		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1469563_1470766_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 98
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1482100	1483972	5053537		Planktothrix_phage(100.0%)	1	NA	NA
WP_021523842.1|1482100_1483972_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.3	3.4e-15
>prophage 99
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1487187	1494071	5053537		Synechococcus_phage(33.33%)	5	NA	NA
WP_001313684.1|1487187_1487850_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	4.3e-26
WP_001313683.1|1487980_1488880_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209353.1|1488885_1491318_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_169063539.1|1491463_1492279_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000961458.1|1492478_1494071_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 100
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1499068	1504295	5053537		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1499068_1499584_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1499636_1499702_-	protein YliM	NA	NA	NA	NA	NA
WP_021523840.1|1499936_1500824_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100799.1|1501124_1501628_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	6.5e-06
WP_000843866.1|1502031_1502778_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1502916_1503576_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1503572_1504295_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 101
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1510858	1522521	5053537		Synechococcus_phage(20.0%)	10	NA	NA
WP_000990167.1|1510858_1511536_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	6.9e-19
WP_000146357.1|1511609_1511876_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849301.1|1512140_1512401_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000253506.1|1512629_1513715_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_169063540.1|1513855_1514818_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_021523836.1|1514845_1516996_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_000007119.1|1517532_1518894_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001295890.1|1519122_1519794_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_021523835.1|1519796_1520792_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_169063541.1|1520784_1522521_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	3.0e-18
>prophage 102
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1533119	1534028	5053537		Streptococcus_phage(100.0%)	1	NA	NA
WP_001304790.1|1533119_1534028_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 103
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1540355	1542885	5053537	transposase	Klosneuvirus(50.0%)	2	NA	NA
WP_021523832.1|1540355_1541660_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.7e-18
WP_000817269.1|1541754_1542885_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	86.4	9.5e-191
>prophage 104
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1553196	1559772	5053537		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891671.1|1553196_1554255_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	9.7e-20
WP_000604037.1|1554257_1554947_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113014.1|1554946_1555720_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1555886_1556036_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_021548009.1|1556164_1556953_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_021523829.1|1557020_1558493_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265443.1|1558755_1559772_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 105
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1564135	1567655	5053537		Klebsiella_phage(33.33%)	4	NA	NA
WP_001357154.1|1564135_1565188_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	48.8	1.7e-80
WP_000784342.1|1565503_1565884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951271.1|1565997_1566939_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.7e-23
WP_000345406.1|1566935_1567655_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
>prophage 106
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1595147	1595939	5053537		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114006.1|1595147_1595939_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	7.5e-09
>prophage 107
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1599317	1611150	5053537		Hokovirus(40.0%)	10	NA	NA
WP_001032722.1|1599317_1600799_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
WP_021523822.1|1600840_1602259_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	6.8e-61
WP_001075783.1|1602255_1602765_-	YbgA family protein	NA	NA	NA	NA	NA
WP_000424789.1|1602865_1603072_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001365534.1|1603384_1603474_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_001682707.1|1603473_1605147_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_021523821.1|1605169_1607218_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	2.1e-26
WP_001467928.1|1607226_1607799_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001313659.1|1607791_1610476_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_000186082.1|1610472_1611150_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 108
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1617805	1618570	5053537		Mycobacterium_phage(100.0%)	1	NA	NA
WP_021523820.1|1617805_1618570_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	4.9e-05
>prophage 109
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1622714	1625360	5053537	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_001287134.1|1622714_1624379_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
WP_000679501.1|1624598_1625360_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
>prophage 110
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1629853	1630612	5053537		Moraxella_phage(100.0%)	1	NA	NA
WP_000480543.1|1629853_1630612_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.2	4.8e-45
>prophage 111
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1633666	1635613	5053537		Vibrio_phage(100.0%)	1	NA	NA
WP_169063545.1|1633666_1635613_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 112
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1640238	1641903	5053537		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337076.1|1640238_1641903_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	1.4e-84
>prophage 113
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1646040	1647081	5053537		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1646040_1647081_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 114
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1655025	1660148	5053537	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
WP_021523810.1|1655025_1655751_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	2.2e-31
WP_001207536.1|1655868_1656804_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_001044880.1|1656848_1657331_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001362899.1|1657565_1660148_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	8.9e-184
>prophage 115
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1667158	1669598	5053537		Synechococcus_phage(50.0%)	2	NA	NA
WP_021523809.1|1667158_1668247_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1668386_1669598_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 116
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1674014	1674661	5053537		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1674014_1674398_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1674451_1674661_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 117
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1688750	1690865	5053537		Morganella_phage(50.0%)	2	NA	NA
WP_001295855.1|1688750_1689179_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
WP_000887629.1|1689299_1690865_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 118
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1693971	1695794	5053537		Streptococcus_phage(50.0%)	2	NA	NA
WP_100273066.1|1693971_1695192_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	7.9e-58
WP_000502940.1|1695164_1695794_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
>prophage 119
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1710084	1716127	5053537		Klosneuvirus(50.0%)	3	NA	NA
WP_000140646.1|1710084_1710900_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_016233919.1|1710896_1712030_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_021523805.1|1712245_1716127_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	2.2e-61
>prophage 120
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1727160	1730304	5053537		Leptospira_phage(100.0%)	1	NA	NA
WP_000573983.1|1727160_1730304_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.3e-59
>prophage 121
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1733449	1735565	5053537		Bacillus_phage(50.0%)	2	NA	NA
WP_000770953.1|1733449_1734133_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253820.1|1734122_1735565_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	1.7e-11
>prophage 122
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1744357	1748835	5053537	tRNA,tail	Enterobacteria_phage(33.33%)	6	NA	NA
WP_001331487.1|1744357_1744714_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	67.5	3.8e-53
WP_000025786.1|1745466_1745664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000729155.1|1745704_1746571_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1746572_1746785_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143501.1|1746892_1747414_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1747449_1748835_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 123
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1760770	1761916	5053537		Streptococcus_phage(100.0%)	1	NA	NA
WP_021523803.1|1760770_1761916_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	9.7e-50
>prophage 124
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1768106	1769888	5053537		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001313634.1|1768106_1769888_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
>prophage 125
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1776223	1776910	5053537		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|1776223_1776910_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 126
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1780046	1780724	5053537		Bacillus_virus(100.0%)	1	NA	NA
WP_021523798.1|1780046_1780724_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.4e-26
>prophage 127
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1786605	1789847	5053537		Escherichia_phage(66.67%)	3	NA	NA
WP_021513535.1|1786605_1789110_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.2e-115
WP_000806442.1|1789167_1789509_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000057524.1|1789544_1789847_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	2.2e-41
>prophage 128
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1799409	1807854	5053537		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801820.1|1799409_1800378_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	6.0e-16
WP_001250114.1|1800352_1801315_-	ferrochelatase	NA	NA	NA	NA	NA
WP_021523796.1|1801446_1802091_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|1802271_1804146_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1804255_1804861_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1804860_1805190_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122015.1|1805242_1807174_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1807302_1807854_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 129
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1814862	1818012	5053537		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|1814862_1818012_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 130
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1826848	1830395	5053537		Bacillus_phage(100.0%)	2	NA	NA
WP_021523793.1|1826848_1828630_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	5.2e-42
WP_021523792.1|1828622_1830395_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.3e-50
>prophage 131
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1833718	1834414	5053537		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|1833718_1834414_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 132
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1837554	1842601	5053537	protease	Burkholderia_virus(25.0%)	4	NA	NA
WP_169063549.1|1837554_1837827_-	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	58.4	5.0e-21
WP_001295325.1|1838035_1840390_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1840577_1841852_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1841977_1842601_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 133
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1864034	1872877	5053537	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|1864034_1864505_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150440.1|1864593_1865697_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
WP_000543535.1|1865700_1866150_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001298536.1|1866300_1866840_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295827.1|1867138_1868023_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1868060_1868408_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1868537_1869509_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934823.1|1869519_1871367_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1871394_1871727_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1871749_1872877_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 134
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1879828	1889927	5053537		Bacillus_phage(60.0%)	7	NA	NA
WP_000893597.1|1879828_1881124_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.2	4.5e-27
WP_000113933.1|1881181_1881871_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221292.1|1882060_1883263_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_021523783.1|1883259_1886403_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001331503.1|1886528_1887713_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219295.1|1887981_1888890_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|1889015_1889927_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 135
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1894213	1895329	5053537		Bacillus_phage(100.0%)	1	NA	NA
WP_000484068.1|1894213_1895329_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 136
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1902743	1903901	5053537		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830766.1|1902743_1903901_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 137
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1910809	1911577	5053537		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939359.1|1910809_1911577_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 138
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1916869	1924152	5053537		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_000842109.1|1916869_1917979_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
WP_000419066.1|1918071_1918905_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001096710.1|1919131_1919671_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000805859.1|1919872_1920955_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	2.4e-191
WP_001533000.1|1921077_1924152_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.6	0.0e+00
>prophage 139
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1929009	1930896	5053537		Staphylococcus_phage(100.0%)	1	NA	NA
WP_021535944.1|1929009_1930896_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	1.8e-53
>prophage 140
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1939391	1943929	5053537		Tupanvirus(50.0%)	4	NA	NA
WP_021523770.1|1939391_1940441_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
WP_000750342.1|1940527_1941484_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818888.1|1941480_1942452_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447324.1|1942444_1943929_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	6.1e-12
>prophage 141
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1956758	1964327	5053537	integrase,holin	Vibrio_phage(33.33%)	5	1950272:1950285	1965354:1965367
1950272:1950285	attL	TTGCCGTTGGTGAA	NA	NA	NA	NA
WP_000131040.1|1956758_1958792_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_021523765.1|1958920_1959508_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_021523764.1|1959521_1960994_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_021523763.1|1961007_1962678_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	8.9e-60
WP_001295805.1|1963763_1964327_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
1965354:1965367	attR	TTGCCGTTGGTGAA	NA	NA	NA	NA
>prophage 142
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1974252	1977557	5053537		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046332.1|1974252_1975578_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
WP_000474088.1|1975686_1975923_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_021523762.1|1975934_1976528_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001295799.1|1976687_1977557_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
>prophage 143
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	1983602	1984454	5053537		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|1983602_1984454_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 144
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2001679	2048395	5053537	transposase,plate	Acinetobacter_phage(18.18%)	40	NA	NA
WP_097730840.1|2001679_2002841_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_021523760.1|2003996_2008127_+	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.6	7.3e-281
WP_001059463.1|2008282_2008777_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000772639.1|2009211_2009550_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
WP_000893298.1|2009894_2011148_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_001285288.1|2011159_2012263_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749899.1|2012550_2013606_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
WP_000174703.1|2013644_2014046_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189573.1|2014103_2015348_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291991.1|2015439_2015898_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292999.1|2016158_2017616_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602123.1|2017672_2018287_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001335538.1|2018283_2019435_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.8e-31
WP_071778924.1|2019612_2020065_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263500.1|2020074_2020473_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|2020475_2020769_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226168.1|2020820_2021876_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_061301231.1|2021946_2022732_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_021523756.1|2022676_2024416_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_125093574.1|2024494_2024839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000006241.1|2024833_2025331_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000093934.1|2025506_2026256_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_001225679.1|2026567_2027308_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|2027278_2028046_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|2028250_2028829_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_021523755.1|2029068_2031513_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|2031555_2032029_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_021523754.1|2032182_2032953_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001298174.1|2033224_2033713_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000227712.1|2033806_2034310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513317.1|2035560_2035851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097730840.1|2037084_2038247_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000571853.1|2038518_2039565_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_021537848.1|2039671_2041654_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	4.2e-24
WP_001142963.1|2041874_2042393_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000041480.1|2043094_2043598_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000111582.1|2043620_2045105_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000946069.1|2045109_2045535_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_021523748.1|2045540_2047382_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000896713.1|2047345_2048395_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 145
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2052340	2055103	5053537		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614310.1|2052340_2055103_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	3.6e-82
>prophage 146
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2064368	2072222	5053537		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001298181.1|2064368_2065100_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	5.8e-40
WP_021523742.1|2065164_2065632_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|2065628_2066351_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052743.1|2066384_2067140_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644691.1|2067211_2068570_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211719.1|2068618_2069389_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2069466_2070267_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648563.1|2070507_2071422_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997016.1|2071418_2072222_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
>prophage 147
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2078742	2079774	5053537		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|2078742_2079774_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 148
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2092731	2096847	5053537		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294798.1|2092731_2096214_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000569423.1|2096250_2096847_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
>prophage 149
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2105675	2106434	5053537		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|2105675_2106434_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 150
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2118021	2119446	5053537	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753936.1|2118021_2119446_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 151
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2123375	2123720	5053537		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2123375_2123720_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 152
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2129631	2130429	5053537		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|2129631_2130429_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 153
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2135564	2142370	5053537	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_021523595.1|2135564_2137994_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.7	2.3e-40
WP_021523594.1|2138067_2138598_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396047.1|2138612_2139317_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2139494_2139950_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937411.1|2139986_2140913_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|2140951_2142370_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 154
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2152260	2153145	5053537		Sodalis_phage(100.0%)	1	NA	NA
WP_000339913.1|2152260_2153145_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	48.4	4.7e-60
>prophage 155
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2156407	2158682	5053537		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_000150638.1|2156407_2157334_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651600.1|2157442_2158105_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|2158145_2158682_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
>prophage 156
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2170817	2172242	5053537		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_021537795.1|2170817_2172242_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	8.4e-43
>prophage 157
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2184659	2185211	5053537		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923733.1|2184659_2185211_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.9e-11
>prophage 158
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2189457	2190501	5053537		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|2189457_2190501_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 159
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2229790	2230489	5053537		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916270.1|2229790_2230489_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.2	8.9e-22
>prophage 160
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2238765	2244187	5053537		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_021523581.1|2238765_2241117_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	8.7e-37
WP_001117001.1|2241280_2244187_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 161
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2251932	2253893	5053537		Microcystis_phage(50.0%)	4	NA	NA
WP_001765384.1|2251932_2252781_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_001160966.1|2252777_2253092_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000125566.1|2253094_2253328_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|2253413_2253893_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 162
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2261787	2267447	5053537		Vibrio_phage(50.0%)	4	NA	NA
WP_021523576.1|2261787_2263302_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|2263332_2264475_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349942.1|2264603_2265821_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001298634.1|2265893_2267447_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	2.7e-34
>prophage 163
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2272950	2274099	5053537		Halovirus(100.0%)	1	NA	NA
WP_021537798.1|2272950_2274099_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.3e-49
>prophage 164
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2278907	2293431	5053537	tRNA	Tupanvirus(16.67%)	12	NA	NA
WP_001286823.1|2278907_2281724_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
WP_000767329.1|2281766_2282708_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001337277.1|2282715_2282934_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_001274021.1|2283036_2283300_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000062878.1|2283395_2284301_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_000681386.1|2284360_2285527_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.8	3.0e-91
WP_000494924.1|2285761_2287021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021535948.1|2287149_2288643_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	3.6e-28
WP_001274832.1|2288662_2289424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001181672.1|2289981_2290191_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001118464.1|2290295_2291426_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2291514_2293431_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
>prophage 165
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2296567	2297521	5053537		Cyanophage(100.0%)	1	NA	NA
WP_000130187.1|2296567_2297521_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 166
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2309290	2311404	5053537		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_021536056.1|2309290_2310715_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	1.1e-10
WP_001188687.1|2310714_2311404_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 167
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2314681	2320491	5053537		Bacillus_phage(33.33%)	5	NA	NA
WP_000409429.1|2314681_2316619_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046754.1|2316825_2318493_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000007436.1|2318548_2318833_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000513550.1|2318834_2319167_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000093834.1|2319258_2320491_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 168
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2328254	2329577	5053537		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477822.1|2328254_2329577_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	4.0e-79
>prophage 169
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2335081	2337957	5053537		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2335081_2335243_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2335369_2335975_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|2336367_2337957_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 170
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2345781	2347061	5053537		Salmonella_phage(50.0%)	2	NA	NA
WP_000098811.1|2345781_2346321_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|2346323_2347061_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 171
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2350288	2355644	5053537		Tupanvirus(50.0%)	4	NA	NA
WP_000106043.1|2350288_2351311_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091572.1|2351449_2352364_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410144.1|2352578_2353940_+	MFS transporter	NA	NA	NA	NA	NA
WP_152639236.1|2353988_2355644_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 172
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2375353	2376814	5053537		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_021538258.1|2375353_2376814_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 173
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2387017	2388693	5053537		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|2387017_2387614_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|2388090_2388693_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 174
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2392053	2393034	5053537		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001295601.1|2392053_2393034_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	1.2e-101
>prophage 175
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2396662	2398797	5053537		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692345.1|2396662_2396884_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_158302277.1|2396946_2397423_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000849588.1|2397438_2397924_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_023156757.1|2397978_2398797_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	4.4e-44
>prophage 176
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2414290	2416459	5053537	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001282151.1|2414290_2414680_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	99.2	7.8e-68
WP_000612591.1|2414676_2415024_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998066.1|2415073_2416459_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.6	8.2e-261
>prophage 177
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2420078	2427512	5053537	transposase	Stx2-converting_phage(40.0%)	8	NA	NA
WP_000624688.1|2420078_2420429_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|2420459_2422073_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_088130945.1|2422130_2423358_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.0e-174
WP_001446914.1|2423744_2423984_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
WP_169063560.1|2424194_2425451_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705931.1|2425463_2425751_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000916805.1|2425766_2426210_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000416152.1|2426480_2427512_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
>prophage 178
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2438806	2440315	5053537		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001189111.1|2438806_2440315_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 179
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2455748	2461118	5053537		Acanthamoeba_polyphaga_moumouvirus(50.0%)	2	NA	NA
WP_000431483.1|2455748_2458199_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	25.5	7.7e-20
WP_001446455.1|2458211_2461118_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	43.0	2.8e-08
>prophage 180
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2465430	2477524	5053537	integrase,tRNA	Stenotrophomonas_phage(20.0%)	8	2458173:2458187	2470513:2470527
2458173:2458187	attL	ACGAAGTTGTTGCCA	NA	NA	NA	NA
WP_001218948.1|2465430_2466675_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.2	1.1e-83
WP_001315986.1|2467141_2468161_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	3.2e-44
WP_001315985.1|2468290_2469793_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001295681.1|2469911_2470994_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
2470513:2470527	attR	ACGAAGTTGTTGCCA	NA	NA	NA	NA
WP_000584109.1|2470993_2472094_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2472360_2473872_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2474225_2474669_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|2474668_2477524_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 181
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2485835	2491932	5053537		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013064.1|2485835_2486771_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	2.5e-51
WP_000148581.1|2486783_2487245_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2487317_2487704_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|2487909_2490606_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2490746_2490800_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|2490984_2491932_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 182
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2495570	2558840	5053537	protease,lysis,integrase,transposase	Vibrio_phage(18.18%)	58	2533352:2533366	2540132:2540146
WP_000187791.1|2495570_2497709_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106226.1|2497868_2498333_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_001232255.1|2498377_2498764_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162184.1|2498818_2500171_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|2500264_2500816_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219806.1|2500971_2502345_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|2502520_2503519_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_169063562.1|2503551_2504547_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001297255.1|2504533_2505556_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000210557.1|2505569_2507072_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265933.1|2507211_2508168_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|2508477_2509008_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_001219160.1|2509387_2509729_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_021538237.1|2509731_2513511_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269314.1|2513507_2515241_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001305659.1|2515447_2516086_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|2516408_2517752_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|2517813_2518020_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175286.1|2518344_2518902_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|2518891_2519632_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_169063563.1|2519821_2521765_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001298029.1|2521887_2522268_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021520441.1|2522356_2523217_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001304672.1|2523324_2524290_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|2524397_2525060_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|2525104_2526517_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_021538235.1|2526825_2527446_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|2527664_2528303_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_063070067.1|2528437_2529646_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_044804197.1|2529653_2530079_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.7	1.6e-42
WP_001350063.1|2530701_2531496_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|2531566_2532016_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|2532057_2532285_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|2532289_2532604_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|2532610_2533006_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|2533333_2533609_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
2533352:2533366	attL	GCCCTTCTGGCTGTG	NA	NA	NA	NA
WP_001170781.1|2533737_2534424_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_042043470.1|2534423_2535239_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001131670.1|2535413_2536595_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	47.9	2.2e-97
WP_000621911.1|2536877_2537507_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000089291.1|2537506_2539048_+	MASE1 domain-containing protein	NA	NA	NA	NA	NA
WP_012601866.1|2539120_2540437_+	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
2540132:2540146	attR	GCCCTTCTGGCTGTG	NA	NA	NA	NA
WP_000783757.1|2540433_2541465_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001545795.1|2541533_2543612_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_001545794.1|2543623_2544670_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	1.4e-34
WP_168728585.1|2545475_2545664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001545792.1|2545991_2546186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016244173.1|2547963_2548182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016244174.1|2549634_2551725_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001363144.1|2552586_2552829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000751583.1|2552924_2553116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169063564.1|2553127_2553496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001622039.1|2553499_2553715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322949.1|2554267_2554696_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109148.1|2554735_2555296_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|2555337_2555598_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|2557423_2557537_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_164906752.1|2557627_2558840_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	2.4e-163
>prophage 183
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2569381	2579387	5053537	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_000080195.1|2569381_2570995_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2571025_2571376_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2571372_2571798_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_021523674.1|2574606_2574957_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	3.2e-36
WP_000435656.1|2574953_2575379_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.8e-33
WP_021538225.1|2576039_2576957_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_021523676.1|2576990_2577866_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_021538226.1|2577914_2579387_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.9e-06
>prophage 184
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2583953	2584940	5053537		Enterobacteria_phage(100.0%)	1	NA	NA
WP_021523681.1|2583953_2584940_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	58.7	4.0e-108
>prophage 185
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2595321	2654975	5053537	protease,tRNA,transposase	Escherichia_phage(12.5%)	55	NA	NA
WP_001034089.1|2595321_2599209_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	8.8e-228
WP_000291745.1|2599255_2599837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435656.1|2600091_2600517_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.8e-33
WP_021523674.1|2600513_2600864_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	3.2e-36
WP_016232313.1|2603740_2604124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323403.1|2604322_2605102_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|2605101_2606124_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_016244178.1|2606453_2607053_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_164881388.1|2607289_2608518_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	93.7	1.8e-166
WP_016244179.1|2609672_2610464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000188790.1|2610845_2611052_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016244180.1|2611137_2611710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296390.1|2611831_2613322_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_169063565.1|2614532_2615405_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_172885492.1|2615737_2618860_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_021537909.1|2618980_2621497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581506.1|2621572_2622028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016244184.1|2622437_2623259_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	2.3e-45
WP_000855059.1|2623599_2624073_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_158302277.1|2624088_2624565_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000692345.1|2624627_2624849_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086755.1|2624867_2625512_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.0	5.2e-24
WP_001285599.1|2625561_2625942_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854689.1|2626018_2626396_+	toxin	NA	NA	NA	NA	NA
WP_001530850.1|2626392_2626881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839236.1|2626892_2627090_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001545729.1|2627203_2628022_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000056749.1|2628293_2628944_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|2628957_2629422_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|2629431_2629737_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000404886.1|2629752_2631150_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001350385.1|2631504_2632569_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|2632676_2633432_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_021523668.1|2633428_2634178_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|2634359_2634689_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|2634837_2635113_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_021523667.1|2635229_2636855_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001683485.1|2636938_2638102_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	6.4e-81
WP_000101642.1|2638104_2638743_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547765.1|2638752_2639151_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012532.1|2639168_2639828_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511942.1|2639877_2640576_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_169063567.1|2640594_2640996_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|2641122_2641854_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_021523666.1|2641944_2644386_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
WP_001177639.1|2644424_2644850_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2645054_2646353_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2646456_2646654_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2646735_2647740_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001683484.1|2647742_2649002_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460357.1|2649087_2650368_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2650443_2650752_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280359.1|2650837_2651788_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001298688.1|2651780_2653628_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_000990304.1|2653637_2654975_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	3.3e-17
>prophage 186
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2658890	2659436	5053537		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_021523665.1|2658890_2659436_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.7e-28
>prophage 187
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2667432	2668410	5053537		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2667432_2668410_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 188
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2673330	2673864	5053537		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|2673330_2673864_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 189
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2678068	2680052	5053537		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2678068_2679715_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2679758_2680052_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 190
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2688386	2689652	5053537	integrase	Enterobacteria_phage(100.0%)	1	2678654:2678667	2691414:2691427
2678654:2678667	attL	TTCAATCTGCTGAC	NA	NA	NA	NA
WP_021538220.1|2688386_2689652_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_021538220.1|2688386_2689652_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
2691414:2691427	attR	GTCAGCAGATTGAA	NA	NA	NA	NA
>prophage 191
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2696267	2697197	5053537		Virus_Rctr41k(100.0%)	1	NA	NA
WP_001328257.1|2696267_2697197_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	38.1	1.4e-51
>prophage 192
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2701754	2704664	5053537	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
WP_000163269.1|2701754_2702081_+|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	96.3	3.5e-53
WP_021538669.1|2702080_2702248_+	hypothetical protein	NA	Q6H9S3	Enterobacteria_phage	91.7	1.3e-19
WP_001393664.1|2702267_2702549_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	8.5e-32
WP_001189111.1|2703155_2704664_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 193
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2708998	2712385	5053537	holin	Serratia_phage(100.0%)	1	NA	NA
WP_000035053.1|2708998_2712385_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 194
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2718257	2718836	5053537		Moraxella_phage(100.0%)	1	NA	NA
WP_000926370.1|2718257_2718836_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.1	7.7e-11
>prophage 195
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2739621	2741793	5053537		Yersinia_phage(33.33%)	4	NA	NA
WP_001234693.1|2739621_2740440_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	1.6e-46
WP_021538211.1|2740531_2741017_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	3.1e-13
WP_158302277.1|2741032_2741509_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000692345.1|2741571_2741793_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 196
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2750596	2753808	5053537	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856826.1|2750596_2752054_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
WP_169063571.1|2752290_2753808_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 197
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2773371	2774874	5053537		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|2773371_2774874_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 198
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2779714	2780503	5053537		Pithovirus(100.0%)	1	NA	NA
WP_001193414.1|2779714_2780503_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.1e-12
>prophage 199
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2786107	2787657	5053537		Bacillus_virus(50.0%)	2	NA	NA
WP_001075531.1|2786107_2786866_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
WP_000611415.1|2786976_2787657_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
>prophage 200
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2793779	2800148	5053537		Staphylococcus_phage(50.0%)	5	NA	NA
WP_021516676.1|2793779_2795312_+	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	6.3e-20
WP_021523655.1|2795290_2796271_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_001314355.1|2796281_2796977_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001171676.1|2796960_2797890_+	allose kinase	NA	NA	NA	NA	NA
WP_021523654.1|2798162_2800148_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	1.1e-149
>prophage 201
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2805393	2807541	5053537		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|2805393_2807541_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 202
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2811458	2812986	5053537		Planktothrix_phage(100.0%)	2	NA	NA
WP_000132446.1|2811458_2812295_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
WP_000156927.1|2812281_2812986_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.6e-21
>prophage 203
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2822469	2824428	5053537		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078223.1|2822469_2824428_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	1.6e-89
>prophage 204
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2830554	2831904	5053537		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|2830554_2831904_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 205
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2835722	2839336	5053537		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2835722_2836259_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357763.1|2836513_2839336_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 206
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2849279	2850698	5053537		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_021523645.1|2849279_2850698_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	4.3e-39
>prophage 207
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2856268	2858816	5053537		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147347.1|2856268_2857348_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_001296639.1|2857400_2858816_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
>prophage 208
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2871111	2871720	5053537		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2871111_2871720_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 209
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2879071	2880187	5053537		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2879071_2880187_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 210
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2904527	2908211	5053537		Dickeya_phage(100.0%)	1	NA	NA
WP_000096035.1|2904527_2908211_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 211
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2921908	2923498	5053537		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_021523712.1|2921908_2923498_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 212
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2928860	2930624	5053537		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2928860_2929133_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000941119.1|2929319_2929910_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|2929952_2930624_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 213
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2938920	2947249	5053537		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2938920_2943144_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2943220_2947249_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 214
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2951244	2954297	5053537		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2951244_2952429_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2953346_2954297_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 215
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2962638	2968460	5053537	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
WP_021523634.1|2962638_2964522_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	26.0	4.4e-07
WP_021523633.1|2964890_2965991_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|2966030_2966390_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_122083113.1|2966389_2967040_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_100273027.1|2967143_2968460_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.2	2.3e-58
>prophage 216
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2973900	2975115	5053537		Oenococcus_phage(100.0%)	1	NA	NA
WP_000691039.1|2973900_2975115_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.1	7.7e-45
>prophage 217
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	2987259	2994506	5053537		Serratia_phage(33.33%)	5	NA	NA
WP_000184858.1|2987259_2989557_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2989607_2989928_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004469.1|2989942_2991022_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001185150.1|2991330_2993832_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424857.1|2993843_2994506_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
>prophage 218
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3001318	3005912	5053537		Pandoravirus(100.0%)	3	NA	NA
WP_169063576.1|3001318_3002872_-	5'-nucleotidase C-terminal domain-containing protein	NA	A0A0B5J7T1	Pandoravirus	24.2	3.0e-09
WP_000105536.1|3003004_3004129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021523631.1|3004361_3005912_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	3.4e-05
>prophage 219
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3019122	3023625	5053537		Erwinia_phage(50.0%)	5	NA	NA
WP_001293344.1|3019122_3020454_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001305044.1|3020520_3021447_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|3021539_3022025_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|3022109_3022355_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|3022779_3023625_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 220
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3035235	3040095	5053537		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033719.1|3035235_3035934_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|3035930_3037304_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_021523624.1|3037408_3038083_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_021523623.1|3038231_3039215_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001350871.1|3039474_3040095_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	2.4e-63
>prophage 221
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3050880	3053931	5053537		Escherichia_phage(100.0%)	1	NA	NA
WP_077627280.1|3050880_3053931_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 222
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3062665	3065445	5053537		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|3062665_3063451_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621626.1|3063484_3064381_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718885.1|3064548_3065445_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 223
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3079168	3081639	5053537		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_169063578.1|3079168_3080218_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.9e-07
WP_001315107.1|3080229_3081639_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 224
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3085760	3088547	5053537		uncultured_virus(100.0%)	1	NA	NA
WP_000249991.1|3085760_3088547_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 225
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3102237	3102852	5053537		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|3102237_3102852_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 226
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3111733	3115020	5053537		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109949.1|3111733_3112510_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459601.1|3112512_3113028_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|3113031_3113301_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187545.1|3113379_3115020_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
>prophage 227
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3137014	3138523	5053537		Vibrio_phage(100.0%)	1	NA	NA
WP_000037973.1|3137014_3138523_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 228
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3148983	3150813	5053537		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3148983_3150813_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 229
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3158183	3166790	5053537		Bacillus_phage(50.0%)	8	NA	NA
WP_000383407.1|3158183_3160346_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213586.1|3160429_3161146_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_021523607.1|3161145_3162042_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.3	3.2e-24
WP_000812802.1|3162038_3162746_-	DUF484 domain-containing protein	NA	NA	NA	NA	NA
WP_001160656.1|3162742_3163567_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000799889.1|3163603_3163807_-	lipoprotein	NA	NA	NA	NA	NA
WP_021513889.1|3163995_3165474_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.1	1.1e-42
WP_021523606.1|3165470_3166790_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	47.4	8.7e-10
>prophage 230
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3174949	3176605	5053537		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395835.1|3174949_3176605_+	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 231
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3184612	3190756	5053537		Enterobacteria_phage(40.0%)	6	NA	NA
WP_169063579.1|3184612_3185743_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145189.1|3185747_3186422_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|3186399_3187281_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_021523604.1|3187299_3188367_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.0e-101
WP_000006614.1|3188366_3189629_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	7.7e-24
WP_021523603.1|3189625_3190756_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	5.1e-27
>prophage 232
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3194798	3200212	5053537		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|3194798_3195128_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|3195258_3196524_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_000535977.1|3196659_3198144_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|3198190_3200212_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 233
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3207809	3209456	5053537		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012591.1|3207809_3209456_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	3.7e-66
>prophage 234
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3222848	3228701	5053537		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001297966.1|3222848_3223739_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.8	9.7e-05
WP_000211858.1|3223763_3224729_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387779.1|3224733_3226239_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_001346607.1|3226246_3226666_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|3226832_3228701_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 235
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3231869	3232862	5053537		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|3231869_3232862_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 236
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3244816	3252331	5053537		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_000933730.1|3244816_3246187_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334086.1|3246347_3248177_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000867146.1|3248490_3249531_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|3249617_3250577_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251985.1|3250576_3251467_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|3251557_3252331_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 237
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3262702	3264040	5053537		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|3262702_3264040_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 238
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3274238	3281607	5053537		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|3274238_3274496_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3274459_3274819_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3274835_3274976_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_122134670.1|3275205_3275286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000059111.1|3275582_3276986_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3276990_3278091_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_169063580.1|3278090_3279164_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_001298010.1|3279192_3281607_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.8e-115
>prophage 239
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3286312	3287461	5053537		Oenococcus_phage(100.0%)	1	NA	NA
WP_021524634.1|3286312_3287461_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.5	1.8e-51
>prophage 240
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3291890	3303768	5053537		Cyanophage(16.67%)	12	NA	NA
WP_001243437.1|3291890_3292304_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3292415_3292844_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001279773.1|3293040_3294702_+	putative transporter	NA	NA	NA	NA	NA
WP_021524633.1|3294791_3295658_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021535997.1|3295824_3297540_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	1.2e-40
WP_021524631.1|3297536_3299030_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.6	1.1e-29
WP_000703959.1|3299089_3299437_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3299426_3299789_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148034.1|3299785_3300283_+	radical SAM protein	NA	NA	NA	NA	NA
WP_169063581.1|3300290_3301475_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.2	6.8e-14
WP_001312198.1|3301875_3301974_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168476.1|3302079_3303768_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 241
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3311072	3312407	5053537		Moraxella_phage(100.0%)	1	NA	NA
WP_001467796.1|3311072_3312407_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 242
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3317857	3318895	5053537		Wolbachia_phage(100.0%)	1	NA	NA
WP_001280586.1|3317857_3318895_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 243
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3332156	3333548	5053537		environmental_Halophage(100.0%)	1	NA	NA
WP_021524616.1|3332156_3333548_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	99.3	1.6e-70
>prophage 244
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3337849	3344600	5053537		Bordetella_phage(25.0%)	6	NA	NA
WP_000280473.1|3337849_3339958_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3339976_3340252_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3340306_3340930_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_021535996.1|3341187_3342870_+	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	22.8	3.3e-22
WP_000924289.1|3342866_3343484_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297973.1|3343775_3344600_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.5	1.3e-91
>prophage 245
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3347974	3352537	5053537		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|3347974_3348433_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050139.1|3348410_3349631_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001321683.1|3349802_3350471_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|3350687_3350924_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3350944_3351112_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114542.1|3351209_3352019_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	5.9e-25
WP_001171873.1|3352057_3352537_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 246
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3359975	3362069	5053537		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364803.1|3359975_3361004_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	5.5e-12
WP_000064025.1|3361085_3362069_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-12
>prophage 247
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3365477	3374983	5053537		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587750.1|3365477_3366410_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213845.1|3366623_3367820_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	4.9e-36
WP_000646018.1|3367829_3368855_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982125.1|3369093_3370128_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_001765163.1|3370114_3371074_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214150.1|3371077_3372361_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|3372370_3373915_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|3374159_3374591_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|3374731_3374983_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 248
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3397828	3402442	5053537		Tupanvirus(50.0%)	3	NA	NA
WP_000582430.1|3397828_3399673_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
WP_000741500.1|3399863_3401015_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_016233639.1|3401146_3402442_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
>prophage 249
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3422016	3423558	5053537		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146502.1|3422016_3423558_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 250
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3428875	3429871	5053537		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_169063583.1|3428875_3429871_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.0e-11
>prophage 251
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3434101	3434314	5053537		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3434101_3434314_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 252
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3437968	3440302	5053537		Escherichia_phage(100.0%)	1	NA	NA
WP_021524601.1|3437968_3440302_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	3.1e-71
>prophage 253
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3456032	3458017	5053537		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196477.1|3456032_3457016_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
WP_000103579.1|3457012_3458017_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 254
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3503818	3505288	5053537		Bacillus_virus(50.0%)	2	NA	NA
WP_000123131.1|3503818_3504466_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
WP_000622316.1|3504517_3505288_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
>prophage 255
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3515959	3521368	5053537		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000065791.1|3515959_3516385_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001295215.1|3516719_3516803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160795.1|3516856_3518209_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_000954225.1|3518280_3519123_-	23S rRNA (adenine(2030)-N(6))-methyltransferase	NA	NA	NA	NA	NA
WP_100273016.1|3519325_3521368_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.4	3.1e-46
>prophage 256
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3531053	3536135	5053537		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000149180.1|3531053_3533789_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_021524587.1|3533788_3534913_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001190062.1|3534921_3535323_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_021524586.1|3535328_3536135_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
>prophage 257
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3544028	3554129	5053537		Dickeya_phage(33.33%)	11	NA	NA
WP_001100463.1|3544028_3544694_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
WP_000130621.1|3544914_3545160_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_021524583.1|3545420_3547619_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	6.5e-119
WP_000964718.1|3547692_3548319_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_021524582.1|3548459_3548819_+	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
WP_001295207.1|3548821_3549091_-	DUF1145 family protein	NA	NA	NA	NA	NA
WP_000743193.1|3549080_3549677_-	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
WP_021524581.1|3549826_3551308_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000617723.1|3551310_3551979_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|3551971_3553030_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3553274_3554129_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 258
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3559851	3561334	5053537		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3559851_3560619_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_097747543.1|3560620_3561334_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	5.4e-14
>prophage 259
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3564875	3566686	5053537		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907827.1|3564875_3565946_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073603.1|3565942_3566686_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.4e-11
>prophage 260
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3586556	3589004	5053537		Dickeya_phage(100.0%)	1	NA	NA
WP_000993444.1|3586556_3589004_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 261
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3604416	3605643	5053537		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105470.1|3604416_3605643_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 262
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3610033	3612427	5053537		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_021513836.1|3610033_3612427_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 263
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3618656	3619550	5053537		Sodalis_phage(100.0%)	1	NA	NA
WP_021524569.1|3618656_3619550_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	4.3e-69
>prophage 264
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3626123	3629890	5053537		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3626123_3626843_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253708.1|3626839_3628192_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|3628267_3629890_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 265
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3646868	3647705	5053537		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|3646868_3647705_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 266
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3666623	3676163	5053537		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601853.1|3666623_3667187_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
WP_021524561.1|3667272_3668496_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001304921.1|3668558_3670649_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000242755.1|3670699_3671332_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3671633_3672038_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274684.1|3672092_3672962_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3673015_3673234_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057415.1|3673227_3674250_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|3674249_3676163_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 267
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3681733	3690300	5053537		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_001209693.1|3681733_3682120_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
WP_000820731.1|3682119_3682479_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903382.1|3682485_3682773_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3682898_3683273_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3683369_3683840_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3683936_3686051_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3686121_3687306_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_021538187.1|3687597_3690300_+	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-40
>prophage 268
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3699130	3701083	5053537		Vibrio_phage(100.0%)	1	NA	NA
WP_001525807.1|3699130_3701083_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 269
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3722307	3808408	5053537	protease,head,tRNA,terminase,portal,integrase,tail,capsid	uncultured_Caudovirales_phage(58.62%)	87	3745888:3745911	3761225:3761248
WP_000004421.1|3722307_3723255_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|3723269_3723779_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000228517.1|3723908_3725033_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460672.1|3725004_3725478_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001312137.1|3725506_3726049_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_001297709.1|3726053_3726626_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_000451230.1|3726630_3727449_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001070567.1|3727445_3727703_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001286216.1|3727678_3728233_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_021535983.1|3734115_3734874_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	2.6e-19
WP_001350444.1|3734881_3735985_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001350445.1|3735994_3737176_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738577.1|3737243_3738269_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
WP_000825647.1|3738699_3738921_-	membrane protein	NA	NA	NA	NA	NA
WP_021538185.1|3739173_3742278_-	multidrug efflux RND transporter permease subunit AcrF	NA	NA	NA	NA	NA
WP_000160363.1|3742289_3743447_-	multidrug efflux RND transporter periplasmic adaptor subunit AcrE	NA	NA	NA	NA	NA
WP_001129503.1|3743845_3744508_+	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_001527795.1|3744510_3744690_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001258951.1|3744773_3745658_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
3745888:3745911	attL	TGTGCAGTCAGTGGTGCAGTCAGT	NA	NA	NA	NA
WP_169063585.1|3745935_3747159_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	99.3	6.4e-241
WP_169063480.1|3747155_3747968_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	98.9	2.2e-152
WP_032669068.1|3748062_3748272_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	98.6	2.8e-32
WP_169063586.1|3748644_3748830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169063587.1|3749023_3749236_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_169063588.1|3749228_3749414_+	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	83.6	1.9e-19
WP_058677716.1|3749406_3749634_+	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	85.1	3.3e-26
WP_014072026.1|3749630_3749999_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	98.4	1.8e-61
WP_169063589.1|3749995_3751360_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	96.5	3.8e-258
WP_169063590.1|3751576_3751825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047344595.1|3751834_3752080_+	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	44.7	8.8e-09
WP_169063591.1|3752299_3753466_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.2	9.8e-215
WP_019077813.1|3753517_3754078_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.9	3.5e-101
WP_169063592.1|3754079_3755315_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.8	1.9e-237
WP_169063593.1|3755311_3755650_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	96.4	1.2e-56
WP_045341406.1|3755646_3755940_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	97.9	3.6e-49
WP_169063594.1|3755939_3756383_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	96.6	9.8e-83
WP_169063595.1|3756375_3756528_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	98.0	8.9e-20
WP_000113647.1|3756658_3757015_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_169063596.1|3756998_3758660_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.8	0.0e+00
WP_047959566.1|3758673_3759288_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	69.2	3.6e-67
WP_047959861.1|3759296_3759635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131798041.1|3759685_3760021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014072012.1|3760087_3760342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047959565.1|3760381_3761146_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_000462905.1|3761314_3761611_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
3761225:3761248	attR	TGTGCAGTCAGTGGTGCAGTCAGT	NA	NA	NA	NA
WP_001219652.1|3761636_3762602_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_001145827.1|3762930_3763812_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001175716.1|3763823_3765275_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_000381175.1|3765264_3765507_-	YhdT family protein	NA	NA	NA	NA	NA
WP_001296457.1|3765598_3766534_-	sugar kinase	NA	NA	NA	NA	NA
WP_050517944.1|3766565_3767396_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	9.3e-10
WP_000275538.1|3767737_3768592_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_001298583.1|3768627_3769518_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000132912.1|3769578_3771078_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
WP_000137052.1|3771078_3772068_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000048611.1|3772089_3773052_+	sugar kinase	NA	NA	NA	NA	NA
WP_021524552.1|3773048_3774095_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000884645.1|3774186_3775536_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000354622.1|3775546_3776017_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_001148484.1|3776996_3777971_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001241477.1|3778122_3780063_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_000913396.1|3780367_3781411_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_000802518.1|3781476_3782580_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000179409.1|3782579_3783068_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000203095.1|3783076_3783670_+	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000123197.1|3783659_3785129_+	ribonuclease G	NA	NA	NA	NA	NA
WP_001253536.1|3785196_3788997_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000055909.1|3789152_3790598_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_000440317.1|3790725_3791655_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000051841.1|3791837_3792041_+	AaeX family protein	NA	NA	NA	NA	NA
WP_000854033.1|3792048_3792981_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_021524550.1|3792986_3794954_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_021524549.1|3795045_3795318_+	barstar family protein	NA	NA	NA	NA	NA
WP_000695690.1|3795372_3795636_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001257847.1|3795999_3796470_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_001295272.1|3796904_3797843_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000497726.1|3797905_3798973_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_001298588.1|3799062_3800430_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
WP_001295270.1|3800583_3800982_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_021524548.1|3801175_3802303_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_000847559.1|3802522_3802951_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|3802966_3803359_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000257293.1|3803753_3804392_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000366127.1|3804397_3804895_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
WP_000074795.1|3805002_3805794_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000224704.1|3805915_3806809_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000108476.1|3806917_3808408_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 270
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3817111	3831905	5053537		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001296449.1|3817111_3818041_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809764.1|3818136_3820473_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	9.9e-41
WP_000719791.1|3820702_3821356_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047069.1|3821352_3822081_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|3822077_3822710_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3822922_3823195_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3823191_3824046_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183674.1|3824091_3824583_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3824700_3824988_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_021524545.1|3825010_3826444_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3826491_3827217_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3827223_3827781_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3827749_3828325_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|3828321_3828888_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|3828908_3829895_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922880.1|3829908_3830886_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3831095_3831905_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 271
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3835973	3837458	5053537		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3835973_3836252_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|3836486_3837458_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 272
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3844087	3846960	5053537	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3844087_3846022_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764750.1|3846111_3846960_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	2.6e-23
>prophage 273
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3851040	3857679	5053537		Dickeya_phage(50.0%)	4	NA	NA
WP_000207680.1|3851040_3852384_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3853014_3853467_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|3853494_3854982_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133040.1|3855006_3857679_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
>prophage 274
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3863160	3865050	5053537		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3863160_3865050_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 275
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3870752	3878548	5053537		Peridroma_alphabaculovirus(25.0%)	10	NA	NA
WP_000189321.1|3870752_3871055_-	DNA damage response exodeoxyribonuclease YhbQ	NA	A0A068LKN9	Peridroma_alphabaculovirus	55.4	3.0e-14
WP_000449450.1|3871105_3871549_+	YhbP family protein	NA	NA	NA	NA	NA
WP_001350449.1|3871528_3872047_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001346704.1|3872174_3872810_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147603.1|3872882_3873923_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|3874035_3874611_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|3874620_3875211_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246829.1|3875230_3875626_-	YraN family protein	NA	NA	NA	NA	NA
WP_021524542.1|3875583_3877620_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809265.1|3877684_3878548_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 276
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3895232	3896378	5053537		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296434.1|3895232_3896378_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 277
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3902531	3904826	5053537		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861710.1|3902531_3904826_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 278
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3924710	3925676	5053537		Escherichia_phage(100.0%)	1	NA	NA
WP_001098826.1|3924710_3925676_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 279
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3938007	3954076	5053537	tRNA	Herpes_simplex_virus(16.67%)	11	NA	NA
WP_021538166.1|3938007_3941100_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	1.4e-156
WP_000212447.1|3941283_3942267_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450588.1|3942485_3942818_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001297164.1|3942859_3944239_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_021524532.1|3944656_3946177_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_001468201.1|3946205_3946829_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001468200.1|3947116_3947881_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000437380.1|3948718_3950560_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_021521058.1|3950754_3952500_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.9e-76
WP_001144069.1|3952609_3952825_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001539750.1|3953062_3954076_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 280
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3960484	3961723	5053537	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_021524530.1|3960484_3961723_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 281
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3966860	3968294	5053537		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|3966860_3968294_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 282
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3972207	3972861	5053537		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|3972207_3972861_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 283
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3984094	3985932	5053537		Ralstonia_phage(50.0%)	2	NA	NA
WP_000442860.1|3984094_3985255_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3985260_3985932_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
>prophage 284
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	3990279	3996540	5053537		Bacillus_virus(33.33%)	4	NA	NA
WP_000195274.1|3990279_3992172_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
WP_021524522.1|3992235_3994377_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_021524521.1|3994750_3995560_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	9.4e-15
WP_000986428.1|3995556_3996540_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
>prophage 285
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4004381	4009421	5053537		Stx_converting_phage(50.0%)	4	NA	NA
WP_000712658.1|4004381_4004774_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_021538160.1|4004826_4005309_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_001468194.1|4005417_4007025_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001281888.1|4007162_4009421_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
>prophage 286
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4016879	4024198	5053537		Ostreococcus_tauri_virus(33.33%)	6	NA	NA
WP_001546134.1|4016879_4018352_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.7	7.6e-47
WP_169063601.1|4018674_4019424_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_000095216.1|4019675_4021895_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848521.1|4021936_4022194_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_001546133.1|4022244_4023171_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013141.1|4023370_4024198_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	3.6e-62
>prophage 287
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4030041	4030926	5053537		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_100273075.1|4030041_4030926_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.8	1.1e-64
>prophage 288
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4053150	4054323	5053537		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_021538158.1|4053150_4054323_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 289
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4085358	4090096	5053537	transposase	Stx2-converting_phage(50.0%)	5	NA	NA
WP_000422741.1|4085358_4085784_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4085780_4086131_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|4086161_4087775_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000124301.1|4088663_4089440_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000590258.1|4089436_4090096_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	9.0e-08
>prophage 290
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4103682	4104666	5053537		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001331698.1|4103682_4104666_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 291
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4110190	4112360	5053537		Klebsiella_phage(33.33%)	4	NA	NA
WP_021524511.1|4110190_4110412_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001537421.1|4110474_4110951_-	RadC family protein	NA	NA	NA	NA	NA
WP_021538151.1|4110965_4111451_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.8e-13
WP_021538150.1|4111541_4112360_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	2.5e-47
>prophage 292
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4141161	4142424	5053537	integrase	Pseudomonas_phage(100.0%)	1	4139948:4139961	4151395:4151408
4139948:4139961	attL	CTGGGGCCAGCAAA	NA	NA	NA	NA
WP_021519596.1|4141161_4142424_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	5.8e-80
WP_021519596.1|4141161_4142424_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	5.8e-80
4151395:4151408	attR	CTGGGGCCAGCAAA	NA	NA	NA	NA
>prophage 293
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4165119	4166274	5053537		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|4165119_4166274_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 294
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4174427	4175336	5053537		Yersinia_phage(100.0%)	1	NA	NA
WP_000646942.1|4174427_4175336_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 295
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4180388	4181066	5053537		Bacillus_virus(100.0%)	1	NA	NA
WP_001546257.1|4180388_4181066_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.7	2.9e-09
>prophage 296
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4194599	4195832	5053537		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4194599_4195832_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 297
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4203967	4208440	5053537		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000195072.1|4203967_4206841_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	8.2e-263
WP_001350137.1|4207006_4208440_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	1.5e-31
>prophage 298
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4212245	4227637	5053537	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|4212245_4213142_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715230.1|4213166_4213877_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_169063607.1|4213882_4215616_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	8.3e-61
WP_001701073.1|4215706_4216804_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|4216814_4218332_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001683257.1|4218374_4218923_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|4218977_4219049_+	protein YqfH	NA	NA	NA	NA	NA
WP_001050745.1|4219045_4219171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001363024.1|4219172_4220621_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	27.0	4.3e-26
WP_021524488.1|4221056_4222976_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838415.1|4222975_4223464_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_021524487.1|4223499_4224867_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	5.6e-161
WP_001295158.1|4224902_4226219_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|4226236_4227637_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 299
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4251916	4252672	5053537		Clostridium_phage(100.0%)	1	NA	NA
WP_169063609.1|4251916_4252672_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	2.4e-12
>prophage 300
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4256957	4259452	5053537		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000602503.1|4256957_4257719_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.8e-20
WP_000256426.1|4258033_4259452_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 301
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4269083	4275856	5053537		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|4269083_4269797_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082183.1|4269865_4270555_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|4271239_4271770_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_021524480.1|4271782_4274029_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4274179_4275055_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4275061_4275856_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 302
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4281333	4297948	5053537		Klosneuvirus(14.29%)	10	NA	NA
WP_021535951.1|4281333_4284222_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	9.0e-68
WP_021524476.1|4284214_4287757_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_021524475.1|4287756_4289583_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	2.7e-25
WP_001765039.1|4289644_4290976_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_021524474.1|4291207_4292461_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_021524473.1|4292718_4293543_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000810553.1|4293574_4295155_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	4.5e-05
WP_000382413.1|4295154_4296330_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_001066237.1|4296332_4296929_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
WP_021524472.1|4297000_4297948_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	9.0e-17
>prophage 303
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4311548	4311812	5053537		Burkholderia_virus(100.0%)	1	NA	NA
WP_164906749.1|4311548_4311812_-	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	38.5	2.6e-06
>prophage 304
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4316055	4321193	5053537		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_021538123.1|4316055_4318536_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.9	3.2e-05
WP_000147358.1|4318547_4321193_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.3	1.9e-96
>prophage 305
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4330023	4332529	5053537	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_000117716.1|4330023_4330830_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
WP_000184272.1|4330880_4331324_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001338000.1|4331323_4332529_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	2.7e-74
>prophage 306
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4344105	4344861	5053537		Bacillus_phage(100.0%)	1	NA	NA
WP_001314086.1|4344105_4344861_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 307
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4349719	4350568	5053537		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|4349719_4350568_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 308
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4358100	4362215	5053537		Hokovirus(50.0%)	2	NA	NA
WP_000186431.1|4358100_4360857_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.9e-54
WP_000046816.1|4360913_4362215_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	1.1e-38
>prophage 309
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4366248	4369272	5053537		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_000210878.1|4366248_4367886_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|4367973_4369272_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
>prophage 310
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4373060	4373732	5053537		Vibrio_phage(100.0%)	1	NA	NA
WP_001199974.1|4373060_4373732_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
>prophage 311
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4377245	4378031	5053537		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021342.1|4377245_4378031_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 312
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4392669	4394702	5053537		Hokovirus(50.0%)	2	NA	NA
WP_001090357.1|4392669_4394097_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	1.3e-30
WP_001173653.1|4394096_4394702_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
>prophage 313
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4397813	4401529	5053537		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_016247751.1|4397813_4398575_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	1.3e-58
WP_000254708.1|4398568_4399195_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|4399334_4400474_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4400536_4401529_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 314
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4405902	4413042	5053537		Escherichia_phage(83.33%)	6	NA	NA
WP_021538119.1|4405902_4406541_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
WP_169063612.1|4406537_4407800_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	4.9e-135
WP_000847998.1|4407796_4408705_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_001296319.1|4408900_4409668_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141289.1|4409718_4410375_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_000103863.1|4410480_4413042_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 315
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4438042	4439008	5053537		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287404.1|4438042_4439008_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 316
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4444476	4449863	5053537	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|4444476_4444974_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|4445053_4446115_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|4446183_4446684_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047171.1|4446812_4449443_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4449677_4449863_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 317
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4462521	4467819	5053537		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|4462521_4463724_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_021513762.1|4464080_4465040_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.1	1.6e-133
WP_001592545.1|4465049_4467194_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	4.9e-196
WP_000080947.1|4467166_4467577_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|4467573_4467819_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 318
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4473625	4477676	5053537		Clostridium_phage(50.0%)	4	NA	NA
WP_000522415.1|4473625_4474075_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156818.1|4474075_4474738_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001298180.1|4474758_4476159_-	GABA permease	NA	NA	NA	NA	NA
WP_001337980.1|4476395_4477676_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	4.9e-34
>prophage 319
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4482685	4483168	5053537		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|4482685_4483168_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 320
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4496800	4497871	5053537		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|4496800_4497871_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 321
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4503776	4506350	5053537		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4503776_4506350_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 322
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4514835	4516134	5053537		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841087.1|4514835_4516134_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	2.8e-45
>prophage 323
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4521427	4527510	5053537	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4521427_4521847_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_021524436.1|4522053_4523091_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|4523138_4523828_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|4524132_4524516_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_021524435.1|4524571_4525159_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001350886.1|4525261_4526143_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4526175_4527510_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 324
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4533281	4537018	5053537		Tupanvirus(50.0%)	3	NA	NA
WP_000790169.1|4533281_4535081_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4535096_4536071_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4536337_4537018_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 325
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4540477	4540738	5053537		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|4540477_4540738_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 326
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4544859	4556167	5053537		Bacillus_phage(50.0%)	7	NA	NA
WP_021524431.1|4544859_4548747_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	6.5e-130
WP_001297612.1|4549322_4550750_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215879.1|4550914_4551628_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|4551617_4552952_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4553012_4553351_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883120.1|4553395_4554586_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4554913_4556167_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 327
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4561925	4563437	5053537		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493464.1|4561925_4563437_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 328
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4573418	4579756	5053537		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4573418_4574633_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4574660_4575047_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4575063_4575387_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|4575482_4575998_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196626.1|4576014_4577865_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124471.1|4577866_4578202_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523612.1|4578213_4578414_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_021524424.1|4578472_4579756_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	1.7e-34
>prophage 329
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4589642	4590074	5053537		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|4589642_4590074_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 330
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4610554	4657577	5053537	integrase,terminase,tail,holin	Escherichia_phage(49.06%)	57	4615191:4615207	4655724:4655740
WP_000937952.1|4610554_4611931_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.7	8.1e-43
WP_001299507.1|4612092_4613559_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|4613627_4615205_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
4615191:4615207	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_000954555.1|4615397_4616648_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	3.0e-238
WP_001077943.1|4616651_4616846_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	96.9	2.8e-26
WP_169063617.1|4616842_4617493_-	adenine methylase	NA	G9L699	Escherichia_phage	98.1	8.1e-126
WP_001335975.1|4617485_4617737_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000675390.1|4617894_4618143_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_042115081.1|4618192_4619215_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	92.4	2.7e-176
WP_000985082.1|4619224_4620124_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	90.6	1.6e-156
WP_169063618.1|4620120_4620420_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	99.0	1.7e-46
WP_097465149.1|4620728_4621313_-	transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.0	6.0e-104
WP_001282459.1|4621467_4621698_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_023145217.1|4622039_4622864_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	97.8	2.5e-156
WP_033559269.1|4622835_4623612_+	replication protein	NA	G9L6A9	Escherichia_phage	99.6	1.0e-151
WP_001231262.1|4623729_4624074_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	99.1	1.3e-61
WP_042115083.1|4624135_4624552_+	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	54.6	2.5e-27
WP_000156548.1|4624548_4624863_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	86.9	1.6e-42
WP_000015508.1|4624840_4625065_+	hypothetical protein	NA	Q286X0	Escherichia_phage	98.6	2.7e-36
WP_169063619.1|4625061_4625586_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	70.9	1.2e-66
WP_000582234.1|4625587_4626343_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	93.2	1.1e-142
WP_001621582.1|4626353_4626722_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	77.4	2.9e-48
WP_000253289.1|4626721_4627006_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_000002109.1|4626998_4627280_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	100.0	6.9e-50
WP_169063620.1|4627272_4627611_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	97.3	2.7e-56
WP_001090120.1|4627651_4628326_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_000132534.1|4628322_4629798_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.6	5.8e-297
WP_021532118.1|4629888_4630260_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	97.6	1.2e-62
WP_000335899.1|4630967_4631174_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_169063621.1|4631188_4632868_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	98.7	4.4e-301
WP_000133160.1|4632864_4633161_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_001525342.1|4633163_4633859_+	hypothetical protein	NA	G9L6C4	Escherichia_phage	98.3	3.9e-94
WP_000268712.1|4633873_4634860_+	hypothetical protein	NA	A0A0F6TJQ9	Escherichia_coli_O157_typing_phage	100.0	1.5e-187
WP_169063622.1|4634911_4635349_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	97.9	1.2e-72
WP_169063623.1|4635359_4635695_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	2.9e-55
WP_169063624.1|4635745_4636069_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	97.2	7.7e-53
WP_000179260.1|4636068_4636674_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
WP_169063625.1|4636673_4639145_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
WP_000568023.1|4639144_4639609_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_000336180.1|4639608_4640148_+	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	81.8	1.6e-47
WP_001145637.1|4640160_4642674_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	89.6	0.0e+00
WP_169063626.1|4642670_4644473_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.2	0.0e+00
WP_001248446.1|4644478_4646953_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	98.9	0.0e+00
WP_001337645.1|4647136_4647553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169063627.1|4647655_4648291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137440957.1|4648411_4649131_-	ORF6N domain-containing protein	NA	G9L6E2	Escherichia_phage	85.4	1.2e-42
WP_001119419.1|4649123_4649630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001188252.1|4649944_4650202_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
WP_021537279.1|4650397_4653517_+|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	95.6	0.0e+00
WP_001276090.1|4653823_4654228_+	membrane protein	NA	G9L6E6	Escherichia_phage	94.8	7.4e-61
WP_000256103.1|4654214_4654523_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
WP_000403802.1|4654512_4655142_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	2.6e-113
WP_000604067.1|4655138_4655636_+	DUF2514 domain-containing protein	NA	A0A193GYU6	Enterobacter_phage	67.7	8.8e-48
WP_000755178.1|4655831_4656371_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
4655724:4655740	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_001295476.1|4656386_4656905_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000076001.1|4657215_4657407_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017553.1|4657424_4657577_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
>prophage 331
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4663824	4667826	5053537		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028626.1|4663824_4664463_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001296287.1|4664462_4665500_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
WP_001295473.1|4665824_4666451_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198327.1|4666536_4667826_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
>prophage 332
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4675305	4676019	5053537		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4675305_4676019_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 333
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4693260	4694211	5053537		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4693260_4694211_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 334
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4712965	4734693	5053537		Streptococcus_phage(25.0%)	22	NA	NA
WP_000102910.1|4712965_4713835_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_000406000.1|4714048_4714474_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001296281.1|4714460_4714910_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838953.1|4714970_4715546_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|4715641_4716541_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001040463.1|4716718_4718143_-	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001175632.1|4718146_4719043_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000517443.1|4719322_4720114_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_000290263.1|4720271_4721288_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458408.1|4721287_4722121_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|4722120_4722996_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021034.1|4722985_4724083_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000105467.1|4724217_4725129_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
WP_000719965.1|4725131_4725500_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096640.1|4725604_4726456_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4726498_4727008_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623142.1|4727048_4728776_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4728820_4729078_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4729461_4730433_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|4730617_4731379_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_100272986.1|4731608_4732607_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_021524401.1|4732677_4734693_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	1.0e-150
>prophage 335
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4760232	4760967	5053537		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4760232_4760967_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 336
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4764785	4765706	5053537		Morganella_phage(100.0%)	1	NA	NA
WP_000484017.1|4764785_4765706_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	1.7e-76
>prophage 337
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4769395	4776972	5053537		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283513.1|4769395_4771090_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	4.7e-24
WP_000955028.1|4771159_4772104_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001317966.1|4772177_4773323_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001331804.1|4773378_4776972_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 338
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4784901	4785834	5053537		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368123.1|4784901_4785834_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
>prophage 339
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4802257	4803343	5053537		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|4802257_4803343_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 340
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4811879	4813016	5053537		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699136.1|4811879_4813016_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
>prophage 341
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4819765	4821283	5053537		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|4819765_4821283_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 342
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4825494	4827354	5053537		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|4825494_4826268_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156131.1|4826463_4827354_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	53.1	4.0e-67
>prophage 343
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4837913	4841141	5053537		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203415.1|4837913_4838564_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
WP_001012899.1|4838650_4840483_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813854.1|4840541_4841141_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 344
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4876109	4881113	5053537		Tupanvirus(50.0%)	4	NA	NA
WP_021524378.1|4876109_4878092_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
WP_021524377.1|4878091_4879060_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	2.0e-35
WP_001467969.1|4879063_4880203_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.5	3.2e-29
WP_000879110.1|4880510_4881113_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
>prophage 345
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4884716	4889092	5053537	transposase	Oenococcus_phage(50.0%)	4	NA	NA
WP_001529341.1|4884716_4885922_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	7.1e-27
WP_021524375.1|4885978_4887268_+	MFS transporter	NA	NA	NA	NA	NA
WP_021524374.1|4887285_4888089_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_021524373.1|4888129_4889092_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.3	3.5e-69
>prophage 346
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4894985	4900829	5053537		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000779074.1|4894985_4896062_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
WP_000301031.1|4896264_4896915_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|4896968_4897223_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4897222_4898353_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075170.1|4898543_4900829_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
>prophage 347
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4906262	4908890	5053537		Bacillus_virus(100.0%)	1	NA	NA
WP_001281253.1|4906262_4908890_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 348
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4923744	4928587	5053537		Bacillus_phage(50.0%)	2	NA	NA
WP_021524368.1|4923744_4925571_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
WP_021524367.1|4925737_4928587_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	3.2e-41
>prophage 349
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4932864	4938666	5053537		Enterobacteria_phage(25.0%)	5	NA	NA
WP_001539019.1|4932864_4933992_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.9	3.2e-114
WP_021524366.1|4934103_4935159_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_169063635.1|4935232_4936297_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	2.4e-18
WP_000884929.1|4936296_4936947_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.7	8.3e-06
WP_000422211.1|4937022_4938666_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
>prophage 350
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4947434	4948052	5053537		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|4947434_4948052_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 351
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4958096	4965746	5053537		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|4958096_4959104_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494186.1|4959242_4959527_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578056.1|4959651_4961412_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	8.4e-101
WP_001234850.1|4961561_4962257_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213368.1|4962284_4963475_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|4963808_4964153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194893.1|4964156_4965746_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	1.9e-19
>prophage 352
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4971500	4975801	5053537		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4971500_4972067_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001445498.1|4972478_4973192_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_021524356.1|4973230_4974217_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_169063636.1|4974334_4975801_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.3e-43
>prophage 353
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4990326	4991184	5053537		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|4990326_4991184_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 354
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	4995252	4999038	5053537		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489277.1|4995252_4997244_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
WP_000425463.1|4997275_4998112_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|4998369_4999038_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 355
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	5002732	5004253	5053537		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|5002732_5004253_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 356
NZ_CP051700	Escherichia coli strain SCU-125 chromosome, complete genome	5053537	5024603	5052687	5053537	lysis,holin	Enterobacteria_phage(40.54%)	41	NA	NA
WP_021524345.1|5024603_5025530_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783150.1|5025534_5026266_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|5026246_5026354_-	protein YohO	NA	NA	NA	NA	NA
WP_028125877.1|5026413_5027115_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.9	6.7e-102
WP_000063648.1|5027135_5028422_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|5028441_5028696_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_021524344.1|5028714_5028849_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.2	1.2e-20
WP_000457723.1|5028852_5029095_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000628775.1|5029179_5029938_-	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.4	1.2e-109
WP_021524342.1|5030451_5031000_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	94.1	1.0e-57
WP_021524341.1|5030996_5031236_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	94.9	2.0e-34
WP_000111289.1|5031228_5031432_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_021524340.1|5031428_5031791_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	2.0e-65
WP_021524339.1|5031781_5032318_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	1.4e-99
WP_021524338.1|5032408_5033326_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	37.5	1.5e-48
WP_012599998.1|5034014_5034707_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	95.7	2.4e-120
WP_001191669.1|5034804_5035065_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000515850.1|5035057_5035615_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	96.8	1.1e-96
WP_021524337.1|5035611_5036760_+	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	85.6	9.7e-175
WP_000620688.1|5036756_5036981_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	90.5	1.9e-34
WP_000995577.1|5036977_5037277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021524336.1|5037273_5038257_+	hypothetical protein	NA	Q8SBF1	Shigella_phage	88.9	4.4e-51
WP_072259056.1|5038253_5038748_+	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	90.1	1.8e-77
WP_001409632.1|5038747_5039401_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.8e-126
WP_000210152.1|5039397_5039724_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.3e-52
WP_000767110.1|5039720_5040116_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|5040278_5041094_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_021524334.1|5041101_5042091_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	4.0e-193
WP_001204776.1|5042108_5042492_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_016234522.1|5042680_5043763_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	2.7e-166
WP_000271630.1|5045032_5045461_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000874509.1|5046059_5048021_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	3.3e-239
WP_001304601.1|5048157_5048340_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_001304600.1|5048377_5048623_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284510.1|5048699_5048915_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001092866.1|5049944_5050478_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_000675927.1|5050699_5050813_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	91.9	4.3e-11
WP_016234517.1|5050814_5051282_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	95.5	6.3e-72
WP_000828068.1|5051620_5051947_+	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_000095742.1|5052088_5052280_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	94.8	1.2e-24
WP_000829186.1|5052321_5052687_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	1.7e-61
>prophage 1
NZ_CP051701	Escherichia coli strain SCU-125 plasmid pSCU-125-1, complete sequence	120617	9300	17844	120617	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_000422741.1|9300_9726_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|9722_10073_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|10103_11717_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_001323403.1|12214_12994_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|12993_14016_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|15085_15433_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|15429_15834_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189111.1|16335_17844_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 2
NZ_CP051701	Escherichia coli strain SCU-125 plasmid pSCU-125-1, complete sequence	120617	107842	113258	120617	integrase	Escherichia_phage(33.33%)	8	106624:106636	113444:113456
106624:106636	attL	GCCAGTGCCCGCC	NA	NA	NA	NA
WP_000618110.1|107842_108091_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|108087_108525_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_021549745.1|108524_109796_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.2	2.7e-141
WP_000340835.1|109800_110193_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001103694.1|110197_111169_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|111397_112042_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|112035_112311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016979.1|112448_113258_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
113444:113456	attR	GGCGGGCACTGGC	NA	NA	NA	NA
>prophage 1
NZ_CP051702	Escherichia coli strain SCU-125 plasmid pSCU-125-2, complete sequence	93339	5825	16685	93339	transposase,integrase	Stx2-converting_phage(30.0%)	13	NA	NA
WP_000381395.1|5825_7397_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|7416_7764_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_059339860.1|7763_8441_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001245884.1|8846_9149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587689.1|9145_9772_-	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_001067838.1|10557_11262_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_000845048.1|11497_12511_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|12666_13140_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_000679427.1|13323_13671_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|13664_14504_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|14631_15132_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000109071.1|16002_16440_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|16436_16685_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
