The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051706	Escherichia coli strain SCU-124 chromosome, complete genome	4753517	1084920	1093670	4753517		Escherichia_phage(71.43%)	7	NA	NA
WP_001279001.1|1084920_1085559_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_000590411.1|1085555_1086818_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|1086814_1087723_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001296319.1|1087918_1088686_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|1088736_1089393_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001525481.1|1089498_1092066_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001525479.1|1092212_1093670_+	hypothetical protein	NA	A0A0R6PGY7	Moraxella_phage	28.1	5.8e-23
>prophage 2
NZ_CP051706	Escherichia coli strain SCU-124 chromosome, complete genome	4753517	1436292	1485940	4753517	lysis,integrase,portal,terminase,tail,head	Enterobacteria_phage(49.23%)	67	1445207:1445228	1484851:1484872
WP_169063466.1|1436292_1436379_+	hypothetical protein	NA	A0A2L1IV38	Escherichia_phage	100.0	3.0e-09
WP_169063414.1|1436451_1444197_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	94.2	0.0e+00
1445207:1445228	attL	TGATAAATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001163428.1|1445301_1445502_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545733.1|1445559_1445727_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_169063415.1|1445799_1446084_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	92.6	1.0e-45
WP_097345126.1|1446083_1446344_-	eaa protein	NA	A0A1B0V7L4	Salmonella_phage	95.3	4.6e-40
WP_169063416.1|1446340_1447009_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	35.7	1.3e-30
WP_001014294.1|1447011_1447203_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_169063417.1|1447204_1447690_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	85.2	1.2e-41
WP_001673392.1|1447686_1447920_-	hypothetical protein	NA	E9NIE8	Enterobacter_phage	41.0	5.1e-06
WP_169063467.1|1447916_1448246_-	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	95.3	3.0e-52
WP_001214456.1|1448266_1448431_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_023351790.1|1448427_1448709_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.7	1.8e-42
WP_000753555.1|1448725_1449040_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_023351789.1|1449051_1449534_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.1	1.6e-78
WP_023351788.1|1449517_1450420_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	87.5	9.7e-146
WP_023351787.1|1450416_1450725_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	7.3e-53
WP_001243355.1|1450809_1450962_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1450946_1451081_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000065364.1|1451156_1451525_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	99.2	2.6e-65
WP_169063418.1|1451674_1452145_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	2.6e-86
WP_052934929.1|1452258_1452522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157912652.1|1452576_1452714_-	hypothetical protein	NA	Q716D9	Shigella_phage	95.6	1.1e-21
WP_023146901.1|1452722_1453055_-	antitermination protein	NA	Q716D8	Shigella_phage	99.1	1.4e-54
WP_021526961.1|1453407_1453812_-	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	99.3	1.9e-69
WP_097478947.1|1453808_1454441_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	98.6	1.5e-116
WP_001194218.1|1454544_1454760_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000536662.1|1454876_1455158_+	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	100.0	1.9e-44
WP_000166961.1|1455192_1455354_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_109083719.1|1455340_1456162_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.3	7.5e-153
WP_001525220.1|1456158_1457535_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.3	8.2e-253
WP_000736904.1|1457608_1458049_+	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_024186921.1|1458045_1458228_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	98.3	2.2e-28
WP_000566998.1|1458224_1458395_+	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	100.0	7.2e-26
WP_001003984.1|1458387_1459110_+	phage antirepressor KilAC domain-containing protein	NA	K7P7L0	Enterobacteria_phage	99.6	7.1e-131
WP_000002244.1|1459109_1459400_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_001525218.1|1459396_1459759_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	96.7	5.6e-60
WP_000994515.1|1459755_1459944_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001525216.1|1459940_1460564_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	8.9e-114
WP_000286100.1|1460999_1461203_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_024186729.1|1461180_1461678_+	lysozyme RrrD	NA	I6R0P2	Salmonella_phage	98.8	4.9e-91
WP_001525213.1|1461674_1462112_+|lysis	lysis protein	lysis	I6RSJ6	Salmonella_phage	95.9	4.2e-70
WP_001525212.1|1462099_1462252_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	3.6e-21
WP_001525210.1|1462334_1462814_+	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	59.7	3.2e-55
WP_001525208.1|1463089_1463623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525207.1|1463647_1464175_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	78.0	5.6e-69
WP_000200766.1|1464171_1465587_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	1.2e-278
WP_001525206.1|1465588_1467787_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.2	0.0e+00
WP_001525205.1|1467877_1468771_+	phage scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	91.9	5.9e-127
WP_001525204.1|1468789_1470043_+	hypothetical protein	NA	A0A088CQ56	Enterobacteria_phage	99.5	5.7e-237
WP_001389518.1|1470084_1470273_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_001140510.1|1470253_1470715_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_023351778.1|1470724_1472143_+	DNA stabilization protein	NA	Q9AYZ4	Salmonella_phage	91.7	3.7e-256
WP_021514124.1|1472164_1472710_+	HNH endonuclease	NA	A0A2H4FQU5	Salmonella_phage	54.4	1.5e-45
WP_023351777.1|1472702_1473404_+	hypothetical protein	NA	A0A2D1GLK3	Escherichia_phage	98.7	6.0e-119
WP_001525201.1|1473403_1473859_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	8.8e-87
WP_097411485.1|1473861_1474554_+	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	98.7	2.1e-116
WP_113334632.1|1474564_1475980_+	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	80.9	4.4e-201
WP_047654990.1|1475979_1477818_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	74.7	5.2e-247
WP_001334102.1|1477842_1478211_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	98.4	2.9e-64
WP_097478950.1|1478262_1478628_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	98.3	1.8e-66
WP_001085430.1|1478641_1478821_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000532176.1|1478920_1479172_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	91.6	6.6e-36
WP_097478951.1|1479318_1482264_+|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	98.8	0.0e+00
WP_169063419.1|1482417_1483299_+	acyltransferase	NA	C7U0W4	Enterobacteria_phage	99.1	3.4e-79
WP_000958692.1|1483538_1484696_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	1.4e-221
WP_001525186.1|1485007_1485940_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	1.0e-166
1484851:1484872	attR	TGATAAATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 3
NZ_CP051706	Escherichia coli strain SCU-124 chromosome, complete genome	4753517	1723953	1733398	4753517		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001525038.1|1723953_1724880_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	1.5e-08
WP_000783109.1|1724884_1725616_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1725596_1725704_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|1725763_1726495_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|1726716_1728402_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001525037.1|1728398_1729118_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001525036.1|1729164_1729635_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001296231.1|1729675_1730137_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001525034.1|1730261_1732265_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001525033.1|1732261_1733398_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	1.9e-162
>prophage 4
NZ_CP051706	Escherichia coli strain SCU-124 chromosome, complete genome	4753517	1823597	1829904	4753517		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001115961.1|1823597_1824992_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	8.3e-19
WP_000183060.1|1825166_1826060_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699403.1|1826432_1827518_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_001524985.1|1827517_1828417_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	2.6e-29
WP_000857516.1|1828475_1829354_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
WP_001100804.1|1829358_1829904_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
>prophage 5
NZ_CP051706	Escherichia coli strain SCU-124 chromosome, complete genome	4753517	1989491	2043462	4753517	plate,integrase,portal,transposase,holin,terminase,capsid,tail,head	Enterobacteria_phage(78.57%)	68	2010331:2010345	2044373:2044387
WP_104209197.1|1989491_1990016_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_072254124.1|1990038_1990368_+	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	6.2e-42
WP_001524866.1|1990249_1990747_-	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.9	1.2e-52
WP_000790504.1|1990855_1991089_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118897.1|1991085_1992291_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|1992477_1992891_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245699.1|1992924_1994412_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001057840.1|1994489_1994855_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_169063430.1|1994854_1995265_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146830.1|1995280_1996696_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000079759.1|1996943_1997993_+	flagellin FliC	NA	NA	NA	NA	NA
WP_001087463.1|1998156_1998876_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001296169.1|1998921_1999473_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_024186910.1|1999560_2000361_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128215.1|2000465_2001452_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|2001466_2002135_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001524857.1|2002131_2002884_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	6.4e-26
WP_001154255.1|2003113_2003836_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|2003903_2004128_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001307856.1|2004114_2004291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611328.1|2004586_2005243_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283421.1|2005239_2007072_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|2007128_2007677_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001303543.1|2008661_2008943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|2009131_2009272_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|2009462_2009723_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001317900.1|2010012_2011152_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
2010331:2010345	attL	TCCGCAGGAAAAAGC	NA	NA	NA	NA
WP_042017428.1|2011551_2012652_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.4	1.8e-202
WP_000005439.1|2012809_2013994_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000290450.1|2013993_2014506_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|2014560_2014926_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_169063431.1|2014934_2015090_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	1.3e-21
WP_042017429.1|2015076_2017884_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.2	0.0e+00
WP_000979954.1|2017896_2018385_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_042017431.1|2018638_2019166_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	90.9	1.0e-86
WP_042017432.1|2019169_2021929_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	76.0	0.0e+00
WP_000071737.1|2021939_2022467_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	88.3	2.8e-84
WP_042017434.1|2022459_2023356_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.9e-155
WP_000213444.1|2023359_2023710_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001416427.1|2023706_2024288_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	4.3e-102
WP_001763299.1|2024284_2024920_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	5.3e-114
WP_000920594.1|2024912_2025380_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_001763300.1|2025517_2025925_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	1.9e-64
WP_000072335.1|2025921_2026314_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	9.9e-71
WP_000104350.1|2026310_2026634_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2026636_2026837_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001734854.1|2026836_2027331_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	6.6e-88
WP_042017440.1|2027433_2028234_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	94.7	4.0e-135
WP_022296525.1|2028279_2029332_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	1.9e-193
WP_001262670.1|2029355_2030192_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	8.7e-149
WP_032349929.1|2030346_2032098_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_042017444.1|2032097_2033144_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	4.4e-206
WP_001289969.1|2033634_2034225_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000211289.1|2034288_2034600_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_000686499.1|2034604_2035564_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_001272083.1|2035640_2038481_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_042017447.1|2038477_2038867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|2039190_2039394_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021647.1|2039480_2039594_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000357025.1|2039590_2039833_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000158976.1|2039844_2040123_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000742491.1|2040133_2040484_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000014504.1|2040505_2040709_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2040780_2040918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|2041007_2041412_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290352.1|2041427_2042078_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|2042107_2042455_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001342226.1|2042460_2043462_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
2044373:2044387	attR	TCCGCAGGAAAAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP051706	Escherichia coli strain SCU-124 chromosome, complete genome	4753517	2711868	2759015	4753517	lysis,portal,terminase,tRNA,capsid,tail,head	Enterobacteria_phage(52.83%)	63	NA	NA
WP_000654168.1|2711868_2712147_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_001579540.1|2714263_2717746_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_071589399.1|2717806_2718439_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.2e-96
WP_000194779.1|2718375_2719119_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152619.1|2719124_2719823_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847330.1|2719822_2720152_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	1.6e-58
WP_001576740.1|2720148_2722716_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.9	0.0e+00
WP_000459452.1|2722708_2723143_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000479173.1|2723124_2723547_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.2e-68
WP_001524522.1|2723562_2724303_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	1.1e-131
WP_000683157.1|2724310_2724706_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	1.2e-68
WP_000985127.1|2724702_2725281_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_000752960.1|2725292_2725646_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000158881.1|2725657_2726053_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.6e-55
WP_000118193.1|2726094_2727120_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_000201478.1|2727175_2727508_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_000123325.1|2727517_2728849_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	96.8	3.0e-228
WP_001337540.1|2728829_2730431_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000198149.1|2730427_2730634_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027282.1|2730630_2732556_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453576.1|2732530_2733076_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_000881610.1|2733639_2733822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2734028_2734355_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000738423.1|2734835_2735129_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|2735219_2735402_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001101164.1|2735618_2736152_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.8e-98
WP_001168526.1|2736286_2736526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193273.1|2736522_2736837_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_000839596.1|2736841_2737057_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2737646_2738729_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204794.1|2738917_2739301_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000971095.1|2739386_2739527_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001099697.1|2739523_2739886_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774475.1|2739882_2740173_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_000224907.1|2740165_2740336_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053004.1|2740335_2740791_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_072093903.1|2740787_2740889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700204.1|2741238_2742282_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000709098.1|2742631_2744158_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	30.8	2.7e-31
WP_014640128.1|2744215_2744365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|2744413_2744746_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145918.1|2744813_2745116_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	93.5	1.3e-41
WP_000788877.1|2745112_2745814_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_001441930.1|2745810_2746740_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	1.9e-112
WP_001182881.1|2746826_2747366_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000184665.1|2747396_2747624_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712396.1|2747734_2748427_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000380253.1|2748507_2749569_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	1.7e-64
WP_000866321.1|2749546_2749924_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_001524508.1|2750399_2750606_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	4.6e-27
WP_000995417.1|2750681_2750978_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	96.9	1.5e-47
WP_000100847.1|2750983_2751769_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186858.1|2751765_2752446_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.6e-132
WP_000149539.1|2752442_2752625_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	6.3e-28
WP_000548537.1|2752597_2752789_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001308571.1|2752799_2753081_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000763364.1|2753179_2753398_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488403.1|2753445_2753685_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	6.7e-38
WP_000088653.1|2753824_2754061_+	excisionase	NA	NA	NA	NA	NA
WP_000444487.1|2755308_2756559_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248674.1|2756730_2757384_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2757393_2757855_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|2757908_2759015_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP051706	Escherichia coli strain SCU-124 chromosome, complete genome	4753517	3529466	3639872	4753517	lysis,plate,protease,integrase,portal,transposase,holin,terminase,capsid,tail,head	Shigella_phage(50.0%)	105	3582452:3582500	3624475:3624523
WP_000131040.1|3529466_3531500_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001385220.1|3531628_3532216_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001441889.1|3532229_3533702_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001524132.1|3533715_3535386_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	1.2e-59
WP_001295804.1|3537376_3538171_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001524129.1|3538324_3539086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162901046.1|3541180_3542394_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_087896689.1|3542465_3542732_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001524127.1|3542915_3543584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001311446.1|3543826_3544522_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001311445.1|3544514_3545942_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102123.1|3545952_3546672_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_001295801.1|3547184_3548039_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046325.1|3548265_3549591_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	6.5e-114
WP_000474078.1|3549697_3549934_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298546.1|3549945_3550539_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001295799.1|3550698_3551568_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_000620998.1|3551815_3552673_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001524126.1|3552797_3557048_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001174452.1|3557613_3558465_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
WP_001172300.1|3558491_3559481_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000910711.1|3559511_3560405_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001524125.1|3560604_3561531_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860032.1|3561687_3562608_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000182343.1|3562779_3563922_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000662258.1|3564395_3564497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3564861_3565125_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3565124_3565265_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001524123.1|3566353_3566896_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730982.1|3566970_3567558_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716404.1|3567614_3568283_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131108.1|3568308_3570834_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265646.1|3570823_3572467_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001339257.1|3572435_3573146_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001295797.1|3573458_3573788_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019923.1|3574036_3574651_-	YagU family protein	NA	NA	NA	NA	NA
WP_001524122.1|3576745_3580876_+	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.7	1.9e-281
WP_001524121.1|3581960_3582299_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	47.7	4.8e-21
3582452:3582500	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATG	NA	NA	NA	NA
WP_000915848.1|3582700_3583063_+	GtrA family protein	NA	U5P0S6	Shigella_phage	100.0	3.6e-59
WP_169063458.1|3583059_3583947_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	100.0	4.1e-165
WP_071995149.1|3587489_3588539_+	acyltransferase family protein	NA	S5FNR8	Shigella_phage	98.6	4.5e-195
WP_032224606.1|3589310_3589745_-|tail	tail assembly chaperone	tail	S5FXM8	Shigella_phage	99.3	1.6e-77
WP_000554679.1|3589716_3590367_-	hypothetical protein	NA	S5FKM2	Shigella_phage	99.5	3.4e-116
WP_001579923.1|3590370_3590955_-	YmfQ family protein	NA	M1FPN6	Enterobacteria_phage	100.0	2.2e-114
WP_001524113.1|3590945_3592004_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.4	6.6e-202
WP_000424732.1|3591990_3592416_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259067.1|3592415_3592964_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	100.0	1.7e-97
WP_000999510.1|3592963_3594043_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_152799028.1|3594039_3595416_-	DNA circularization N-terminal domain-containing protein	NA	U5P4I0	Shigella_phage	99.3	8.7e-255
WP_001524109.1|3595440_3597348_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.2	0.0e+00
WP_001524108.1|3597432_3597756_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	98.1	9.4e-51
WP_000090998.1|3597752_3598109_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_152799030.1|3598108_3599605_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	7.2e-271
WP_000497751.1|3599588_3599759_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779292.1|3599767_3600328_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224835.1|3600324_3600831_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_022296592.1|3600805_3601216_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	3.9e-70
WP_000927719.1|3601212_3601536_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601363.1|3601538_3601739_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_000257504.1|3601788_3602994_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	3.1e-224
WP_001193631.1|3603008_3603659_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_105516875.1|3603636_3604878_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	2.2e-241
WP_000605606.1|3604877_3605060_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_065312442.1|3605071_3606568_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000929175.1|3606801_3607296_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_022296591.1|3607421_3607772_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	1.5e-62
WP_000738423.1|3608297_3608591_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3608681_3608864_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_022296589.1|3609080_3609557_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	97.4	8.6e-85
WP_001120503.1|3609560_3609896_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	98.2	5.7e-59
WP_021562676.1|3609992_3611384_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_152799390.1|3611523_3612102_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.3	3.6e-45
WP_137494289.1|3612116_3613106_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	98.8	8.9e-193
WP_001061441.1|3613113_3613923_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	2.0e-150
WP_000767113.1|3613942_3614332_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000066918.1|3614328_3614982_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_128500355.1|3614981_3615476_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	9.6e-87
WP_000104953.1|3615472_3616414_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	5.6e-144
WP_152799387.1|3616403_3616583_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	1.3e-14
WP_000515829.1|3616758_3617316_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000187185.1|3617338_3617587_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000853320.1|3617722_3618409_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.7e-39
WP_152799383.1|3618391_3619282_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	31.6	2.6e-34
WP_000500990.1|3619515_3620028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|3620496_3620859_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_115763208.1|3620924_3621749_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000008249.1|3621877_3622414_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
WP_016159288.1|3622404_3622767_+	phage protein	NA	U5P092	Shigella_phage	98.3	1.5e-65
WP_000206732.1|3622766_3623072_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|3623298_3624462_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_001524085.1|3624666_3625920_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
3624475:3624523	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATG	NA	NA	NA	NA
WP_001285288.1|3625931_3627035_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749899.1|3627323_3628379_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
WP_000174684.1|3628488_3628890_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189575.1|3628947_3630192_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291991.1|3630283_3630742_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293022.1|3631002_3632460_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602123.1|3632515_3633130_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_072262171.1|3633126_3634278_-	RNA ligase RtcB family protein	NA	A0A222ZKP1	Mycobacterium_phage	30.1	2.5e-29
WP_071589393.1|3634455_3634908_-	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	27.5	1.3e-05
WP_000554758.1|3635318_3635612_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226176.1|3635663_3636719_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_072254153.1|3636789_3637575_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001524081.1|3637519_3639259_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006239.1|3639374_3639872_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP051707	Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence	114026	0	1961	114026	integrase	Macacine_betaherpesvirus(100.0%)	1	1106:1119	2201:2214
1106:1119	attL	ATCTGCCTGTTCCT	NA	NA	NA	NA
WP_001066947.1|1220_1961_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001066947.1|1220_1961_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
2201:2214	attR	AGGAACAGGCAGAT	NA	NA	NA	NA
>prophage 2
NZ_CP051707	Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence	114026	9676	13306	114026	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_001323403.1|9676_10456_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_169063469.1|10455_11478_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	2.7e-200
WP_000612626.1|12557_12905_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|12901_13306_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
>prophage 3
NZ_CP051707	Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence	114026	27554	33985	114026	transposase	Enterobacteria_phage(33.33%)	6	NA	NA
WP_000065240.1|27554_28310_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_000143800.1|28306_29806_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_001189106.1|30914_31403_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
WP_000874189.1|32307_32793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|32817_33303_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|33289_33985_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
>prophage 4
NZ_CP051707	Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence	114026	42430	43135	114026	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067837.1|42430_43135_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	5.8e-138
>prophage 5
NZ_CP051707	Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence	114026	46731	50038	114026		Moraxella_phage(33.33%)	5	NA	NA
WP_001233838.1|46731_47193_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001309245.1|47437_47650_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139321.1|47778_48339_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704523.1|48441_49302_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.9e-10
WP_169063470.1|49360_50038_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	31.2	6.4e-09
>prophage 6
NZ_CP051707	Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence	114026	75614	75836	114026		Vibrio_virus(100.0%)	1	NA	NA
WP_001278695.1|75614_75836_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
>prophage 7
NZ_CP051707	Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence	114026	83876	91898	114026		Yersinia_phage(25.0%)	12	NA	NA
WP_001234489.1|83876_84698_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	5.7e-44
WP_000107526.1|84816_85104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337416.1|85167_85404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032195784.1|85447_85783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302184.1|86020_86179_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001276230.1|86454_87174_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845910.1|87170_87605_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_169063474.1|87659_89618_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.2	7.3e-21
WP_033551487.1|89676_89910_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290834.1|89967_90495_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_024185774.1|90796_91249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298559.1|91334_91898_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
>prophage 8
NZ_CP051707	Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence	114026	97533	100814	114026	transposase	Enterobacteria_phage(66.67%)	5	NA	NA
WP_000086169.1|97533_98217_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	2.8e-28
WP_001310011.1|98292_98604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298677.1|98600_98804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952372.1|98844_100017_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|100016_100814_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
>prophage 9
NZ_CP051707	Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence	114026	103948	109363	114026	integrase	Escherichia_phage(40.0%)	7	102730:102742	109549:109561
102730:102742	attL	GCCAGTGCCCGCC	NA	NA	NA	NA
WP_000619112.1|103948_104197_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_000109079.1|104193_104631_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
WP_000340835.1|105905_106298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103694.1|106302_107274_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|107502_108147_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|108140_108416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016979.1|108553_109363_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
109549:109561	attR	GGCGGGCACTGGC	NA	NA	NA	NA
