The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	0	43202	5048496	terminase,protease,head,capsid,tail	Stx2-converting_phage(41.67%)	40	NA	NA
WP_001304597.1|0_1662_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.6	0.0e+00
WP_000173054.1|1726_3664_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	97.8	0.0e+00
WP_001063027.1|3708_3930_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125984.1|6456_6783_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007909.1|6794_7145_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	4.6e-59
WP_000573362.1|7141_7588_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|7584_7929_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275433.1|7994_8708_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	2.3e-126
WP_000710952.1|8725_9100_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001538679.1|9195_9405_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	2.0e-33
WP_000212987.1|9452_12695_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.0	0.0e+00
WP_000807940.1|12687_13029_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001351100.1|13028_13727_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	8.9e-131
WP_001351101.1|13732_14476_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_122996802.1|14421_15054_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_001773905.1|15397_19090_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_016238842.1|19157_19757_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	1.0e-106
WP_071686802.1|19908_21972_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	3.1e-147
WP_001204581.1|21968_22247_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_000355614.1|22256_22553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304590.1|22670_23003_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001304589.1|23188_23641_+	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_001079492.1|24272_24779_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|24824_25325_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|25410_25590_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|25970_26777_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|26776_27970_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|27981_29340_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|29343_30939_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|30938_32501_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|32592_32637_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|32774_33656_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|33652_34273_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|34300_36196_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|36408_37284_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|37323_37914_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|37910_38669_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|38888_39938_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|39973_40225_-	YciN family protein	NA	NA	NA	NA	NA
WP_001304419.1|40604_43202_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 2
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	48112	48703	5048496		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|48112_48703_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 3
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	56522	58457	5048496		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485006.1|56522_58457_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	4.8e-33
>prophage 4
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	67391	69409	5048496		Salmonella_phage(50.0%)	2	NA	NA
WP_000135020.1|67391_68555_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	1.6e-28
WP_000573407.1|68602_69409_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 5
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	88751	89834	5048496		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057991.1|88751_89834_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-23
>prophage 6
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	107058	107574	5048496		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|107058_107574_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 7
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	112335	121756	5048496	tRNA	Bacillus_phage(20.0%)	7	NA	NA
WP_001350888.1|112335_113568_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|113822_114806_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|115080_115254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123782.1|115283_116657_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157413.1|116785_117721_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_001295593.1|120047_120482_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|120622_121756_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 8
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	126715	127705	5048496		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|126715_127705_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 9
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	145842	149745	5048496		Klosneuvirus(100.0%)	1	NA	NA
WP_000139522.1|145842_149745_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 10
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	153685	154634	5048496		Escherichia_phage(50.0%)	2	NA	NA
WP_001350640.1|153685_154216_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731859.1|154460_154634_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 11
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	166185	168147	5048496		Phage_TP(100.0%)	1	NA	NA
WP_001350637.1|166185_168147_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.6	1.2e-23
>prophage 12
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	171776	172790	5048496		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220436.1|171776_172790_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	4.6e-27
>prophage 13
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	178286	180389	5048496		Salmonella_phage(100.0%)	1	NA	NA
WP_000689338.1|178286_180389_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.1	6.6e-137
>prophage 14
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	185014	187420	5048496		Ralstonia_phage(100.0%)	1	NA	NA
WP_169062173.1|185014_187420_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.6	3.2e-26
>prophage 15
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	191115	192660	5048496		Escherichia_phage(100.0%)	1	NA	NA
WP_000702551.1|191115_192660_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 16
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	204084	205843	5048496		Escherichia_phage(66.67%)	3	NA	NA
WP_000781370.1|204084_204369_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000605675.1|204368_204647_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_000642412.1|204832_205843_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
>prophage 17
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	209249	211649	5048496		Klosneuvirus(100.0%)	1	NA	NA
WP_001362858.1|209249_211649_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	2.1e-09
>prophage 18
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	217117	224053	5048496		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_000402827.1|217117_219913_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	4.4e-19
WP_000832485.1|219957_222330_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001304373.1|222367_224053_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	3.8e-10
>prophage 19
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	245528	246947	5048496		Bacillus_phage(100.0%)	1	NA	NA
WP_000558461.1|245528_246947_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	1.4e-18
>prophage 20
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	253690	255820	5048496		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091198.1|253690_254074_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803537.1|254105_254324_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012592.1|254380_255820_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	4.8e-30
>prophage 21
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	263323	264214	5048496		Bacillus_phage(100.0%)	1	NA	NA
WP_000592858.1|263323_264214_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
>prophage 22
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	268601	273579	5048496		Salmonella_phage(20.0%)	6	NA	NA
WP_000214712.1|268601_268805_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000526706.1|268840_270301_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	5.1e-43
WP_015952996.1|270651_270744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836075.1|270801_271821_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
WP_001298659.1|271832_273047_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_001304355.1|273252_273579_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
>prophage 23
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	278460	283025	5048496		Escherichia_phage(100.0%)	4	NA	NA
WP_001468025.1|278460_280884_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
WP_000213028.1|280894_281512_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526507.1|281513_282368_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148695.1|282410_283025_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
>prophage 24
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	300855	302157	5048496		Bacillus_phage(100.0%)	1	NA	NA
WP_000732519.1|300855_302157_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
>prophage 25
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	312052	313864	5048496		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945903.1|312052_313864_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 26
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	333652	334927	5048496	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001351112.1|333652_334927_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	2.0e-83
>prophage 27
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	341838	343337	5048496		Salmonella_phage(50.0%)	2	NA	NA
WP_001350654.1|341838_342360_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
WP_000250643.1|342440_343337_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	2.1e-07
>prophage 28
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	347752	356544	5048496		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101200.1|347752_348568_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	9.8e-20
WP_000007283.1|348695_349277_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701049.1|349422_350592_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|350757_350847_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190985.1|351145_352171_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_000269493.1|352167_353100_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182336.1|353212_354424_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|354714_355863_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|355902_356544_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 29
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	362049	364316	5048496		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587583.1|362049_362862_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069965.1|362865_363651_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001362847.1|363647_364316_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
>prophage 30
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	372605	377689	5048496		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|372605_373826_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907963.1|373822_375094_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948883.1|375068_375815_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.1	5.1e-07
WP_001304330.1|375824_377312_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367158.1|377320_377689_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
>prophage 31
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	396161	415700	5048496	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001296108.1|396161_397808_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.7e-31
WP_000069409.1|397864_400243_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_000368046.1|400575_401409_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|401565_402612_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001313872.1|402743_402935_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175635.1|402938_404375_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001298229.1|404437_405151_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209783.1|405397_405862_-	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.8e-11
WP_000029464.1|405939_406689_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154198.1|406688_407240_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|407301_408282_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|408382_408682_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672426.1|408686_411074_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|411088_412072_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|412355_412400_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|412522_412879_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|412931_413129_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|413225_413768_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|413771_415700_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 32
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	425076	427338	5048496		Tupanvirus(100.0%)	1	NA	NA
WP_000077882.1|425076_427338_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.9e-143
>prophage 33
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	433463	434291	5048496		Bacillus_virus(100.0%)	1	NA	NA
WP_000175056.1|433463_434291_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	3.5e-73
>prophage 34
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	441767	442988	5048496		Klosneuvirus(100.0%)	1	NA	NA
WP_000081990.1|441767_442988_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.7e-26
>prophage 35
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	449751	450405	5048496		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|449751_450405_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 36
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	454795	456751	5048496		Streptococcus_phage(100.0%)	1	NA	NA
WP_001332112.1|454795_456751_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 37
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	461677	465763	5048496		Tupanvirus(50.0%)	4	NA	NA
WP_001135068.1|461677_462319_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
WP_001313906.1|462411_463770_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|463887_464646_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723732.1|464782_465763_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	6.7e-07
>prophage 38
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	474576	475431	5048496		Indivirus(100.0%)	1	NA	NA
WP_001332110.1|474576_475431_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 39
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	478749	483326	5048496		Bacillus_phage(100.0%)	3	NA	NA
WP_000219684.1|478749_480033_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621390.1|480179_481655_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|481835_483326_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 40
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	492293	500399	5048496	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|492293_493979_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|494183_494765_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220977.1|494804_495500_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128839.1|495557_497468_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	1.0e-91
WP_001351125.1|497599_497944_+	RidA family protein	NA	NA	NA	NA	NA
WP_001304301.1|498305_498665_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|498784_498964_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855011.1|499037_500399_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.9	2.3e-42
>prophage 41
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	504261	505818	5048496		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|504261_505818_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 42
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	511458	511668	5048496		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|511458_511668_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 43
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	517001	519050	5048496		Moraxella_phage(100.0%)	1	NA	NA
WP_001055805.1|517001_519050_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	4.0e-86
>prophage 44
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	526546	531014	5048496		Escherichia_phage(33.33%)	7	NA	NA
WP_000812741.1|526546_527203_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.5	1.4e-56
WP_000984819.1|527597_527939_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879320.1|527951_528824_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|528827_529202_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|529340_529571_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011664.1|529672_530329_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|530351_531014_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 45
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	539070	540546	5048496		Cyanophage(100.0%)	1	NA	NA
WP_000301724.1|539070_540546_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	3.4e-79
>prophage 46
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	544544	551679	5048496		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|544544_545867_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|545882_546815_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|546893_547649_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|547645_548431_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|548647_549658_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|549666_550278_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072123646.1|550416_550482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024939.1|550553_551156_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|551157_551679_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 47
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	555572	557623	5048496		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639256.1|555572_556391_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_001313931.1|556443_556839_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|556879_557623_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 48
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	564239	565973	5048496	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025351.1|564239_565973_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.3	3.7e-85
>prophage 49
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	570500	574769	5048496		Tupanvirus(33.33%)	4	NA	NA
WP_000763860.1|570500_570890_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
WP_000036385.1|570904_571954_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204321.1|571956_572817_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001332092.1|573107_574769_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.5	3.8e-10
>prophage 50
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	584856	586371	5048496		Cedratvirus(100.0%)	1	NA	NA
WP_001187785.1|584856_586371_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	2.1e-12
>prophage 51
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	598353	599106	5048496		Bacillus_virus(100.0%)	1	NA	NA
WP_001273001.1|598353_599106_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 52
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	611372	613636	5048496		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000334564.1|611372_612041_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.2e-79
WP_000737290.1|612553_613636_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.1	6.0e-166
>prophage 53
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	629965	642335	5048496		Bacillus_phage(33.33%)	12	NA	NA
WP_001351132.1|629965_631660_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	1.5e-17
WP_000009302.1|631830_632013_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922688.1|632091_633009_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|633181_634102_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228684.1|634090_634561_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	6.8e-34
WP_001157268.1|634541_635960_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001304276.1|636071_636722_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.6e-07
WP_001330593.1|636761_637127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824389.1|637692_638751_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.1	2.5e-92
WP_000218217.1|639346_640198_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826735.1|640305_641664_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|641663_642335_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 54
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	646385	647606	5048496	integrase	Ralstonia_phage(100.0%)	1	638955:638969	652527:652541
638955:638969	attL	CATTTCTTTATAAAT	NA	NA	NA	NA
WP_001298509.1|646385_647606_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	42.1	2.5e-80
WP_001298509.1|646385_647606_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	42.1	2.5e-80
652527:652541	attR	CATTTCTTTATAAAT	NA	NA	NA	NA
>prophage 55
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	654696	655560	5048496		Enterococcus_phage(100.0%)	1	NA	NA
WP_000282336.1|654696_655560_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	36.4	3.2e-21
>prophage 56
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	663659	694689	5048496	integrase	Bacillus_phage(28.57%)	18	661533:661547	676378:676392
661533:661547	attL	TATTGGCTATCGTGT	NA	NA	NA	NA
WP_000262502.1|663659_664391_-	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	41.4	8.7e-44
WP_001233369.1|664564_665044_+	DUF4756 family protein	NA	NA	NA	NA	NA
WP_001287374.1|665202_665607_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000505229.1|665670_666021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564596.1|666129_666372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091321.1|666444_666741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687678.1|666793_667084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298701.1|667165_667384_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_000830396.1|667600_668437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325918.1|668898_669696_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_024174323.1|670033_671296_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	9.0e-73
WP_000703047.1|671489_672794_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286281.1|672821_674102_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_001327263.1|674094_675897_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001327262.1|675883_677596_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.8e-31
676378:676392	attR	TATTGGCTATCGTGT	NA	NA	NA	NA
WP_000970688.1|677852_678812_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623030.1|679002_685110_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	3.1e-33
WP_000369530.1|685197_694689_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
>prophage 57
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	714155	715427	5048496	integrase	Stenotrophomonas_phage(100.0%)	1	710514:710527	729130:729143
710514:710527	attL	GATATGGCGGTGAT	NA	NA	NA	NA
WP_000055670.1|714155_715427_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.8e-73
WP_000055670.1|714155_715427_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.8e-73
729130:729143	attR	ATCACCGCCATATC	NA	NA	NA	NA
>prophage 58
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	720985	749204	5048496		Tupanvirus(80.0%)	7	NA	NA
WP_001327259.1|720985_725353_-	colibactin non-ribosomal peptide synthetase ClbN	NA	A0A2K9KZV5	Tupanvirus	22.8	4.3e-37
WP_000217768.1|725349_726789_-	precolibactin export MATE transporter ClbM	NA	NA	NA	NA	NA
WP_001297937.1|726850_728314_-	colibactin biosynthesis amidase ClbL	NA	NA	NA	NA	NA
WP_000222467.1|728306_734771_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbK	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-43
WP_001468003.1|734781_741282_-	colibactin non-ribosomal peptide synthetase ClbJ	NA	A0A2K9KZV5	Tupanvirus	23.4	2.5e-102
WP_000829570.1|741325_744358_-	colibactin polyketide synthase ClbI	NA	D0R7J2	Paenibacillus_phage	37.9	4.0e-50
WP_001304254.1|744407_749204_-	colibactin non-ribosomal peptide synthetase ClbH	NA	A0A2K9L3I8	Tupanvirus	28.7	3.0e-44
>prophage 59
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	755448	765069	5048496		Tupanvirus(100.0%)	1	NA	NA
WP_001362828.1|755448_765069_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbB	NA	A0A2K9KZV5	Tupanvirus	23.8	5.0e-46
>prophage 60
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	776041	777894	5048496		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502870.1|776041_776686_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_001362826.1|776670_777894_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	1.5e-61
>prophage 61
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	797378	799180	5048496	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001323403.1|797378_798158_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|798157_799180_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
>prophage 62
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	802690	803458	5048496		Bacillus_virus(100.0%)	1	NA	NA
WP_000016205.1|802690_803458_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.7e-13
>prophage 63
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	814590	816770	5048496		Yersinia_phage(33.33%)	4	NA	NA
WP_001234569.1|814590_815412_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.5	4.7e-46
WP_000213703.1|815502_815988_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.3	9.9e-12
WP_001351157.1|816003_816480_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|816548_816770_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 64
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	821112	822279	5048496		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001297905.1|821112_822279_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	2.2e-227
>prophage 65
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	828476	829376	5048496		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|828476_829376_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 66
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	836731	839552	5048496		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704860.1|836731_837898_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
WP_000043444.1|838145_839552_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.6	2.8e-38
>prophage 67
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	843826	852542	5048496		Enterobacteria_phage(42.86%)	8	NA	NA
WP_000735124.1|843826_844954_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
WP_001362820.1|844963_846202_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_001100791.1|846233_846782_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_000857549.1|846786_847665_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023627.1|847722_848622_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000699418.1|848621_849707_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_000183060.1|850079_850973_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115981.1|851147_852542_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
>prophage 68
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	858140	864843	5048496		Bacillus_phage(25.0%)	6	NA	NA
WP_001296216.1|858140_859511_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_000079277.1|859612_861049_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.3	3.8e-51
WP_000699724.1|861051_862275_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|862271_862751_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|862753_863719_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000048190.1|863721_864843_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 69
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	869160	880059	5048496		Catovirus(33.33%)	11	NA	NA
WP_000654488.1|869160_870000_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
WP_000137112.1|870128_872291_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482915.1|872293_872737_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|872742_873882_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_162829205.1|874190_874340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332223.1|874540_876124_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001227699.1|876198_876537_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000687871.1|876526_876817_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_001252295.1|876869_878723_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|878744_879326_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|879417_880059_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 70
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	884786	886139	5048496		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469710.1|884786_886139_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 71
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	899246	901369	5048496		Bacillus_phage(100.0%)	2	NA	NA
WP_000675178.1|899246_900650_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|900646_901369_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
>prophage 72
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	907208	910702	5048496	tRNA	Phage_TP(50.0%)	3	NA	NA
WP_000476019.1|907208_908570_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_001350699.1|909069_909387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807360.1|909802_910702_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
>prophage 73
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	919843	935892	5048496	integrase,protease	Escherichia_phage(28.57%)	17	915179:915195	936397:936413
915179:915195	attL	TGCGGTTCGTCGAGCAT	NA	NA	NA	NA
WP_000846205.1|919843_920848_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	2.2e-13
WP_000011933.1|920844_921810_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434049.1|921783_922530_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297940.1|922581_923400_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822262.1|923464_924265_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195614.1|924261_925050_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_001596797.1|925731_926013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373414.1|926015_926501_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	66.9	8.6e-48
WP_001017075.1|926758_928672_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	57.2	2.5e-215
WP_001596799.1|929024_929738_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000710161.1|930129_931947_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	1.5e-129
WP_001261489.1|931943_932243_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113145.1|932249_932570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072112918.1|932562_933483_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001075377.1|933492_933717_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	3.6e-17
WP_000163378.1|933820_934675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513576.1|934671_935892_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.8	4.9e-132
936397:936413	attR	TGCGGTTCGTCGAGCAT	NA	NA	NA	NA
>prophage 74
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	944992	947026	5048496	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350700.1|944992_947026_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 75
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	959108	968553	5048496		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|959108_960245_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001332210.1|960241_962245_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|962369_962831_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|962871_963342_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|963388_964108_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|964104_965790_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|966011_966743_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|966802_966910_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|966890_967622_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|967626_968553_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 76
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	988903	990424	5048496		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|988903_990424_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 77
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	994118	997904	5048496		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|994118_994787_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425456.1|995044_995881_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001596802.1|995912_997904_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
>prophage 78
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1001972	1002830	5048496		Catovirus(100.0%)	1	NA	NA
WP_000873879.1|1001972_1002830_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	4.0e-24
>prophage 79
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1016217	1020518	5048496		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001332203.1|1016217_1017684_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
WP_000198797.1|1017801_1018788_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000594599.1|1018826_1019540_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1019951_1020518_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 80
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1026272	1033922	5048496		Vibrio_phage(50.0%)	7	NA	NA
WP_000194888.1|1026272_1027862_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|1027865_1028210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213379.1|1028543_1029734_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|1029761_1030457_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578103.1|1030606_1032367_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	9.9e-102
WP_000494186.1|1032491_1032776_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1032914_1033922_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 81
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1043824	1044442	5048496		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|1043824_1044442_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 82
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1053210	1058976	5048496		Bacillus_phage(25.0%)	5	NA	NA
WP_000422239.1|1053210_1054854_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.6	1.6e-13
WP_000884927.1|1054929_1055580_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
WP_000872522.1|1055579_1056644_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.2	3.1e-18
WP_000406059.1|1056717_1057773_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865556.1|1057884_1058976_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.3	2.7e-118
>prophage 83
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1063253	1068096	5048496		Hokovirus(50.0%)	2	NA	NA
WP_000876050.1|1063253_1066103_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	3.2e-41
WP_001296244.1|1066269_1068096_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
>prophage 84
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1083019	1096895	5048496		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281253.1|1083019_1085647_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
WP_000990768.1|1085793_1086516_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001351169.1|1086655_1090414_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	28.2	3.3e-22
WP_001075170.1|1091095_1093381_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|1093527_1094658_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|1094657_1094912_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301034.1|1094965_1095616_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|1095818_1096895_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 85
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1102787	1107358	5048496	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140576.1|1102787_1103747_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.6e-69
WP_000150339.1|1103759_1103945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992976.1|1103985_1104789_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001297939.1|1104806_1106096_-	MFS transporter	NA	NA	NA	NA	NA
WP_001350710.1|1106152_1107358_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	3.5e-26
>prophage 86
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1110961	1115965	5048496		Tupanvirus(50.0%)	4	NA	NA
WP_000879110.1|1110961_1111564_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
WP_011076488.1|1111871_1113011_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	7.2e-29
WP_000461633.1|1113014_1113983_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_000860295.1|1113982_1115965_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 87
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1150927	1154155	5048496		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|1150927_1151527_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|1151585_1153418_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203415.1|1153504_1154155_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
>prophage 88
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1164714	1166574	5048496		Sodalis_phage(50.0%)	2	NA	NA
WP_000156130.1|1164714_1165605_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	53.1	4.0e-67
WP_001293612.1|1165800_1166574_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 89
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1170785	1172303	5048496		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|1170785_1172303_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 90
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1177161	1248617	5048496	tRNA,terminase,integrase,protease,head,lysis,coat,portal,holin,tail	Enterobacteria_phage(72.41%)	85	1207283:1207299	1248691:1248707
WP_001283598.1|1177161_1177974_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|1177973_1178987_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|1179052_1180189_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|1180287_1181283_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|1181279_1182458_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|1182722_1183943_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683753.1|1184101_1186108_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|1186228_1186507_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089236.1|1186540_1187089_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|1187088_1187898_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|1187897_1188722_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|1188725_1189811_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|1189845_1190778_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|1190943_1191495_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|1191814_1192657_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|1192658_1193186_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|1193182_1193662_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|1193658_1194162_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000120670.1|1194178_1194931_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001447287.1|1194950_1197599_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195816.1|1198788_1199274_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425008.1|1199476_1201621_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|1201620_1202931_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|1203111_1203396_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|1203767_1205108_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|1205165_1205921_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|1206214_1207147_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
1207283:1207299	attL	CTGCAGGGGACACCATT	NA	NA	NA	NA
WP_000958671.1|1207458_1208616_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000132323.1|1209904_1212853_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	98.8	0.0e+00
WP_000835353.1|1212953_1213883_-	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	89.6	4.6e-159
WP_000620145.1|1213946_1214120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410001.1|1214116_1214269_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001051912.1|1214383_1214632_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000903307.1|1214631_1215168_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_000954424.1|1215648_1216092_-	SocA family protein	NA	I6R0L8	Salmonella_phage	70.1	1.2e-59
WP_001331792.1|1216487_1216856_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	97.5	7.2e-63
WP_001362793.1|1216880_1218707_-	hypothetical protein	NA	I6R973	Salmonella_phage	73.1	7.6e-230
WP_000257014.1|1218706_1220122_-	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	80.3	3.7e-200
WP_000964857.1|1220131_1220821_-	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	98.3	6.8e-115
WP_000627624.1|1220823_1221279_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	98.7	3.3e-86
WP_000785520.1|1221278_1221980_-	hypothetical protein	NA	A0A2D1GLK3	Escherichia_phage	98.7	4.6e-119
WP_001122380.1|1221979_1223398_-	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.7	5.1e-274
WP_001140510.1|1223407_1223869_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001362792.1|1223849_1224038_-	hypothetical protein	NA	A5VW71	Enterobacteria_phage	100.0	2.9e-28
WP_000013270.1|1224079_1225333_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	100.0	3.4e-237
WP_000372589.1|1225351_1226245_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818372.1|1226335_1228534_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.4	0.0e+00
WP_000200770.1|1228535_1229951_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	7.5e-278
WP_000113731.1|1229947_1230388_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807790.1|1230390_1230633_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	1.1e-35
WP_001059339.1|1230933_1231458_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001139677.1|1231660_1231813_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	98.0	8.1e-21
WP_000092261.1|1231800_1232268_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.1	4.6e-75
WP_000229392.1|1232264_1232741_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|1232724_1233048_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_032153396.1|1233720_1234344_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.0	2.2e-112
WP_000994515.1|1234340_1234529_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001008202.1|1234525_1234888_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	3.5e-62
WP_001279421.1|1235174_1235444_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000566863.1|1235436_1235607_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	98.2	5.5e-26
WP_001254251.1|1235603_1235786_-	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000814611.1|1235782_1236193_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344551.1|1236164_1236521_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	96.5	6.1e-59
WP_000818846.1|1236538_1236745_-	hypothetical protein	NA	K7PKH6	Enterobacteria_phage	94.1	1.9e-25
WP_001331794.1|1236821_1238702_-	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	100.0	0.0e+00
WP_000067065.1|1238809_1239670_-	replication protein	NA	K7PL20	Enterobacteria_phage	100.0	3.0e-160
WP_000166207.1|1239662_1239809_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000536662.1|1239844_1240126_-	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	100.0	1.9e-44
WP_000391959.1|1240242_1240473_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	100.0	1.1e-37
WP_001331795.1|1240581_1241268_+	helix-turn-helix transcriptional regulator	NA	K7PK07	Enterobacteria_phage	100.0	1.1e-130
WP_072197693.1|1241950_1242313_+	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	3.0e-53
WP_000213976.1|1242391_1242592_+	Restriction inhibitor protein ral	NA	A5VWA0	Enterobacteria_phage	100.0	3.2e-33
WP_000392426.1|1242650_1243073_+	hypothetical protein	NA	A5VWA1	Enterobacteria_phage	100.0	3.3e-72
WP_000638547.1|1244241_1244373_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|1244357_1244510_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031365.1|1244766_1245372_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|1245371_1245755_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|1245778_1246075_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|1246169_1246688_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_000215166.1|1246684_1246984_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|1246985_1247558_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000253290.1|1247557_1247842_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	97.9	3.2e-47
WP_000002115.1|1247834_1248119_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	98.9	1.2e-49
WP_000545737.1|1248191_1248359_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|1248416_1248617_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
1248691:1248707	attR	CTGCAGGGGACACCATT	NA	NA	NA	NA
>prophage 91
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1256484	1264061	5048496		Bacillus_phage(50.0%)	4	NA	NA
WP_001331804.1|1256484_1260078_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001331805.1|1260133_1261279_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1261352_1262297_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283509.1|1262366_1264061_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 92
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1267754	1268675	5048496		Morganella_phage(100.0%)	1	NA	NA
WP_000484022.1|1267754_1268675_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 93
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1272493	1273231	5048496		Clostridioides_phage(100.0%)	1	NA	NA
WP_001314031.1|1272493_1273231_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.3	6.1e-13
>prophage 94
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1298770	1320498	5048496		Streptococcus_phage(25.0%)	22	NA	NA
WP_032153397.1|1298770_1300786_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	2.9e-150
WP_001317975.1|1300856_1301855_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1302084_1302846_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1303030_1304002_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1304385_1304643_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623142.1|1304687_1306415_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1306455_1306965_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096640.1|1307007_1307859_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000724596.1|1307963_1308332_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000105467.1|1308334_1309246_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
WP_000021034.1|1309380_1310478_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1310467_1311343_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458408.1|1311342_1312176_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290262.1|1312175_1313192_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517443.1|1313349_1314141_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_001175632.1|1314420_1315317_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040463.1|1315320_1316745_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000084590.1|1316922_1317822_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838948.1|1317917_1318493_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001331810.1|1318553_1319003_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1318989_1319415_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102910.1|1319628_1320498_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 95
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1339168	1340119	5048496		Cyanophage(100.0%)	1	NA	NA
WP_001003713.1|1339168_1340119_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	7.4e-11
>prophage 96
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1357360	1358074	5048496		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1357360_1358074_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 97
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1365553	1369554	5048496		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198327.1|1365553_1366843_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|1366928_1367555_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001350863.1|1367878_1368916_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.6	2.8e-72
WP_001028626.1|1368915_1369554_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 98
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1375800	1382290	5048496		Escherichia_phage(66.67%)	7	NA	NA
WP_000017553.1|1375800_1375953_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
WP_000076001.1|1375970_1376162_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|1376472_1376991_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|1377006_1377546_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138282.1|1377639_1379217_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|1379285_1380752_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000937882.1|1380913_1382290_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	9.0e-42
>prophage 99
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1402796	1403228	5048496		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|1402796_1403228_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 100
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1413113	1419451	5048496		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133562.1|1413113_1414397_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|1414455_1414656_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|1414667_1415003_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1415004_1416855_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|1416871_1417387_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1417482_1417806_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1417822_1418209_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1418236_1419451_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 101
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1429568	1431080	5048496		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000493462.1|1429568_1431080_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
>prophage 102
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1436838	1448147	5048496		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1436838_1438092_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883117.1|1438420_1439611_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1439655_1439994_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001305238.1|1440054_1441389_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	38.2	1.4e-10
WP_001215879.1|1441378_1442092_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001350885.1|1442256_1443684_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970064.1|1444259_1448147_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	6.5e-130
>prophage 103
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1452267	1452528	5048496		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|1452267_1452528_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 104
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1455987	1459724	5048496		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1455987_1456668_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1456934_1457909_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790169.1|1457924_1459724_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 105
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1464626	1551978	5048496	tRNA,terminase,head,lysis,portal,plate,capsid,holin,tail	Shigella_phage(41.82%)	95	NA	NA
WP_000083664.1|1464626_1465364_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1465495_1466830_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|1466862_1467744_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|1467846_1468434_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1468489_1468873_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|1469177_1469867_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|1469914_1470952_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1471158_1471578_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|1471646_1472345_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|1472376_1475037_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1475150_1476506_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|1476551_1476875_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|1476871_1478170_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001350770.1|1486656_1489230_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|1489359_1490091_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079096.1|1490087_1491068_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1491202_1491940_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1492209_1492551_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|1492654_1492702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|1492800_1493961_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|1494003_1495125_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|1495135_1496206_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|1496415_1496781_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|1496929_1497448_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|1497437_1498664_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|1498679_1499162_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1499238_1499586_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1499627_1500395_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1500425_1500974_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1500992_1501241_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1501377_1502739_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1502905_1503697_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|1503717_1505004_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|1505058_1505652_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|1505774_1506653_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|1506738_1508400_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1508548_1508890_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|1508951_1509242_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|1509231_1509708_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1509839_1510322_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000183405.1|1511478_1512267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174562.1|1512354_1512648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|1512858_1513632_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|1514683_1516573_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|1516826_1517318_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|1517320_1517764_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|1517735_1518338_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554717.1|1518337_1519081_-|tail	tail fiber protein	tail	O22004	Shigella_phage	91.7	1.1e-49
WP_000539246.1|1519084_1519669_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785328.1|1519659_1520718_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|1520704_1521130_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|1521129_1521678_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|1521677_1522757_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|1522753_1524082_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|1524142_1525978_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|1526119_1526389_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|1526388_1526745_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|1526744_1528241_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|1528224_1528395_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|1528403_1528964_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|1528960_1529467_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|1529441_1529852_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|1529848_1530172_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|1530174_1530375_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|1530424_1531630_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_000466267.1|1532272_1533514_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|1533513_1533696_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|1533707_1535204_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|1535437_1535932_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|1536057_1536408_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000026993.1|1536510_1536951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332386.1|1537057_1537309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|1537379_1537817_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|1537813_1538290_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|1538276_1538582_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|1538733_1539069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|1539254_1540007_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001351089.1|1540020_1541010_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	1.1e-190
WP_001061411.1|1541017_1541815_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|1541834_1542224_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210172.1|1542220_1542547_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001332383.1|1542543_1543197_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_001332382.1|1543196_1543691_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|1543687_1544629_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|1544618_1544798_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|1544973_1545525_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|1545568_1545769_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|1545859_1546534_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|1546736_1547249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|1547717_1548080_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|1548145_1548970_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|1549097_1549622_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|1549730_1550597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|1550638_1550845_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|1550805_1551978_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
>prophage 106
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1558451	1562503	5048496		Klosneuvirus(50.0%)	4	NA	NA
WP_001332373.1|1558451_1559732_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	1.2e-32
WP_001298180.1|1559969_1561370_+	GABA permease	NA	NA	NA	NA	NA
WP_000156818.1|1561390_1562053_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|1562053_1562503_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 107
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1568309	1573606	5048496		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223238.1|1568309_1568555_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	36.8	6.3e-07
WP_000080951.1|1568551_1568962_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.1e-18
WP_000246589.1|1568934_1571079_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.1e-195
WP_000777929.1|1571088_1572048_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000985490.1|1572403_1573606_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 108
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1588349	1593735	5048496	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1588349_1588535_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047209.1|1588769_1591400_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
WP_000140506.1|1591527_1592028_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1592096_1593158_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132237.1|1593237_1593735_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	3.4e-31
>prophage 109
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1599203	1600169	5048496		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287404.1|1599203_1600169_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 110
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1607740	1608751	5048496		Enterobacteria_phage(100.0%)	1	NA	NA
WP_024174326.1|1607740_1608751_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	27.8	3.9e-26
>prophage 111
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1627638	1634778	5048496		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|1627638_1630200_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|1630305_1630962_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|1631012_1631780_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|1631975_1632884_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|1632880_1634143_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|1634139_1634778_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 112
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1639151	1642867	5048496		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1639151_1640144_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1640206_1641346_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254701.1|1641485_1642112_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1642105_1642867_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 113
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1645978	1648011	5048496		Tupanvirus(50.0%)	2	NA	NA
WP_001173653.1|1645978_1646584_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090357.1|1646583_1648011_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	1.3e-30
>prophage 114
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1662660	1663446	5048496		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021344.1|1662660_1663446_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.4e-20
>prophage 115
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1667020	1667692	5048496		Vibrio_phage(100.0%)	1	NA	NA
WP_001199974.1|1667020_1667692_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
>prophage 116
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1671507	1674531	5048496		Streptococcus_phage(50.0%)	2	NA	NA
WP_000036723.1|1671507_1672806_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1672893_1674531_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 117
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1678564	1682679	5048496		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046816.1|1678564_1679866_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	1.1e-38
WP_000186431.1|1679922_1682679_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.9e-54
>prophage 118
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1690211	1691060	5048496		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|1690211_1691060_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 119
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1695918	1696674	5048496		Bacillus_phage(100.0%)	1	NA	NA
WP_001296330.1|1695918_1696674_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 120
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1708250	1710756	5048496	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_001331603.1|1708250_1709456_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.5	3.2e-75
WP_000184272.1|1709455_1709899_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117716.1|1709949_1710756_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
>prophage 121
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1719501	1724639	5048496		Cronobacter_phage(50.0%)	2	NA	NA
WP_000147358.1|1719501_1722147_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.3	1.9e-96
WP_000512742.1|1722158_1724639_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.4	4.9e-06
>prophage 122
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1727951	1728212	5048496		Burkholderia_virus(100.0%)	1	NA	NA
WP_001117814.1|1727951_1728212_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	37.2	5.7e-06
>prophage 123
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1743027	1759642	5048496		Paramecium_bursaria_Chlorella_virus(14.29%)	10	NA	NA
WP_001331592.1|1743027_1743975_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-16
WP_001066237.1|1744046_1744643_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
WP_000382413.1|1744645_1745821_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810553.1|1745820_1747401_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	4.5e-05
WP_001314100.1|1747432_1748257_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|1748514_1749768_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|1749999_1751331_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775938.1|1751392_1753219_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	1.0e-24
WP_001331589.1|1753218_1756761_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138098.1|1756753_1759642_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	9.0e-68
>prophage 124
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1765119	1771892	5048496		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1765119_1765914_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1765920_1766796_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|1766946_1769193_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1769205_1769736_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082183.1|1770420_1771110_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1771178_1771892_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 125
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1781523	1784018	5048496		Aichi_virus(50.0%)	2	NA	NA
WP_000256426.1|1781523_1782942_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|1783256_1784018_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 126
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1788304	1789060	5048496		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|1788304_1789060_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 127
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1813339	1828731	5048496	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|1813339_1814740_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001296347.1|1814757_1816074_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012167.1|1816109_1817477_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_000838415.1|1817512_1818001_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001363023.1|1818000_1819920_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001363024.1|1820355_1821804_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	27.0	4.3e-26
WP_001050745.1|1821805_1821931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|1821927_1821999_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192798.1|1822053_1822602_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|1822644_1824162_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1824171_1825270_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813190.1|1825360_1827094_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_000715230.1|1827099_1827810_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806987.1|1827834_1828731_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 128
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1832536	1837009	5048496		Pandoravirus(50.0%)	2	NA	NA
WP_001350137.1|1832536_1833970_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	1.5e-31
WP_000195072.1|1834135_1837009_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	8.2e-263
>prophage 129
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1845145	1846378	5048496		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1845145_1846378_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 130
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1859873	1860551	5048496		Bacillus_virus(100.0%)	1	NA	NA
WP_000956879.1|1859873_1860551_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	6.4e-09
>prophage 131
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1865603	1866512	5048496		Yersinia_phage(100.0%)	1	NA	NA
WP_000646943.1|1865603_1866512_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	7.5e-53
>prophage 132
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1874666	1875821	5048496		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1874666_1875821_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 133
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1898516	1899779	5048496	integrase	Pseudomonas_phage(100.0%)	1	1889533:1889546	1900980:1900993
1889533:1889546	attL	TTTGCTGGCCCCAG	NA	NA	NA	NA
WP_001218820.1|1898516_1899779_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
WP_001218820.1|1898516_1899779_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
1900980:1900993	attR	TTTGCTGGCCCCAG	NA	NA	NA	NA
>prophage 134
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1928624	1937105	5048496	transposase	Mycobacterium_phage(33.33%)	5	NA	NA
WP_000999383.1|1928624_1929857_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.7	2.9e-60
WP_059348061.1|1929992_1930637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001332016.1|1930830_1932279_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_169059419.1|1932449_1933663_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.0	1.5e-165
WP_000792544.1|1935056_1937105_-	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
>prophage 135
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1945080	1947256	5048496		Yersinia_phage(33.33%)	4	NA	NA
WP_001175142.1|1945080_1945899_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.8e-45
WP_001596890.1|1945989_1946475_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.2	6.4e-11
WP_001186756.1|1946489_1946966_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692312.1|1947034_1947256_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
>prophage 136
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1952742	1953726	5048496		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001331698.1|1952742_1953726_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 137
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	1967307	1967967	5048496		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000590258.1|1967307_1967967_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.7	2.9e-06
>prophage 138
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2000646	2001819	5048496		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524959.1|2000646_2001819_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 139
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2024043	2024928	5048496		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|2024043_2024928_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 140
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2030771	2038090	5048496		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013152.1|2030771_2031599_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_000691616.1|2031798_2032725_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848521.1|2032775_2033033_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095186.1|2033074_2035294_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000438655.1|2035545_2036295_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001331680.1|2036617_2038090_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	1.7e-46
>prophage 141
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2045548	2050588	5048496		Bacillus_virus(50.0%)	4	NA	NA
WP_001281888.1|2045548_2047807_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
WP_001350728.1|2047944_2049552_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183493.1|2049660_2050143_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_000712658.1|2050195_2050588_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 142
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2058482	2070928	5048496		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_000986428.1|2058482_2059466_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
WP_000940869.1|2059462_2060272_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	2.7e-14
WP_001240663.1|2060645_2062787_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195274.1|2062850_2064743_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
WP_000105733.1|2064771_2065353_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444744.1|2065352_2066180_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2066204_2066627_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2066627_2067257_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|2067461_2068943_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2069090_2069762_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442855.1|2069767_2070928_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.4	9.1e-88
>prophage 143
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2082161	2082815	5048496		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|2082161_2082815_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 144
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2086728	2088162	5048496		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|2086728_2088162_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 145
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2093299	2094538	5048496	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708479.1|2093299_2094538_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 146
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2100946	2117131	5048496	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264377.1|2100946_2101960_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
WP_001144069.1|2102197_2102413_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918851.1|2102523_2104269_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	8.4e-77
WP_000437380.1|2104463_2106305_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2106383_2106890_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065876.1|2107143_2107908_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000120223.1|2108184_2108808_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094730.1|2108961_2110482_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_001297164.1|2110899_2112279_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000450588.1|2112320_2112653_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212450.1|2112871_2113855_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082822.1|2114038_2117131_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	8.5e-157
>prophage 147
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2128792	2129758	5048496		Escherichia_phage(100.0%)	1	NA	NA
WP_001098826.1|2128792_2129758_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 148
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2149636	2151931	5048496		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861709.1|2149636_2151931_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 149
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2158079	2159225	5048496		Streptococcus_phage(100.0%)	1	NA	NA
WP_001298324.1|2158079_2159225_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	2.8e-49
>prophage 150
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2175908	2183704	5048496		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|2175908_2176772_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_000249166.1|2176836_2178873_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246833.1|2178830_2179226_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|2179245_2179836_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2179845_2180421_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147637.1|2180533_2181574_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|2181646_2182282_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001350722.1|2182409_2182928_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	1.7e-09
WP_000449450.1|2182907_2183351_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189322.1|2183401_2183704_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 151
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2189411	2191301	5048496		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2189411_2191301_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 152
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2196782	2203421	5048496		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133040.1|2196782_2199455_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
WP_001031057.1|2199479_2200967_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2200994_2201447_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207671.1|2202077_2203421_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 153
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2207498	2210371	5048496	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764750.1|2207498_2208347_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	2.6e-23
WP_001107467.1|2208436_2210371_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 154
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2217000	2218483	5048496		Indivirus(50.0%)	2	NA	NA
WP_001047338.1|2217000_2217972_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445401.1|2218204_2218483_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	69.8	2.2e-16
>prophage 155
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2222551	2237346	5048496		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2222551_2223361_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922880.1|2223570_2224548_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2224561_2225548_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|2225568_2226135_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2226131_2226707_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2226675_2227233_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2227239_2227965_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2228012_2229446_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2229468_2229756_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183674.1|2229873_2230365_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2230410_2231265_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2231261_2231534_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620407.1|2231747_2232380_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047069.1|2232376_2233105_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719794.1|2233101_2233755_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809780.1|2233984_2236321_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001296449.1|2236416_2237346_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 156
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2246049	2250060	5048496	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_000108476.1|2246049_2247540_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224714.1|2247648_2248542_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000074795.1|2248663_2249455_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366127.1|2249562_2250060_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 157
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2254027	2256552	5048496	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001298588.1|2254027_2255395_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
WP_000497723.1|2255484_2256552_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 158
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2273046	2274090	5048496		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2273046_2274090_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 159
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2283377	2287889	5048496		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000132905.1|2283377_2284877_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.7	5.2e-11
WP_001331656.1|2284937_2285828_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275539.1|2285863_2286718_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843960.1|2287058_2287889_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 160
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2293228	2294113	5048496		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258951.1|2293228_2294113_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 161
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2300617	2304771	5048496		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738577.1|2300617_2301643_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
WP_071686831.1|2301710_2302892_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001351032.1|2302901_2304005_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078319.1|2304012_2304771_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.5e-19
>prophage 162
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2315107	2316579	5048496	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2315107_2315617_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004421.1|2315631_2316579_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 163
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2337803	2339756	5048496		Vibrio_phage(100.0%)	1	NA	NA
WP_001363052.1|2337803_2339756_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	31.1	9.2e-32
>prophage 164
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2348604	2357171	5048496		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773166.1|2348604_2351307_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	1.5e-40
WP_000031783.1|2351598_2352783_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2352853_2354968_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2355064_2355535_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2355631_2356006_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903381.1|2356131_2356419_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820734.1|2356425_2356785_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	3.1e-10
WP_001209702.1|2356784_2357171_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	4.3e-18
>prophage 165
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2362741	2372281	5048496		Tupanvirus(25.0%)	9	NA	NA
WP_000634747.1|2362741_2364655_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.1	4.7e-73
WP_000057415.1|2364654_2365677_+	hydrolase	NA	NA	NA	NA	NA
WP_000907086.1|2365670_2365889_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	4.0e-05
WP_001274684.1|2365942_2366812_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2366866_2367271_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2367572_2368205_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001304921.1|2368255_2370346_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000963803.1|2370412_2371633_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601853.1|2371717_2372281_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
>prophage 166
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2391179	2392016	5048496		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2391179_2392016_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 167
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2408826	2412593	5048496		Bacillus_phage(66.67%)	3	NA	NA
WP_001309803.1|2408826_2410449_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253708.1|2410524_2411877_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2411873_2412593_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 168
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2419169	2420063	5048496		Sodalis_phage(100.0%)	1	NA	NA
WP_000039083.1|2419169_2420063_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 169
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2426223	2428617	5048496		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081889.1|2426223_2428617_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 170
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2433007	2434234	5048496		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105471.1|2433007_2434234_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 171
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2449636	2452084	5048496		Dickeya_phage(100.0%)	1	NA	NA
WP_000993444.1|2449636_2452084_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 172
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2471954	2473765	5048496		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073603.1|2471954_2472698_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.4e-11
WP_000907827.1|2472694_2473765_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 173
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2477306	2478789	5048496		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|2477306_2478020_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|2478021_2478789_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 174
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2487680	2492407	5048496		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_001332164.1|2487680_2488601_+	phosphoglycerate dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	30.7	3.3e-24
WP_000661262.1|2488600_2489485_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000130217.1|2489588_2490443_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2490687_2491746_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2491738_2492407_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 175
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2495413	2499712	5048496		Dickeya_phage(50.0%)	4	NA	NA
WP_000964729.1|2495413_2496040_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.1	2.7e-30
WP_000106588.1|2496113_2498312_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.6	1.0e-119
WP_000130621.1|2498580_2498826_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|2499046_2499712_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 176
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2507605	2508412	5048496		Bacillus_virus(100.0%)	1	NA	NA
WP_000173679.1|2507605_2508412_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
>prophage 177
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2515851	2518587	5048496		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149184.1|2515851_2518587_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 178
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2528273	2530316	5048496		Indivirus(100.0%)	1	NA	NA
WP_032153433.1|2528273_2530316_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	2.3e-46
>prophage 179
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2533455	2533881	5048496		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000065791.1|2533455_2533881_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
>prophage 180
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2544552	2546022	5048496		Pithovirus(50.0%)	2	NA	NA
WP_001332154.1|2544552_2545323_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	1.7e-18
WP_000123131.1|2545374_2546022_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 181
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2588559	2590544	5048496		Bacillus_virus(50.0%)	2	NA	NA
WP_000103579.1|2588559_2589564_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196477.1|2589560_2590544_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 182
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2600429	2602763	5048496		Escherichia_phage(100.0%)	1	NA	NA
WP_000013974.1|2600429_2602763_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	3.7e-72
>prophage 183
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2606417	2606630	5048496		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2606417_2606630_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 184
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2610851	2611847	5048496		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182635.1|2610851_2611847_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.0e-11
>prophage 185
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2617165	2618707	5048496		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146514.1|2617165_2618707_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	8.6e-17
>prophage 186
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2638281	2642893	5048496		Clostridioides_phage(50.0%)	3	NA	NA
WP_000985743.1|2638281_2639577_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	3.7e-21
WP_000741500.1|2639706_2640858_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000582432.1|2641048_2642893_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 187
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2665019	2674525	5048496		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2665019_2665271_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2665411_2665843_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|2666087_2667632_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214150.1|2667641_2668925_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483824.1|2668928_2669888_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982107.1|2669874_2670909_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000646018.1|2671147_2672173_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213847.1|2672182_2673379_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.4e-35
WP_000587750.1|2673592_2674525_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 188
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2677933	2680027	5048496		Catovirus(50.0%)	2	NA	NA
WP_000064025.1|2677933_2678917_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-12
WP_000364803.1|2678998_2680027_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	5.5e-12
>prophage 189
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2687465	2692028	5048496		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|2687465_2687945_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|2687983_2688793_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2688890_2689058_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2689078_2689315_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|2689531_2690200_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050149.1|2690371_2691592_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	8.5e-44
WP_000976066.1|2691569_2692028_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	1.6e-48
>prophage 190
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2695369	2720121	5048496	integrase	Morganella_phage(35.71%)	28	2692590:2692603	2722396:2722409
2692590:2692603	attL	GACGGATGAAACCC	NA	NA	NA	NA
WP_001351217.1|2695369_2696638_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.3	5.1e-193
WP_001059729.1|2696634_2697285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001363069.1|2697756_2697975_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000412532.1|2697974_2698406_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
WP_001019373.1|2698418_2699252_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	9.0e-21
WP_000042975.1|2699244_2699424_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000613400.1|2699420_2700488_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	8.6e-16
WP_001065741.1|2700480_2700675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024678.1|2700671_2700935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|2700931_2701153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058741.1|2701145_2701748_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	33.3	2.6e-22
WP_001332287.1|2701760_2704112_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	48.2	1.7e-72
WP_000987941.1|2704288_2704519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001064134.1|2704508_2705246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018522.1|2705849_2706023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000246976.1|2706027_2707371_+	phage DNA ejection protein	NA	A0A0M5M1J8	Salmonella_phage	71.4	1.0e-159
WP_000729825.1|2707355_2709473_+	hypothetical protein	NA	A0A2D1GLK8	Escherichia_phage	54.1	1.2e-162
WP_001363070.1|2709492_2709888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072645.1|2710799_2711282_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
WP_000204055.1|2711285_2711663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000230710.1|2711679_2712123_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	65.7	4.8e-45
WP_000617439.1|2712382_2712670_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297973.1|2713370_2714195_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.5	1.3e-91
WP_000924289.1|2714486_2715104_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001363072.1|2715100_2716783_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.4	6.7e-23
WP_001295237.1|2717040_2717664_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2717718_2717994_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|2718012_2720121_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
2722396:2722409	attR	GACGGATGAAACCC	NA	NA	NA	NA
>prophage 191
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2724422	2725814	5048496		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2724422_2725814_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 192
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2739075	2740113	5048496		Wolbachia_phage(100.0%)	1	NA	NA
WP_001280586.1|2739075_2740113_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 193
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2745554	2746889	5048496		Moraxella_phage(100.0%)	1	NA	NA
WP_001363077.1|2745554_2746889_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 194
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2754193	2766070	5048496		Micromonas_sp._RCC1109_virus(20.0%)	11	NA	NA
WP_000168473.1|2754193_2755882_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.2e-56
WP_001312198.1|2755987_2756086_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001332269.1|2756486_2757671_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_000148034.1|2757678_2758176_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113443.1|2758172_2758535_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2758524_2758872_-	YidH family protein	NA	NA	NA	NA	NA
WP_001087168.1|2760420_2762136_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.0	6.1e-40
WP_001332266.1|2762302_2763169_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279773.1|2763258_2764920_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|2765116_2765545_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2765656_2766070_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 195
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2770499	2771648	5048496		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|2770499_2771648_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 196
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2776353	2783722	5048496		Bacillus_virus(33.33%)	8	NA	NA
WP_001298010.1|2776353_2778768_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.8e-115
WP_000060112.1|2778796_2779870_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2779869_2780970_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2780974_2782378_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122083097.1|2782674_2782755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|2782984_2783125_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2783141_2783501_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2783464_2783722_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 197
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2793919	2795257	5048496		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|2793919_2795257_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 198
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2805628	2813143	5048496		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|2805628_2806402_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251985.1|2806492_2807383_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2807382_2808342_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2808428_2809469_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|2809782_2811612_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933754.1|2811772_2813143_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
>prophage 199
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2825098	2826091	5048496		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845129.1|2825098_2826091_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	2.2e-50
>prophage 200
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2829259	2835112	5048496		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|2829259_2831128_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001350412.1|2831294_2831714_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387779.1|2831721_2833227_+	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	5.1e-14
WP_000211858.1|2833231_2834197_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|2834221_2835112_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 201
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2848503	2850150	5048496		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012594.1|2848503_2850150_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.5e-67
>prophage 202
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2857746	2863160	5048496		Bacillus_phage(33.33%)	4	NA	NA
WP_001238853.1|2857746_2859768_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	1.9e-112
WP_001314257.1|2859814_2861299_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|2861434_2862700_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2862830_2863160_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 203
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2867202	2873346	5048496		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866674.1|2867202_2868333_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	2.3e-27
WP_000006614.1|2868329_2869592_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	7.7e-24
WP_001226621.1|2869591_2870659_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.8e-102
WP_000676056.1|2870677_2871559_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145189.1|2871536_2872211_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612051.1|2872215_2873346_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 204
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2881420	2883076	5048496		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395836.1|2881420_2883076_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 205
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2891187	2892504	5048496		Salmonella_phage(100.0%)	1	NA	NA
WP_001014285.1|2891187_2892504_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	49.1	3.5e-11
>prophage 206
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2895923	2899782	5048496		Bacillus_phage(100.0%)	3	NA	NA
WP_000130676.1|2895923_2896820_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213586.1|2896819_2897536_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|2897619_2899782_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 207
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2907152	2908982	5048496		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2907152_2908982_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 208
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2919441	2920950	5048496		Vibrio_phage(100.0%)	1	NA	NA
WP_000037973.1|2919441_2920950_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 209
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2942945	2946232	5048496		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|2942945_2944586_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|2944664_2944934_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459600.1|2944937_2945453_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109949.1|2945455_2946232_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 210
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2955113	2955728	5048496		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|2955113_2955728_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 211
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2969415	2972202	5048496		uncultured_virus(100.0%)	1	NA	NA
WP_000250046.1|2969415_2972202_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 212
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2976228	2978699	5048496		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001315107.1|2976228_2977638_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190574.1|2977649_2978699_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
>prophage 213
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2982584	2987314	5048496		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|2982584_2983373_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_001363089.1|2983412_2984309_-	sugar kinase	NA	NA	NA	NA	NA
WP_000190782.1|2984480_2985359_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.0e-47
WP_000094544.1|2985383_2986271_+	aldolase	NA	NA	NA	NA	NA
WP_000357981.1|2986303_2987314_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 214
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	2999910	3002961	5048496		Escherichia_phage(100.0%)	1	NA	NA
WP_012579028.1|2999910_3002961_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 215
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3014064	3018925	5048496		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001350871.1|3014064_3014685_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	2.4e-63
WP_016233703.1|3014944_3015928_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270237.1|3016076_3016751_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3016856_3018230_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|3018226_3018925_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 216
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3030535	3035038	5048496		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3030535_3031381_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3031805_3032051_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3032135_3032621_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|3032713_3033640_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3033706_3035038_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 217
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3048248	3052842	5048496		Pandoravirus(100.0%)	3	NA	NA
WP_000859437.1|3048248_3049799_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	3.4e-05
WP_000105536.1|3050031_3051156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694069.1|3051288_3052842_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	7.8e-10
>prophage 218
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3059655	3066902	5048496		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424854.1|3059655_3060318_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
WP_001185153.1|3060329_3062831_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004469.1|3063139_3064219_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3064233_3064554_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184865.1|3064604_3066902_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 219
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3079046	3080261	5048496		Oenococcus_phage(100.0%)	1	NA	NA
WP_000691040.1|3079046_3080261_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	27.9	3.8e-44
>prophage 220
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3085572	3091355	5048496	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_000125464.1|3085572_3086889_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	1.6e-59
WP_122083113.1|3086992_3087643_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806411.1|3087642_3088002_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000187001.1|3088041_3089142_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000591379.1|3089510_3091355_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
>prophage 221
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3099696	3102749	5048496		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3099696_3100647_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3101564_3102749_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 222
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3106744	3115073	5048496		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3106744_3110773_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653952.1|3110849_3115073_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
>prophage 223
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3123367	3125131	5048496		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3123367_3124039_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|3124081_3124672_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3124858_3125131_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 224
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3130493	3132083	5048496		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187584.1|3130493_3132083_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 225
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3145780	3149464	5048496		Dickeya_phage(100.0%)	1	NA	NA
WP_000096034.1|3145780_3149464_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 226
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3173805	3174921	5048496		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3173805_3174921_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 227
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3182361	3182970	5048496		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3182361_3182970_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 228
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3195265	3199388	5048496		Escherichia_phage(25.0%)	4	NA	NA
WP_001296639.1|3195265_3196681_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
WP_001147328.1|3196733_3197813_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000122235.1|3197835_3198393_+	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	28.8	1.7e-15
WP_001331852.1|3198389_3199388_+	AAA family ATPase	NA	K4F711	Cronobacter_phage	30.7	7.0e-28
>prophage 229
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3204787	3206206	5048496		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000103922.1|3204787_3206206_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.6e-38
>prophage 230
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3216149	3219762	5048496		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357763.1|3216149_3218972_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
WP_000168305.1|3219225_3219762_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 231
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3223579	3224929	5048496		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|3223579_3224929_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 232
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3231135	3233094	5048496		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078225.1|3231135_3233094_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	2.5e-90
>prophage 233
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3242464	3243992	5048496		Bacillus_virus(50.0%)	2	NA	NA
WP_000156933.1|3242464_3243169_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	4.6e-18
WP_000132446.1|3243155_3243992_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
>prophage 234
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3247909	3250057	5048496		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|3247909_3250057_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 235
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3255301	3261672	5048496		Tetraselmis_virus(50.0%)	4	NA	NA
WP_001363000.1|3255301_3257287_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	3.8e-150
WP_001171671.1|3257561_3258491_-	allose kinase	NA	NA	NA	NA	NA
WP_001314355.1|3258474_3259170_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000235242.1|3260139_3261672_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	4.4e-13
>prophage 236
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3267787	3269337	5048496		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611410.1|3267787_3268468_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001075531.1|3268578_3269337_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
>prophage 237
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3274941	3275730	5048496		Pithovirus(100.0%)	1	NA	NA
WP_001193413.1|3274941_3275730_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.9e-12
>prophage 238
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3280570	3282073	5048496		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|3280570_3282073_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 239
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3301636	3304848	5048496	tRNA	Catovirus(50.0%)	2	NA	NA
WP_000003806.1|3301636_3303154_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856826.1|3303390_3304848_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
>prophage 240
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3313183	3315546	5048496		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692347.1|3313183_3313405_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
WP_001186193.1|3313491_3313968_-	RadC family protein	NA	NA	NA	NA	NA
WP_000706978.1|3313982_3314462_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	1.2e-12
WP_001175155.1|3314727_3315546_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	2.5e-47
>prophage 241
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3327049	3330631	5048496		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001001003.1|3327049_3328201_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.2	1.3e-107
WP_000494233.1|3328329_3329385_-	response regulator	NA	NA	NA	NA	NA
WP_000792585.1|3329401_3330631_-	PocR ligand-binding domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	30.3	5.6e-19
>prophage 242
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3337456	3338032	5048496		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000722279.1|3337456_3338032_-	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.8	1.5e-14
>prophage 243
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3372901	3374167	5048496	integrase	Enterobacteria_phage(100.0%)	1	3360872:3360885	3375818:3375831
3360872:3360885	attL	AATTACCGTCTTTG	NA	NA	NA	NA
WP_021519580.1|3372901_3374167_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.5e-77
WP_021519580.1|3372901_3374167_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.5e-77
3375818:3375831	attR	CAAAGACGGTAATT	NA	NA	NA	NA
>prophage 244
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3382501	3384485	5048496		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3382501_3382795_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3382838_3384485_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 245
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3388689	3389223	5048496		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|3388689_3389223_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 246
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3394143	3395121	5048496		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3394143_3395121_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 247
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3403117	3403663	5048496		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3403117_3403663_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 248
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3407578	3420609	5048496	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990304.1|3407578_3408916_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	3.3e-17
WP_001298688.1|3408925_3410773_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_001280359.1|3410765_3411716_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3411801_3412110_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460357.1|3412185_3413466_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312482.1|3413551_3414811_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3414813_3415818_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3415899_3416097_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3416200_3417499_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3417703_3418129_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076340.1|3418167_3420609_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
>prophage 249
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3424452	3425616	5048496		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944012.1|3424452_3425616_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
>prophage 250
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3467864	3474352	5048496		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|3467864_3468395_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265925.1|3468704_3469661_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205834.1|3469800_3471303_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	6.2e-12
WP_001298067.1|3471316_3472339_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595996.1|3472325_3473321_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3473353_3474352_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 251
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3478670	3481431	5048496		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106233.1|3478670_3479135_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187799.1|3479292_3481431_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 252
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3485069	3491166	5048496		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|3485069_3486017_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3486201_3486255_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471858.1|3486395_3489092_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	1.5e-45
WP_000047539.1|3489297_3489684_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3489756_3490218_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3490230_3491166_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 253
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3501512	3510692	5048496	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416385.1|3501512_3504368_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|3504367_3504811_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3505068_3506580_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3506846_3507947_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001331766.1|3507946_3509029_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294566.1|3509189_3510692_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.1e-82
>prophage 254
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3515821	3516841	5048496		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000061766.1|3515821_3516841_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
>prophage 255
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3520108	3521020	5048496		Caulobacter_phage(100.0%)	1	NA	NA
WP_001082109.1|3520108_3521020_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.6	5.5e-48
>prophage 256
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3524699	3528959	5048496		Escherichia_phage(50.0%)	2	NA	NA
WP_000236931.1|3524699_3527669_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	32.9	7.3e-81
WP_000643690.1|3527762_3528959_-	DNA cytosine methyltransferase	NA	A0A191SAU1	Nostoc_phage	30.8	2.2e-36
>prophage 257
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3541399	3545218	5048496	transposase	Enterobacteria_phage(100.0%)	5	NA	NA
WP_000416151.1|3541399_3542431_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|3542701_3543145_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|3543160_3543448_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|3543460_3544717_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|3544963_3545218_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
>prophage 258
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3552778	3554937	5048496	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_031935995.1|3552778_3554173_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.2	1.2e-256
WP_000612632.1|3554212_3554560_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_001171523.1|3554556_3554937_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 259
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3566177	3568578	5048496		Yersinia_phage(33.33%)	4	NA	NA
WP_001234738.1|3566177_3566996_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_000855061.1|3567337_3567802_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.0	1.2e-14
WP_001557203.1|3567817_3568294_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|3568356_3568578_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 260
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3575090	3576281	5048496		Bacillus_phage(100.0%)	1	NA	NA
WP_001295727.1|3575090_3576281_+	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
>prophage 261
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3579421	3581497	5048496		Acidithiobacillus_phage(100.0%)	1	NA	NA
WP_000366620.1|3579421_3581497_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	33.8	7.7e-37
>prophage 262
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3605140	3606121	5048496		Escherichia_phage(100.0%)	1	NA	NA
WP_000991462.1|3605140_3606121_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
>prophage 263
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3609480	3611157	5048496		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|3609480_3610083_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|3610560_3611157_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 264
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3621360	3622821	5048496		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|3621360_3622821_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 265
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3630165	3630720	5048496		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|3630165_3630720_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 266
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3643305	3648668	5048496		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000919544.1|3643305_3644970_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000091572.1|3646592_3647507_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106037.1|3647645_3648668_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 267
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3651892	3653172	5048496		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3651892_3652630_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|3652632_3653172_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 268
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3660998	3663874	5048496		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|3660998_3662588_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3662980_3663586_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3663712_3663874_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 269
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3669852	3671175	5048496		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3669852_3671175_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 270
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3677917	3683272	5048496		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093807.1|3677917_3679150_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|3679456_3681124_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409455.1|3681334_3683272_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 271
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3686555	3688669	5048496		Bacillus_phage(50.0%)	2	NA	NA
WP_001188687.1|3686555_3687245_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219586.1|3687244_3688669_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	1.1e-10
>prophage 272
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3700324	3701278	5048496		Cyanophage(100.0%)	1	NA	NA
WP_000130187.1|3700324_3701278_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 273
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3704414	3718935	5048496	tRNA	Chrysochromulina_ericina_virus(16.67%)	12	NA	NA
WP_000516135.1|3704414_3706331_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3706419_3707550_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|3707654_3707864_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001274823.1|3708418_3709180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350775.1|3709199_3710693_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	2.8e-28
WP_000494924.1|3710821_3712081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681386.1|3712315_3713482_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.8	3.0e-91
WP_000062878.1|3713541_3714447_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001274021.1|3714542_3714806_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001337277.1|3714908_3715127_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_000767329.1|3715134_3716076_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001286813.1|3716118_3718935_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	25.7	4.6e-77
>prophage 274
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3723743	3724892	5048496		Halovirus(100.0%)	1	NA	NA
WP_001295757.1|3723743_3724892_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 275
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3728354	3736765	5048496	transposase	Saccharomonospora_phage(33.33%)	8	NA	NA
WP_000526115.1|3728354_3728813_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000333104.1|3729102_3729498_+	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_032153352.1|3729616_3730207_-	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_000004399.1|3730212_3730998_-	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001350362.1|3731106_3732660_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.9e-35
WP_000349942.1|3732732_3733950_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3734077_3735220_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|3735250_3736765_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 276
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3744659	3746621	5048496		Bacillus_phage(50.0%)	5	NA	NA
WP_000624375.1|3744659_3745139_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|3745224_3745458_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_001332330.1|3745460_3745583_+	CcdB family protein	NA	NA	NA	NA	NA
WP_146692624.1|3745623_3745776_+	CcdB family protein	NA	NA	NA	NA	NA
WP_000257201.1|3745772_3746621_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 277
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3754398	3759820	5048496		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|3754398_3757305_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035622.1|3757468_3759820_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	6.7e-37
>prophage 278
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3768096	3768795	5048496		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916269.1|3768096_3768795_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-21
>prophage 279
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3780273	3781998	5048496		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425644.1|3780273_3781998_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 280
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3807968	3809012	5048496		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3807968_3809012_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 281
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3813258	3813810	5048496		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923703.1|3813258_3813810_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 282
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3826224	3827649	5048496		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3826224_3827649_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 283
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3835469	3841937	5048496		Mamastrovirus(33.33%)	5	NA	NA
WP_001189635.1|3835469_3837020_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.1e-18
WP_001332319.1|3837066_3839457_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3839662_3840199_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651600.1|3840239_3840902_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|3841010_3841937_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 284
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3845199	3846084	5048496		Sodalis_phage(100.0%)	1	NA	NA
WP_000339931.1|3845199_3846084_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	48.4	1.0e-59
>prophage 285
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3855975	3862781	5048496	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|3855975_3857394_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937401.1|3857432_3858359_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3858395_3858851_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396047.1|3859028_3859733_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294708.1|3859747_3860278_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001362943.1|3860351_3862781_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	1.0e-40
>prophage 286
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3867922	3868720	5048496		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3867922_3868720_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 287
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3874631	3874976	5048496		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3874631_3874976_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 288
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3878905	3880330	5048496	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753936.1|3878905_3880330_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 289
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3891907	3892666	5048496		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|3891907_3892666_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 290
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3901494	3905610	5048496		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569434.1|3901494_3902091_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294798.1|3902127_3905610_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
>prophage 291
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3918569	3919601	5048496		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3918569_3919601_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 292
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3926121	3933973	5048496		Indivirus(25.0%)	9	NA	NA
WP_000997016.1|3926121_3926925_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
WP_000648548.1|3926921_3927836_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3928076_3928877_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211705.1|3928954_3929725_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3929771_3931130_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052741.1|3931201_3931957_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|3931990_3932713_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3932709_3933177_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|3933241_3933973_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 293
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3943235	3945995	5048496		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614314.1|3943235_3945995_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	4.7e-82
>prophage 294
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3956685	3958668	5048496		Ralstonia_phage(100.0%)	1	NA	NA
WP_000053636.1|3956685_3958668_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-26
>prophage 295
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3968248	3971571	5048496		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|3968248_3968827_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001331866.1|3969031_3969799_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3969769_3970510_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|3970821_3971571_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
>prophage 296
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3977544	3978696	5048496		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001331869.1|3977544_3978696_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
>prophage 297
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	3983444	3993055	5048496		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000749902.1|3983444_3984500_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|3984788_3985892_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|3985903_3987157_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
WP_000772638.1|3987501_3987840_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	49.5	4.3e-22
WP_001298126.1|3988274_3988799_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001034008.1|3988924_3993055_-	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.6	3.3e-281
>prophage 298
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4011338	4012190	5048496		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|4011338_4012190_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 299
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4018295	4021600	5048496		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001295799.1|4018295_4019165_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_001298546.1|4019324_4019918_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474088.1|4019929_4020166_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046332.1|4020274_4021600_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
>prophage 300
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4031525	4039097	5048496	integrase,holin	Escherichia_phage(33.33%)	5	4030242:4030255	4033239:4033252
4030242:4030255	attL	AACGCATCCTTCCC	NA	NA	NA	NA
WP_001295805.1|4031525_4032089_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001159135.1|4033159_4034848_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
4033239:4033252	attR	AACGCATCCTTCCC	NA	NA	NA	NA
WP_001350625.1|4034861_4036334_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001314510.1|4036347_4036935_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131041.1|4037063_4039097_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 301
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4051836	4056374	5048496		Bacillus_virus(50.0%)	4	NA	NA
WP_000447331.1|4051836_4053321_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818902.1|4053313_4054285_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750346.1|4054281_4055238_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692719.1|4055324_4056374_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.8e-71
>prophage 302
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4063905	4065792	5048496		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010273.1|4063905_4065792_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	1.8e-53
>prophage 303
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4070751	4078033	5048496		Herpes_simplex_virus(33.33%)	5	NA	NA
WP_000177872.1|4070751_4073826_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.5	0.0e+00
WP_000805859.1|4073948_4075031_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	2.4e-191
WP_001096705.1|4075232_4075772_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000419070.1|4075997_4076831_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842109.1|4076923_4078033_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 304
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4083325	4084093	5048496		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939359.1|4083325_4084093_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 305
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4091001	4092159	5048496		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830766.1|4091001_4092159_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 306
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4099574	4100690	5048496		Bacillus_phage(100.0%)	1	NA	NA
WP_000484068.1|4099574_4100690_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 307
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4104979	4115077	5048496		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4104979_4105891_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219315.1|4106015_4106924_+	fructokinase	NA	NA	NA	NA	NA
WP_001331503.1|4107192_4108377_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698877.1|4108502_4111646_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221279.1|4111642_4112845_-	exonuclease subunit SbcD	NA	L0LAJ8	Bacillus_phage	25.1	9.1e-06
WP_000113932.1|4113034_4113724_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	1.5e-37
WP_000893603.1|4113781_4115077_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 308
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4122154	4130996	5048496	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4122154_4123282_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4123304_4123637_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934823.1|4123664_4125512_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4125522_4126494_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_001317658.1|4126623_4126971_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_071686815.1|4127008_4127893_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001298536.1|4128190_4128730_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4128880_4129330_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150487.1|4129333_4130437_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.7e-54
WP_001350619.1|4130525_4130996_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 309
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4152438	4157485	5048496	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4152438_4153062_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4153187_4154462_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4154649_4157004_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4157212_4157485_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 310
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4160625	4161321	5048496		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|4160625_4161321_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 311
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4164644	4168191	5048496		Bacillus_phage(100.0%)	2	NA	NA
WP_001235600.1|4164644_4166417_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.4e-50
WP_001256184.1|4166409_4168191_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	2.0e-41
>prophage 312
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4177028	4180178	5048496		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4177028_4180178_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 313
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4187186	4195644	5048496		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4187186_4187738_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122015.1|4187866_4189798_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4189850_4190180_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4190179_4190785_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678211.1|4190894_4192769_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.4e-117
WP_001331495.1|4192949_4193594_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250114.1|4193725_4194688_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801795.1|4194684_4195644_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	5.0e-15
>prophage 314
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4205206	4208448	5048496		Escherichia_phage(66.67%)	3	NA	NA
WP_000057524.1|4205206_4205509_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	2.2e-41
WP_000806442.1|4205544_4205886_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083945.1|4205943_4208448_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.0e-115
>prophage 315
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4215546	4216224	5048496		Bacillus_virus(100.0%)	1	NA	NA
WP_001157551.1|4215546_4216224_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 316
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4219360	4220047	5048496		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110564.1|4219360_4220047_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.9e-32
>prophage 317
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4234272	4235418	5048496		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331490.1|4234272_4235418_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 318
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4247272	4251748	5048496	tail,tRNA	Moumouvirus(33.33%)	5	NA	NA
WP_000912345.1|4247272_4248658_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143516.1|4248693_4249215_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4249322_4249535_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4249536_4250403_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001331487.1|4251391_4251748_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	67.5	3.8e-53
>prophage 319
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4260551	4262667	5048496		Hokovirus(50.0%)	2	NA	NA
WP_000253820.1|4260551_4261994_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	1.7e-11
WP_000770953.1|4261983_4262667_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 320
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4265812	4268956	5048496		Leptospira_phage(100.0%)	1	NA	NA
WP_000573983.1|4265812_4268956_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.3e-59
>prophage 321
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4279908	4285951	5048496		Tupanvirus(50.0%)	3	NA	NA
WP_000077765.1|4279908_4283790_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	1.7e-61
WP_000096768.1|4284005_4285139_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140634.1|4285135_4285951_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
>prophage 322
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4300253	4302076	5048496		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502940.1|4300253_4300883_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_000029771.1|4300855_4302076_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	2.7e-58
>prophage 323
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4305181	4307296	5048496		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4305181_4306747_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_001308472.1|4306867_4307296_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
>prophage 324
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4321384	4322031	5048496		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4321384_4321594_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4321647_4322031_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 325
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4326246	4328686	5048496		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4326246_4327458_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231442.1|4327597_4328686_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 326
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4335696	4340819	5048496	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001362899.1|4335696_4338279_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	8.9e-184
WP_001044880.1|4338513_4338996_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207539.1|4339040_4339976_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631389.1|4340093_4340819_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 327
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4348766	4349807	5048496		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|4348766_4349807_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 328
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4353945	4355610	5048496		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4353945_4355610_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 329
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4360235	4362182	5048496		Vibrio_phage(100.0%)	1	NA	NA
WP_001023115.1|4360235_4362182_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 330
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4370480	4373126	5048496	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_000679501.1|4370480_4371242_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
WP_001287134.1|4371461_4373126_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 331
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4377278	4378043	5048496		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773263.1|4377278_4378043_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	7.5e-06
>prophage 332
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4384698	4396531	5048496		Hokovirus(40.0%)	10	NA	NA
WP_000186082.1|4384698_4385376_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001350605.1|4385372_4388057_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_001331974.1|4388049_4388622_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087931.1|4388630_4390679_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	7.9e-26
WP_000730081.1|4390701_4392375_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4392374_4392464_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424788.1|4392776_4392983_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001075783.1|4393083_4393593_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000207170.1|4393589_4395008_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	4.7e-62
WP_001032722.1|4395049_4396531_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
>prophage 333
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4399909	4400701	5048496		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114008.1|4399909_4400701_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.4	3.7e-08
>prophage 334
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4428112	4431632	5048496		Vibrio_phage(33.33%)	4	NA	NA
WP_000345406.1|4428112_4428832_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_000951260.1|4428828_4429770_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.7e-23
WP_000784341.1|4429883_4430264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109195.1|4430579_4431632_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
>prophage 335
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4435995	4442571	5048496		Tupanvirus(33.33%)	7	NA	NA
WP_001265445.1|4435995_4437012_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	8.0e-80
WP_000096843.1|4437274_4438747_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	1.6e-12
WP_001147445.1|4438814_4439603_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4439731_4439881_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113014.1|4440047_4440821_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604040.1|4440820_4441510_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891671.1|4441512_4442571_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	9.7e-20
>prophage 336
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4452831	4454121	5048496		Klosneuvirus(100.0%)	1	NA	NA
WP_001362906.1|4452831_4454121_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 337
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4460448	4461357	5048496		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331964.1|4460448_4461357_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	3.7e-28
>prophage 338
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4471955	4476944	5048496		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_001596675.1|4471955_4473692_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000976402.1|4473684_4474683_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001295890.1|4474682_4475354_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007119.1|4475582_4476944_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
>prophage 339
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4482598	4483616	5048496		Salmonella_phage(50.0%)	2	NA	NA
WP_000146357.1|4482598_4482865_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990167.1|4482938_4483616_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	6.9e-19
>prophage 340
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4490179	4495404	5048496		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4490179_4490902_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4490898_4491558_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4491696_4492443_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4492846_4493350_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4493648_4494536_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_122083111.1|4494770_4494836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295296.1|4494888_4495404_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 341
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4500401	4507285	5048496		Tupanvirus(33.33%)	5	NA	NA
WP_000961458.1|4500401_4501994_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000114251.1|4502193_4503009_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209353.1|4503154_4505587_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000576970.1|4505592_4506492_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001350598.1|4506622_4507285_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
>prophage 342
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4510500	4512372	5048496		Planktothrix_phage(100.0%)	1	NA	NA
WP_001350597.1|4510500_4512372_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 343
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4523706	4524909	5048496		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001467835.1|4523706_4524909_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.4e-99
>prophage 344
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4533456	4542605	5048496		Vibrio_phage(25.0%)	11	NA	NA
WP_001195230.1|4533456_4533714_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_001201575.1|4533873_4534161_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|4534144_4534867_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4534927_4535830_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4535917_4536394_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|4536743_4537856_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|4537950_4539084_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105433.1|4539093_4540047_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061669.1|4540043_4540889_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4540948_4541437_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149763.1|4541477_4542605_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
>prophage 345
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4545730	4548468	5048496		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|4545730_4546459_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001298306.1|4546676_4547192_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4547317_4547641_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255187.1|4547637_4548468_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
>prophage 346
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4552055	4553774	5048496		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815373.1|4552055_4553774_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
>prophage 347
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4562897	4596232	5048496	protease,tRNA	Vibrio_phage(20.0%)	21	NA	NA
WP_000188147.1|4562897_4564844_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4564916_4565141_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4565463_4565784_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_137562881.1|4565814_4568091_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|4568983_4569967_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|4569963_4573197_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000415806.1|4573526_4574834_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001029748.1|4575764_4576766_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000350182.1|4576776_4577331_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001040187.1|4578372_4578591_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|4578875_4579580_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202198.1|4579621_4581343_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043638.1|4581343_4583110_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_000537432.1|4583232_4584198_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|4584741_4585236_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077107.1|4585370_4589414_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4589572_4590184_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|4590194_4591538_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4591628_4592921_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850286.1|4593159_4595604_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	7.8e-222
WP_000213098.1|4595614_4596232_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 348
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4599317	4602532	5048496		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|4599317_4600058_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|4600249_4602532_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 349
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4606630	4607719	5048496		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057124.1|4606630_4607719_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	9.2e-82
>prophage 350
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4612806	4617346	5048496		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|4612806_4613091_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705727.1|4613296_4615561_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|4615597_4617346_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 351
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4632051	4643000	5048496	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|4632051_4632600_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109453.1|4632626_4633274_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|4633323_4634514_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977927.1|4634698_4635787_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
WP_000117881.1|4636388_4637789_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001298298.1|4637957_4639160_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193873.1|4639425_4642038_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	1.2e-18
WP_001090487.1|4642232_4643000_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
>prophage 352
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4651755	4653663	5048496		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|4651755_4653663_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 353
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4666263	4668318	5048496		Bacillus_phage(100.0%)	1	NA	NA
WP_001350178.1|4666263_4668318_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 354
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4672552	4673212	5048496	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4672552_4673212_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 355
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4684206	4696724	5048496		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|4684206_4684419_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|4684429_4684618_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|4684592_4684823_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|4684812_4684986_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818464.1|4685034_4686108_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054739.1|4686190_4688923_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	5.4e-38
WP_001264953.1|4689005_4690034_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|4690006_4690699_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|4690828_4692001_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063164.1|4692000_4694547_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_000210216.1|4694543_4695143_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024569.1|4695498_4695804_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|4695803_4696724_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 356
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4699754	4701748	5048496		Enterobacteria_phage(100.0%)	2	NA	NA
WP_001273658.1|4699754_4699928_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001028100.1|4701253_4701748_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	9.3e-50
>prophage 357
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4716343	4717132	5048496		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533536.1|4716343_4717132_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
>prophage 358
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4723952	4725320	5048496		Bacillus_phage(100.0%)	1	NA	NA
WP_000409834.1|4723952_4725320_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	9.6e-20
>prophage 359
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4728711	4729545	5048496		Pelagibacter_phage(100.0%)	1	NA	NA
WP_032153366.1|4728711_4729545_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 360
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4733678	4734212	5048496		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|4733678_4734212_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 361
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4743519	4744440	5048496		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|4743519_4744440_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 362
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4749102	4749348	5048496		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4749102_4749348_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 363
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4765228	4766170	5048496		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001331933.1|4765228_4766170_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	4.7e-10
>prophage 364
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4778526	4779708	5048496		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|4778526_4779261_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|4779471_4779708_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 365
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4782979	4784622	5048496		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257012.1|4782979_4783621_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.4	3.8e-27
WP_001267963.1|4783617_4784622_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 366
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4796944	4797202	5048496		Erwinia_phage(100.0%)	1	NA	NA
WP_000800132.1|4796944_4797202_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 367
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4804491	4808214	5048496		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|4804491_4805193_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251360.1|4805192_4806437_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291301.1|4806465_4807377_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952746.1|4807392_4808214_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 368
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4811489	4813467	5048496		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|4811489_4812347_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531578.1|4812330_4813467_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 369
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4818488	4873287	5048496	tRNA,terminase,integrase,protease,lysis,head,portal,capsid,tail	Enterobacteria_phage(50.82%)	77	4813175:4813190	4873536:4873551
4813175:4813190	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_000423737.1|4818488_4819859_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_001295971.1|4819862_4820504_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001298466.1|4820539_4821646_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4821699_4822161_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|4822170_4822824_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4822995_4824246_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|4824359_4825502_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|4825491_4825728_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|4825867_4826107_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|4826090_4826417_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|4826416_4826638_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|4827024_4827216_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|4827188_4827371_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|4827367_4828048_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|4828044_4828830_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|4828835_4829132_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|4829207_4829351_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|4829319_4829484_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|4829556_4829925_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|4830107_4830308_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|4830521_4831103_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|4831119_4831392_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|4831369_4831552_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|4831828_4832581_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|4832577_4833135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|4833174_4833870_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|4833945_4834161_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|4834302_4834599_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|4834631_4835531_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|4835527_4836229_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|4836225_4836516_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|4836589_4837030_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|4837026_4837554_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|4837550_4837727_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|4837729_4838071_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099712.1|4838277_4838640_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|4838636_4838777_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|4838862_4839246_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|4839434_4840517_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|4841105_4841321_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|4841320_4841818_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|4842034_4842217_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|4842307_4842601_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|4843081_4843408_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|4843614_4843797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867575.1|4844359_4844908_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001584287.1|4844879_4846808_+|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	66.8	2.8e-259
WP_000258997.1|4846791_4846998_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|4846994_4848587_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001588554.1|4848576_4850082_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
WP_000256840.1|4850118_4850466_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|4850523_4851552_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|4851603_4851978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|4851970_4852324_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|4852335_4852914_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|4852910_4853306_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001351266.1|4853313_4854054_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|4854069_4854492_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459475.1|4854473_4854908_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.8	1.4e-57
WP_032153373.1|4854900_4857462_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.2	0.0e+00
WP_000847402.1|4857458_4857788_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152660.1|4857787_4858486_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|4858491_4859235_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|4859171_4859804_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515327.1|4859864_4863347_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000290543.1|4863405_4865466_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|4865462_4865741_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000355360.1|4865753_4866047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001596715.1|4866138_4866996_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101730.1|4866992_4867850_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983716.1|4867846_4868674_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	29.0	1.9e-07
WP_000555630.1|4868673_4869588_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001304451.1|4870286_4871045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|4871516_4871669_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001445545.1|4871752_4871878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373104.1|4871930_4872335_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332310.1|4872555_4873287_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	9.3e-54
4873536:4873551	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 370
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4887522	4889210	5048496		Morganella_phage(50.0%)	2	NA	NA
WP_000897380.1|4887522_4887942_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	2.6e-37
WP_000457594.1|4887941_4889210_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.0	5.3e-206
>prophage 371
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4905238	4905997	5048496		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173308.1|4905238_4905997_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-14
>prophage 372
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4918444	4921196	5048496		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033349.1|4918444_4920124_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
WP_001298109.1|4920248_4921196_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 373
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4924332	4930601	5048496		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000804726.1|4924332_4925415_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456474.1|4925414_4926248_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200375.1|4926244_4926637_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257054.1|4926640_4927450_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|4927485_4928340_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170954.1|4928487_4928595_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001313768.1|4929000_4930101_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|4930370_4930601_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 374
NZ_CP051711	Escherichia coli strain SCU-123 chromosome, complete genome	5048496	4941732	5047645	5048496	terminase,integrase,lysis,head,portal,capsid,transposase,tail,holin	Escherichia_phage(42.39%)	136	4989546:4989576	5041238:5041268
WP_000702647.1|4941732_4943271_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
WP_000571681.1|4943267_4943978_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4943977_4944655_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_001111620.1|4944707_4945907_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|4946699_4947542_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|4947591_4948050_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|4948162_4949068_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|4949159_4950173_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000719002.1|4950374_4951283_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	6.3e-60
WP_001287378.1|4951426_4951840_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|4952443_4953061_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|4954518_4957194_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|4957670_4958318_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001362935.1|4958344_4958500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297114.1|4959055_4960687_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|4960772_4961693_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|4961707_4962616_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|4962627_4963641_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|4963637_4964642_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|4964694_4965024_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|4965058_4966519_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|4966661_4966835_+	YciY family protein	NA	NA	NA	NA	NA
WP_001313775.1|4966889_4968143_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_032153388.1|4968442_4968739_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|4968962_4969679_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|4969718_4970117_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808672.1|4970222_4970762_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|4970791_4971535_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|4971890_4972529_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|4972574_4973705_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|4973682_4973931_-	excisionase	NA	NA	NA	NA	NA
WP_000048435.1|4973995_4976467_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|4976559_4976751_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4976747_4976936_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|4977336_4977501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|4977501_4977723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|4977882_4978038_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|4978330_4978669_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|4979060_4979303_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|4979286_4979712_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|4979783_4980854_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151216.1|4980894_4981317_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_014639476.1|4981508_4982471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|4982486_4983488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|4983896_4984004_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000813256.1|4984105_4984261_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_011478175.1|4984428_4984707_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|4984708_4985755_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|4985767_4986142_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|4986138_4986960_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|4987184_4987382_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935515.1|4987532_4988582_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
4989546:4989576	attL	CTGAACTCACCGGGAGGCACCCGGCACCATG	NA	NA	NA	NA
WP_001331709.1|4989856_4990084_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|4990352_4990568_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|4990572_4990917_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|4990882_4991155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992052.1|4991260_4991794_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
WP_001082537.1|4992092_4992557_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|4992864_4993275_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|4993332_4993566_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|4993952_4994501_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000622378.1|4994472_4996401_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.2e-259
WP_000259002.1|4996384_4996591_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|4996587_4998180_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_001253958.1|4998169_4999675_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000256823.1|4999711_5000059_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|5000116_5001145_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201495.1|5001196_5001580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|5001572_5001926_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|5001941_5002475_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|5002471_5002867_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|5002874_5003627_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|5003640_5004072_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|5004098_5004512_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|5004492_5007066_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847402.1|5007062_5007392_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152522.1|5007391_5008090_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|5008094_5008838_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|5008774_5009377_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|5009450_5009789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515773.1|5009855_5013335_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001233195.1|5013402_5014002_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216497.1|5014153_5017261_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_000885580.1|5017260_5017845_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_023141128.1|5017899_5018568_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|5018624_5018894_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|5019008_5019179_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000113674.1|5019653_5020784_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|5020761_5021010_-	excisionase	NA	NA	NA	NA	NA
WP_169062183.1|5021074_5023546_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|5023638_5023830_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|5023826_5024015_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001351093.1|5024415_5024853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394526.1|5024830_5025151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071686822.1|5025173_5025392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|5025551_5025707_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|5025960_5026422_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_001053425.1|5026529_5026805_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000702041.1|5026788_5027214_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|5027285_5028326_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|5028237_5028780_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450708.1|5028813_5029584_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	1.5e-86
WP_001141099.1|5029599_5029992_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|5029988_5030285_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|5030281_5030743_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403780.1|5030720_5031020_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.3e-50
WP_001224665.1|5031172_5031355_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000753053.1|5031347_5031524_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001289989.1|5031520_5031880_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000510387.1|5031880_5032096_+	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001142588.1|5032097_5032316_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000224216.1|5032317_5032581_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_000207997.1|5032591_5032759_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000206826.1|5032755_5033100_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000967408.1|5033334_5033547_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001004956.1|5033712_5034363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|5034343_5035447_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687431.1|5035604_5035778_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001403449.1|5035837_5036110_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|5036111_5037158_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_000904114.1|5037170_5037545_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|5037541_5038363_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917768.1|5038589_5038787_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_000935524.1|5038937_5039996_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.9	5.2e-207
WP_001304604.1|5040459_5040891_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.1	8.1e-66
WP_000216690.1|5040887_5041052_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_000874510.1|5042018_5043980_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	3.3e-239
5041238:5041268	attR	CTGAACTCACCGGGAGGCACCCGGCACCATG	NA	NA	NA	NA
WP_001304601.1|5044115_5044298_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_001304600.1|5044335_5044581_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284510.1|5044657_5044873_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731249.1|5044877_5045228_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	93.0	4.0e-55
WP_000992075.1|5045291_5045825_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
WP_001082534.1|5046123_5046618_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.7	1.1e-74
WP_000736383.1|5046614_5046839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304598.1|5047037_5047238_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829186.1|5047279_5047645_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	1.7e-61
>prophage 1
NZ_CP051712	Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence	116892	0	1961	116892	integrase	Macacine_betaherpesvirus(100.0%)	1	1106:1119	2201:2214
1106:1119	attL	ATCTGCCTGTTCCT	NA	NA	NA	NA
WP_001066947.1|1220_1961_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001066947.1|1220_1961_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
2201:2214	attR	AGGAACAGGCAGAT	NA	NA	NA	NA
>prophage 2
NZ_CP051712	Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence	116892	9674	15314	116892	transposase	Escherichia_phage(40.0%)	5	NA	NA
WP_001323403.1|9674_10454_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|10453_11476_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|12555_12903_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|12899_13304_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|13805_15314_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
>prophage 3
NZ_CP051712	Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence	116892	27549	33980	116892	transposase	Enterobacteria_phage(33.33%)	6	NA	NA
WP_000065240.1|27549_28305_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_000143800.1|28301_29801_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_001189106.1|30909_31398_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
WP_000874189.1|32302_32788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|32812_33298_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|33284_33980_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
>prophage 4
NZ_CP051712	Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence	116892	42425	43130	116892	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067837.1|42425_43130_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	5.8e-138
>prophage 5
NZ_CP051712	Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence	116892	46725	50101	116892		Moraxella_phage(33.33%)	5	NA	NA
WP_001233838.1|46725_47187_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001309245.1|47431_47644_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139321.1|47772_48333_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704523.1|48435_49296_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.9e-10
WP_000205725.1|49354_50101_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
>prophage 6
NZ_CP051712	Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence	116892	75814	76036	116892		Vibrio_virus(100.0%)	1	NA	NA
WP_001278694.1|75814_76036_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
>prophage 7
NZ_CP051712	Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence	116892	84076	94763	116892		Yersinia_phage(20.0%)	12	NA	NA
WP_001234489.1|84076_84898_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	5.7e-44
WP_000107526.1|85016_85304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337416.1|85367_85604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302184.1|86219_86378_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001276230.1|86653_87373_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845910.1|87369_87804_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145501.1|87858_89817_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	7.3e-21
WP_000006018.1|89875_90109_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032145664.1|90165_90651_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.8	1.7e-40
WP_000936285.1|90800_92702_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	3.1e-32
WP_011478091.1|93655_94114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298559.1|94199_94763_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
>prophage 8
NZ_CP051712	Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence	116892	100398	103679	116892	transposase	Enterobacteria_phage(66.67%)	4	NA	NA
WP_000086169.1|100398_101082_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	2.8e-28
WP_001298677.1|101465_101669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952372.1|101709_102882_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|102881_103679_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
>prophage 9
NZ_CP051712	Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence	116892	106813	112229	116892	integrase	Escherichia_phage(33.33%)	8	105595:105607	112415:112427
105595:105607	attL	GCCAGTGCCCGCC	NA	NA	NA	NA
WP_000618110.1|106813_107062_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|107058_107496_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_021549745.1|107495_108767_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.2	2.7e-141
WP_000340835.1|108771_109164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103694.1|109168_110140_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|110368_111013_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|111006_111282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016979.1|111419_112229_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
112415:112427	attR	GGCGGGCACTGGC	NA	NA	NA	NA
>prophage 1
NZ_CP051713	Escherichia coli strain SCU-123 plasmid pSCU-123-2, complete sequence	94616	16278	23883	94616		Pseudomonas_phage(16.67%)	8	NA	NA
WP_000936285.1|16278_18180_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	3.1e-32
WP_031222835.1|18329_18815_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.8	6.0e-41
WP_000006020.1|18872_19106_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
WP_001145476.1|19164_21123_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.6	1.5e-21
WP_000845903.1|21177_21612_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276270.1|21608_22328_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000977995.1|22324_22921_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
WP_000117631.1|23382_23883_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	28.2	1.4e-05
