The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	0	97382	5007984	holin,protease,portal,lysis,tail,terminase,capsid,head,integrase	Escherichia_phage(43.18%)	117	13016:13040	66296:66320
WP_169063360.1|0_1662_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.4	0.0e+00
WP_000173054.1|1726_3664_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	97.8	0.0e+00
WP_001063027.1|3708_3930_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125984.1|6456_6783_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007909.1|6795_7146_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	4.6e-59
WP_000573362.1|7142_7589_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|7585_7930_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275433.1|7995_8709_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	2.3e-126
WP_000710952.1|8726_9101_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001538679.1|9196_9406_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	2.0e-33
WP_000212987.1|9453_12696_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.0	0.0e+00
WP_000807940.1|12688_13030_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
13016:13040	attL	CAGGTGGTGAACTGATGCAGGATAT	NA	NA	NA	NA
WP_021524657.1|13029_13728_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_000194709.1|13738_14482_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	8.6e-148
WP_032300536.1|14427_15060_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_001773905.1|15403_19096_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_016238842.1|19163_19763_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	1.0e-106
WP_169063361.1|19914_21978_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	2.4e-147
WP_001204581.1|21974_22253_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_000355614.1|22262_22559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304590.1|22676_23009_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001304589.1|23194_23647_+	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_000113674.1|24265_25396_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_023150470.1|25373_25622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079419891.1|25686_28158_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|28250_28442_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|28438_28627_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001351093.1|29027_29465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016238838.1|29442_29763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304608.1|29765_30005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|30164_30320_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|30573_31035_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_001053425.1|31142_31418_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000702041.1|31401_31827_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|31898_32939_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|32850_33393_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_169063362.1|33426_34197_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.3e-86
WP_001141099.1|34212_34605_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|34601_34898_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|34894_35356_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403780.1|35333_35633_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.3e-50
WP_001224665.1|35785_35968_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000753053.1|35960_36137_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001289989.1|36133_36493_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000510387.1|36493_36709_+	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001142588.1|36710_36929_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000224216.1|36930_37194_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_000207997.1|37204_37372_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000206826.1|37368_37713_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000967408.1|37947_38160_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001004956.1|38325_38976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|38956_40060_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687431.1|40217_40391_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001403449.1|40450_40723_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|40724_41771_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_000904114.1|41783_42158_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_169063363.1|42154_42976_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	1.7e-80
WP_000917768.1|43202_43400_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_000935524.1|43550_44609_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.9	5.2e-207
WP_001304604.1|45072_45504_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.1	8.1e-66
WP_000216690.1|45500_45665_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_000874510.1|46631_48593_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	3.3e-239
WP_001304601.1|48728_48911_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_001304600.1|48948_49194_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284510.1|49270_49486_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193259.1|49490_49835_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|49800_50073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992052.1|50178_50712_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
WP_000459345.1|50871_51009_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082537.1|51010_51475_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|51782_52193_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|52250_52484_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|52870_53419_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_021548508.1|53390_55319_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	8.8e-261
WP_000259002.1|55302_55509_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_021548507.1|55505_57098_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_001253963.1|57087_58593_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_000256823.1|58629_58977_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|59034_60063_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201495.1|60114_60498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|60490_60844_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|60859_61393_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|61389_61785_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|61792_62545_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|62558_62990_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|63016_63430_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|63410_65984_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847402.1|65980_66310_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152522.1|66309_67008_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
66296:66320	attR	CAGGTGGTGAACTGATGCAGGATAT	NA	NA	NA	NA
WP_000140762.1|67012_67756_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|67692_68295_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|68368_68707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515773.1|68773_72253_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001233195.1|72320_72920_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_016230679.1|73071_76047_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	85.3	2.1e-48
WP_000885580.1|76046_76631_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240999.1|76685_77354_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|77410_77680_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|77794_77965_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079492.1|78452_78959_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|79004_79505_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|79590_79770_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|80150_80957_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|80956_82150_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001513786.1|82161_83520_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|83523_85119_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_169063364.1|85118_86681_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_160530659.1|86772_86817_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001513787.1|86954_87836_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|87832_88453_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_024187306.1|88480_90376_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|90588_91464_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|91503_92094_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|92090_92849_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|93068_94118_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|94153_94405_-	YciN family protein	NA	NA	NA	NA	NA
WP_001304419.1|94784_97382_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 2
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	102292	102883	5007984		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|102292_102883_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 3
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	110696	112631	5007984		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485006.1|110696_112631_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	4.8e-33
>prophage 4
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	121565	123583	5007984		Salmonella_phage(50.0%)	2	NA	NA
WP_000135020.1|121565_122729_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	1.6e-28
WP_000573407.1|122776_123583_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 5
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	142925	144008	5007984		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057991.1|142925_144008_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-23
>prophage 6
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	161232	161748	5007984		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|161232_161748_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 7
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	166509	175930	5007984	tRNA	Bacillus_phage(20.0%)	7	NA	NA
WP_001350888.1|166509_167742_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|167996_168980_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|169254_169428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123782.1|169457_170831_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157413.1|170959_171895_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_001295593.1|174221_174656_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|174796_175930_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 8
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	180889	181879	5007984		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|180889_181879_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 9
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	188628	189842	5007984	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_139371347.1|188628_189842_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 10
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	198830	202733	5007984		Klosneuvirus(100.0%)	1	NA	NA
WP_000139522.1|198830_202733_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 11
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	206673	207622	5007984		Escherichia_phage(50.0%)	2	NA	NA
WP_001350640.1|206673_207204_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731859.1|207448_207622_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 12
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	219173	221135	5007984		Phage_TP(100.0%)	1	NA	NA
WP_001441964.1|219173_221135_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
>prophage 13
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	224764	225778	5007984		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220436.1|224764_225778_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	4.6e-27
>prophage 14
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	231274	233377	5007984		Salmonella_phage(100.0%)	1	NA	NA
WP_000689338.1|231274_233377_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.1	6.6e-137
>prophage 15
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	238002	240408	5007984		Ralstonia_phage(100.0%)	1	NA	NA
WP_000053647.1|238002_240408_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.6	8.4e-27
>prophage 16
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	246890	248435	5007984		Escherichia_phage(100.0%)	1	NA	NA
WP_000702551.1|246890_248435_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 17
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	259859	261618	5007984		Escherichia_phage(66.67%)	3	NA	NA
WP_000781370.1|259859_260144_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000605675.1|260143_260422_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_000642412.1|260607_261618_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
>prophage 18
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	265024	267424	5007984		Klosneuvirus(100.0%)	1	NA	NA
WP_001362858.1|265024_267424_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	2.1e-09
>prophage 19
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	272892	279828	5007984		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_000402827.1|272892_275688_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	4.4e-19
WP_000832485.1|275732_278105_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_169063365.1|278142_279828_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	6.5e-10
>prophage 20
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	291169	292398	5007984	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_102384962.1|291169_292398_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
>prophage 21
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	302639	304058	5007984		Bacillus_phage(100.0%)	1	NA	NA
WP_000558461.1|302639_304058_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	1.4e-18
>prophage 22
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	310801	312931	5007984		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091198.1|310801_311185_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803537.1|311216_311435_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012592.1|311491_312931_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	4.8e-30
>prophage 23
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	320433	321324	5007984		Bacillus_phage(100.0%)	1	NA	NA
WP_000592858.1|320433_321324_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
>prophage 24
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	325711	340136	5007984		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|325711_325915_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000526706.1|325950_327411_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	5.1e-43
WP_015952996.1|327761_327854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836075.1|327911_328931_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
WP_016239245.1|328942_330157_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_001304355.1|330362_330689_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_000705201.1|330823_331165_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|331199_331760_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001296084.1|331762_332473_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778146.1|332580_332886_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041666.1|333084_335511_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
WP_001468025.1|335571_337995_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
WP_000213028.1|338005_338623_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526507.1|338624_339479_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148695.1|339521_340136_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
>prophage 25
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	357825	359127	5007984		Bacillus_phage(100.0%)	1	NA	NA
WP_000732519.1|357825_359127_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
>prophage 26
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	369033	370845	5007984		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945903.1|369033_370845_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 27
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	390729	392004	5007984	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001339629.1|390729_392004_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 28
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	398915	400414	5007984		Salmonella_phage(50.0%)	2	NA	NA
WP_001350654.1|398915_399437_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
WP_000250643.1|399517_400414_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	2.1e-07
>prophage 29
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	404829	413621	5007984		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101200.1|404829_405645_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	9.8e-20
WP_000007283.1|405772_406354_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701049.1|406499_407669_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|407834_407924_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190985.1|408222_409248_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_000269493.1|409244_410177_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182336.1|410289_411501_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|411791_412940_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|412979_413621_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 30
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	419207	421474	5007984		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587583.1|419207_420020_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069965.1|420023_420809_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001362847.1|420805_421474_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
>prophage 31
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	429763	434847	5007984		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|429763_430984_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_021532065.1|430980_432252_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948883.1|432226_432973_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_001304330.1|432982_434470_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367158.1|434478_434847_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
>prophage 32
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	453319	472858	5007984	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001296108.1|453319_454966_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.7e-31
WP_000069409.1|455022_457401_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_000368046.1|457733_458567_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|458723_459770_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001313872.1|459901_460093_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175635.1|460096_461533_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001298229.1|461595_462309_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209783.1|462555_463020_-	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.8e-11
WP_000029464.1|463097_463847_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154199.1|463846_464398_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|464459_465440_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|465540_465840_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672426.1|465844_468232_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|468246_469230_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|469513_469558_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|469680_470037_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|470089_470287_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|470383_470926_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|470929_472858_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 33
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	482235	484497	5007984		Tupanvirus(100.0%)	1	NA	NA
WP_000077882.1|482235_484497_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.9e-143
>prophage 34
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	490622	491450	5007984		Bacillus_virus(100.0%)	1	NA	NA
WP_000175056.1|490622_491450_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	3.5e-73
>prophage 35
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	498926	500147	5007984		Klosneuvirus(100.0%)	1	NA	NA
WP_000081990.1|498926_500147_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.7e-26
>prophage 36
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	506910	507564	5007984		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|506910_507564_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 37
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	511954	513910	5007984		Streptococcus_phage(100.0%)	1	NA	NA
WP_001332112.1|511954_513910_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 38
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	518836	522922	5007984		Tupanvirus(50.0%)	4	NA	NA
WP_001135068.1|518836_519478_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
WP_001313906.1|519570_520929_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|521046_521805_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723732.1|521941_522922_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	6.7e-07
>prophage 39
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	531735	532590	5007984		Indivirus(100.0%)	1	NA	NA
WP_001332110.1|531735_532590_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 40
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	535908	540485	5007984		Bacillus_phage(100.0%)	3	NA	NA
WP_000219684.1|535908_537192_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621390.1|537338_538814_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|538994_540485_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 41
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	549452	557558	5007984	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|549452_551138_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|551342_551924_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220977.1|551963_552659_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128839.1|552716_554627_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	1.0e-91
WP_001351125.1|554758_555103_+	RidA family protein	NA	NA	NA	NA	NA
WP_001304301.1|555464_555824_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|555943_556123_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855011.1|556196_557558_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.9	2.3e-42
>prophage 42
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	561420	562977	5007984		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|561420_562977_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 43
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	568617	568827	5007984		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|568617_568827_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 44
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	574160	576209	5007984		Moraxella_phage(100.0%)	1	NA	NA
WP_001055805.1|574160_576209_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	4.0e-86
>prophage 45
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	583705	588173	5007984		Escherichia_phage(33.33%)	7	NA	NA
WP_000812741.1|583705_584362_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.5	1.4e-56
WP_000984819.1|584756_585098_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879320.1|585110_585983_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|585986_586361_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|586499_586730_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011664.1|586831_587488_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|587510_588173_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 46
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	596229	597705	5007984		Cyanophage(100.0%)	1	NA	NA
WP_000301724.1|596229_597705_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	3.4e-79
>prophage 47
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	601703	608839	5007984		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|601703_603026_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|603041_603974_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|604052_604808_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|604804_605590_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|605806_606817_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|606825_607437_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072123646.1|607575_607641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024939.1|607713_608316_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|608317_608839_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 48
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	612732	614783	5007984		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639256.1|612732_613551_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_001313931.1|613603_613999_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|614039_614783_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 49
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	621399	623133	5007984	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025351.1|621399_623133_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.3	3.7e-85
>prophage 50
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	627660	631929	5007984		Tupanvirus(33.33%)	4	NA	NA
WP_000763860.1|627660_628050_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
WP_000036385.1|628064_629114_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204321.1|629116_629977_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001350672.1|630267_631929_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.5	1.6e-08
>prophage 51
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	642016	643531	5007984		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|642016_643531_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 52
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	655522	656275	5007984		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|655522_656275_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 53
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	667659	668915	5007984	transposase	uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_000334576.1|667659_668157_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.2	5.9e-52
WP_001336494.1|668038_668368_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	8.1e-42
WP_015674555.1|668390_668915_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
>prophage 54
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	684897	697261	5007984		Bacillus_phage(28.57%)	11	NA	NA
WP_001513825.1|684897_686592_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|686762_686945_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922684.1|687023_687941_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|688113_689034_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786003.1|689022_689493_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.6e-33
WP_001157247.1|689473_690892_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
WP_000365598.1|690958_691654_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_000824345.1|692622_693681_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.3	6.6e-93
WP_000218222.1|694272_695124_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826781.1|695231_696590_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	3.0e-05
WP_001340597.1|696589_697261_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
>prophage 55
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	702451	727107	5007984	integrase	Bacillus_phage(40.0%)	8	694898:694912	716980:716994
694898:694912	attL	TCCCAGACGCCGCAG	NA	NA	NA	NA
WP_000480163.1|702451_703714_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.2e-72
WP_000703041.1|703907_705212_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286292.1|705239_706520_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000654453.1|706512_708315_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	7.9e-22
WP_001317926.1|708301_710014_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.3	1.0e-31
WP_000140405.1|710270_711230_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623055.1|711420_717528_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
716980:716994	attR	TCCCAGACGCCGCAG	NA	NA	NA	NA
WP_016239269.1|717615_727107_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 56
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	746574	747846	5007984	integrase	Stenotrophomonas_phage(100.0%)	1	742933:742946	761549:761562
742933:742946	attL	GATATGGCGGTGAT	NA	NA	NA	NA
WP_000055670.1|746574_747846_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.8e-73
WP_000055670.1|746574_747846_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.8e-73
761549:761562	attR	ATCACCGCCATATC	NA	NA	NA	NA
>prophage 57
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	753404	781623	5007984		Tupanvirus(80.0%)	7	NA	NA
WP_001327259.1|753404_757772_-	colibactin non-ribosomal peptide synthetase ClbN	NA	A0A2K9KZV5	Tupanvirus	22.8	4.3e-37
WP_000217768.1|757768_759208_-	precolibactin export MATE transporter ClbM	NA	NA	NA	NA	NA
WP_001297937.1|759269_760733_-	colibactin biosynthesis amidase ClbL	NA	NA	NA	NA	NA
WP_000222467.1|760725_767190_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbK	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-43
WP_169063367.1|767200_773701_-	colibactin non-ribosomal peptide synthetase ClbJ	NA	A0A2K9KZV5	Tupanvirus	23.4	9.6e-102
WP_000829570.1|773744_776777_-	colibactin polyketide synthase ClbI	NA	D0R7J2	Paenibacillus_phage	37.9	4.0e-50
WP_021532082.1|776826_781623_-	colibactin non-ribosomal peptide synthetase ClbH	NA	A0A2K9L3I8	Tupanvirus	28.7	3.0e-44
>prophage 58
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	787867	797488	5007984		Tupanvirus(100.0%)	1	NA	NA
WP_001518711.1|787867_797488_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbB	NA	A0A2K9KZV5	Tupanvirus	23.8	5.0e-46
>prophage 59
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	808420	812376	5007984	transposase	uncultured_marine_virus(33.33%)	3	NA	NA
WP_000502870.1|808420_809065_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_001362826.1|809049_810273_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	1.5e-61
WP_102384962.1|811147_812376_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
>prophage 60
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	831093	832895	5007984	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001297096.1|831093_831873_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001297914.1|831872_832895_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.3e-199
>prophage 61
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	836405	837173	5007984		Bacillus_virus(100.0%)	1	NA	NA
WP_000016205.1|836405_837173_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.7e-13
>prophage 62
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	848305	850485	5007984		Yersinia_phage(33.33%)	4	NA	NA
WP_001234569.1|848305_849127_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.5	4.7e-46
WP_000213703.1|849217_849703_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.3	9.9e-12
WP_001351157.1|849718_850195_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|850263_850485_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 63
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	854828	855995	5007984		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001297905.1|854828_855995_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	2.2e-227
>prophage 64
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	862192	863092	5007984		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131789.1|862192_863092_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 65
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	870533	873353	5007984		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704905.1|870533_871700_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.9	6.5e-110
WP_000043455.1|871946_873353_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
>prophage 66
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	880813	891454	5007984		Enterobacteria_phage(42.86%)	11	NA	NA
WP_001028393.1|880813_881371_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.3	8.1e-50
WP_000691392.1|881391_882441_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001513851.1|882457_883720_-	O2/O50 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001033086.1|883719_884826_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.6	5.9e-44
WP_001332228.1|884818_885286_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_032139969.1|885272_885683_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000857507.1|885700_886576_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.6e-107
WP_001023648.1|886634_887534_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	8.2e-28
WP_000699453.1|887533_888619_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.6e-100
WP_000183029.1|888991_889885_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.4	1.3e-46
WP_001116045.1|890059_891454_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
>prophage 67
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	897043	903837	5007984		Bacillus_phage(25.0%)	6	NA	NA
WP_001332227.1|897043_898414_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	4.9e-32
WP_000079257.1|898606_900043_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	9.7e-47
WP_000699680.1|900045_901269_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001351161.1|901265_901745_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001231336.1|901747_902713_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.0	4.9e-87
WP_000048190.1|902715_903837_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 68
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	908081	918686	5007984		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654504.1|908081_908921_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_021532087.1|909049_911212_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|911214_911658_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|911663_912803_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_001513855.1|913461_915045_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252301.1|915496_917350_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|917371_917953_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|918044_918686_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 69
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	923413	924766	5007984		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469710.1|923413_924766_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 70
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	937873	939996	5007984		Bacillus_phage(100.0%)	2	NA	NA
WP_000675178.1|937873_939277_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|939273_939996_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
>prophage 71
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	945835	949329	5007984	tRNA	Phage_TP(50.0%)	3	NA	NA
WP_000476019.1|945835_947197_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_001350699.1|947696_948014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807360.1|948429_949329_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
>prophage 72
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	959909	963466	5007984		Serratia_phage(50.0%)	4	NA	NA
WP_000846205.1|959909_960914_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	2.2e-13
WP_000011933.1|960910_961876_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434049.1|961849_962596_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297940.1|962647_963466_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
>prophage 73
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	974115	976149	5007984	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350700.1|974115_976149_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 74
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	988240	997685	5007984		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|988240_989377_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001332210.1|989373_991377_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|991501_991963_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|992003_992474_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|992520_993240_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|993236_994922_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|995143_995875_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|995934_996042_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|996022_996754_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|996758_997685_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 75
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1018035	1019556	5007984		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|1018035_1019556_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 76
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1023250	1027036	5007984		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1023250_1023919_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425456.1|1024176_1025013_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489277.1|1025044_1027036_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
>prophage 77
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1031104	1031962	5007984		Catovirus(100.0%)	1	NA	NA
WP_000873879.1|1031104_1031962_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	4.0e-24
>prophage 78
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1045349	1049650	5007984		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001332203.1|1045349_1046816_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
WP_000198797.1|1046933_1047920_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000594599.1|1047958_1048672_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1049083_1049650_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 79
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1055404	1063054	5007984		Vibrio_phage(50.0%)	7	NA	NA
WP_016239292.1|1055404_1056994_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|1056997_1057342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213379.1|1057675_1058866_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|1058893_1059589_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578103.1|1059738_1061499_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	9.9e-102
WP_000494186.1|1061623_1061908_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1062046_1063054_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 80
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1072957	1073575	5007984		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|1072957_1073575_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 81
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1082343	1088109	5007984		Bacillus_phage(25.0%)	5	NA	NA
WP_000422239.1|1082343_1083987_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.6	1.6e-13
WP_000884927.1|1084062_1084713_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
WP_000872522.1|1084712_1085777_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.2	3.1e-18
WP_000406059.1|1085850_1086906_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865556.1|1087017_1088109_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.3	2.7e-118
>prophage 82
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1093145	1098565	5007984	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_102384962.1|1093145_1094373_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001296244.1|1096738_1098565_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
>prophage 83
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1113488	1127364	5007984		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281253.1|1113488_1116116_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
WP_000990768.1|1116262_1116985_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_024176483.1|1117124_1120883_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	28.2	2.0e-22
WP_001075170.1|1121564_1123850_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|1123996_1125127_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|1125126_1125381_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301034.1|1125434_1126085_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|1126287_1127364_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 84
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1133256	1137827	5007984	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140576.1|1133256_1134216_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.6e-69
WP_000150339.1|1134228_1134414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992976.1|1134454_1135258_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001297939.1|1135275_1136565_-	MFS transporter	NA	NA	NA	NA	NA
WP_001350710.1|1136621_1137827_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	3.5e-26
>prophage 85
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1141430	1146360	5007984		Tupanvirus(66.67%)	3	NA	NA
WP_000879110.1|1141430_1142033_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
WP_011076488.1|1142340_1143480_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	7.2e-29
WP_000860295.1|1144377_1146360_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 86
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1181321	1184549	5007984		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|1181321_1181921_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|1181979_1183812_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203415.1|1183898_1184549_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
>prophage 87
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1195108	1196968	5007984		Sodalis_phage(50.0%)	2	NA	NA
WP_000156130.1|1195108_1195999_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	53.1	4.0e-67
WP_001293612.1|1196194_1196968_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 88
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1201179	1202697	5007984		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|1201179_1202697_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 89
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1209446	1210583	5007984		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699136.1|1209446_1210583_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
>prophage 90
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1219119	1220205	5007984		Pandoravirus(100.0%)	1	NA	NA
WP_001331783.1|1219119_1220205_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 91
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1236607	1250049	5007984	protease,transposase,tail,integrase	Enterobacteria_phage(84.62%)	18	1237676:1237692	1250123:1250139
WP_000368123.1|1236607_1237540_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
1237676:1237692	attL	CTGCAGGGGACACCATT	NA	NA	NA	NA
WP_000958671.1|1237851_1239009_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000258780.1|1240185_1240689_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	99.4	5.3e-93
WP_139371347.1|1240756_1241969_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000620145.1|1242544_1242718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410001.1|1242714_1242867_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001051911.1|1242981_1243230_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000903306.1|1243229_1243766_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_001198454.1|1243814_1244264_-	type II toxin-antitoxin system YafO family toxin	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
WP_000064337.1|1244272_1244839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011703616.1|1245035_1245365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139371347.1|1246478_1247692_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000215166.1|1248116_1248416_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|1248417_1248990_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_001621581.1|1248989_1249274_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	98.9	1.5e-47
WP_000002106.1|1249266_1249551_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|1249623_1249791_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|1249848_1250049_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
1250123:1250139	attR	CTGCAGGGGACACCATT	NA	NA	NA	NA
>prophage 92
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1257916	1265493	5007984		Bacillus_phage(50.0%)	4	NA	NA
WP_001331804.1|1257916_1261510_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001331805.1|1261565_1262711_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1262784_1263729_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283509.1|1263798_1265493_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 93
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1269186	1270107	5007984		Morganella_phage(100.0%)	1	NA	NA
WP_000484022.1|1269186_1270107_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 94
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1273925	1274663	5007984		Clostridioides_phage(100.0%)	1	NA	NA
WP_001314031.1|1273925_1274663_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.3	6.1e-13
>prophage 95
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1300202	1321930	5007984		Streptococcus_phage(25.0%)	22	NA	NA
WP_000443708.1|1300202_1302218_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	2.9e-150
WP_001317975.1|1302288_1303287_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1303516_1304278_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1304462_1305434_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1305817_1306075_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623142.1|1306119_1307847_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1307887_1308397_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096640.1|1308439_1309291_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000724596.1|1309395_1309764_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000105467.1|1309766_1310678_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
WP_000021034.1|1310812_1311910_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1311899_1312775_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458408.1|1312774_1313608_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290262.1|1313607_1314624_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517443.1|1314781_1315573_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_001175632.1|1315852_1316749_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040463.1|1316752_1318177_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000084590.1|1318354_1319254_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838948.1|1319349_1319925_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_021532109.1|1319985_1320435_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1320421_1320847_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102910.1|1321060_1321930_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 96
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1340584	1341535	5007984		Cyanophage(100.0%)	1	NA	NA
WP_001003713.1|1340584_1341535_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	7.4e-11
>prophage 97
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1358776	1359490	5007984		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1358776_1359490_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 98
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1366969	1370970	5007984		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198327.1|1366969_1368259_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|1368344_1368971_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001350863.1|1369294_1370332_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.6	2.8e-72
WP_001028626.1|1370331_1370970_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 99
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1377217	1424339	5007984	holin,terminase,tail,integrase	Escherichia_phage(57.69%)	55	1399318:1399335	1429732:1429749
WP_000017553.1|1377217_1377370_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
WP_000076001.1|1377387_1377579_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|1377889_1378408_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|1378423_1378963_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_001555607.1|1379181_1379664_-	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	93.1	2.4e-74
WP_001617179.1|1379660_1380290_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	98.1	1.1e-114
WP_001546697.1|1380279_1380588_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
WP_001546698.1|1380574_1380979_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	96.3	1.0e-62
WP_023150286.1|1381133_1383074_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	34.7	3.2e-61
WP_023150287.1|1383104_1385336_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	62.0	1.6e-85
WP_001188262.1|1385531_1385789_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	1.3e-42
WP_001617182.1|1385810_1386539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617183.1|1386936_1387647_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	81.1	1.8e-102
WP_001260052.1|1387793_1388426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|1388523_1388685_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_000559990.1|1388728_1388869_-	hypothetical protein	NA	A0A0F6R7N3	Escherichia_coli_O157_typing_phage	97.8	5.2e-14
WP_001248460.1|1388878_1391353_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.4	0.0e+00
WP_000119852.1|1391358_1393161_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.2	0.0e+00
WP_023150293.1|1393157_1395671_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	98.0	0.0e+00
WP_000332878.1|1395670_1396216_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_000580591.1|1396215_1396680_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.1	3.5e-83
WP_000179257.1|1399150_1399756_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	8.1e-112
1399318:1399335	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_000424495.1|1399755_1400079_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_000012377.1|1400129_1400465_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000627074.1|1400475_1400913_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	100.0	2.2e-74
WP_000268715.1|1400964_1401951_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_001048079.1|1401965_1402661_-	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_000133160.1|1402663_1402960_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_000852410.1|1402956_1404636_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	98.7	1.8e-302
WP_000335899.1|1404650_1404857_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_001280573.1|1405564_1405936_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	99.2	1.1e-63
WP_000132526.1|1406026_1407502_-	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.4	2.9e-296
WP_001090112.1|1407498_1408173_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_001130065.1|1408213_1408552_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	89.3	2.0e-51
WP_021532119.1|1408666_1409194_-	ead/Ea22-like family protein	NA	A0A0N7KZV3	Escherichia_phage	72.0	9.3e-40
WP_023150297.1|1409190_1409892_-	hypothetical protein	NA	G9L6B1	Escherichia_phage	88.9	3.9e-33
WP_001231263.1|1409953_1410301_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.3	3.1e-60
WP_001066741.1|1410418_1411204_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
WP_042007212.1|1411200_1412016_-	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	94.2	1.4e-114
WP_000402893.1|1412031_1412232_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_001282459.1|1412382_1412613_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|1412767_1413352_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198619.1|1413505_1413667_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	4.9e-24
WP_001292931.1|1413663_1414698_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	61.9	1.4e-31
WP_001102247.1|1414705_1415005_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	93.9	9.3e-45
WP_000802271.1|1415001_1415823_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.5	9.8e-161
WP_000063825.1|1415819_1416701_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.6	7.5e-159
WP_000675390.1|1416750_1416999_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001228931.1|1417108_1417408_+	PerC family transcriptional regulator	NA	A0A2R9YJK3	Escherichia_phage	100.0	4.3e-50
WP_023150299.1|1417400_1418051_+	MT-A70 protein	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	97.2	1.2e-124
WP_001077943.1|1418047_1418242_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	96.9	2.8e-26
WP_000954559.1|1418245_1419496_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.5	7.2e-240
WP_000138282.1|1419688_1421266_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|1421334_1422801_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000937882.1|1422962_1424339_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	9.0e-42
1429732:1429749	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
>prophage 100
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1444845	1445277	5007984		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|1444845_1445277_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 101
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1455162	1461500	5007984		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133562.1|1455162_1456446_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|1456504_1456705_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|1456716_1457052_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1457053_1458904_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|1458920_1459436_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1459531_1459855_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1459871_1460258_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1460285_1461500_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 102
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1471617	1473129	5007984		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493462.1|1471617_1473129_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 103
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1478887	1490196	5007984		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1478887_1480141_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883117.1|1480469_1481660_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1481704_1482043_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001305238.1|1482103_1483438_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	38.2	1.4e-10
WP_001215879.1|1483427_1484141_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001350885.1|1484305_1485733_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970064.1|1486308_1490196_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	6.5e-130
>prophage 104
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1494316	1494577	5007984		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|1494316_1494577_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 105
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1498036	1501773	5007984		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1498036_1498717_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1498983_1499958_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790169.1|1499973_1501773_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 106
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1506675	1586985	5007984	protease,holin,tRNA,plate,tail,portal,lysis,terminase,transposase,capsid,head	Shigella_phage(40.48%)	80	NA	NA
WP_000083664.1|1506675_1507413_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1507544_1508879_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|1508911_1509793_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|1509895_1510483_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1510538_1510922_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|1511226_1511916_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|1511963_1513001_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1513207_1513627_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|1513695_1514394_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|1514425_1517086_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1517199_1518555_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|1518600_1518924_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|1518920_1520219_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001350770.1|1528706_1531280_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|1531409_1532141_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079096.1|1532137_1533118_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1533252_1533990_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000483767.1|1534092_1535439_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000178456.1|1535698_1536040_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|1536143_1536191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|1536289_1537450_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|1537492_1538614_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|1538624_1539695_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|1539904_1540270_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|1540418_1540937_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|1540926_1542153_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|1542168_1542651_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1542727_1543075_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1543116_1543884_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1543914_1544463_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1544481_1544730_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1544866_1546228_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1546394_1547186_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|1547206_1548493_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|1548547_1549141_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|1549263_1550142_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|1550227_1551889_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1552037_1552379_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|1552440_1552731_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|1552720_1553197_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1553328_1553811_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_102384962.1|1555021_1556249_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_139371347.1|1557015_1558229_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000174562.1|1558492_1558786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|1558996_1559770_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|1560821_1562711_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|1562964_1563456_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|1563458_1563902_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|1563873_1564476_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554665.1|1564475_1565219_-|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_000539246.1|1565222_1565807_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785328.1|1565797_1566856_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|1566842_1567268_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|1567267_1567816_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|1567815_1568895_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_000807182.1|1570280_1572116_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|1572257_1572527_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|1572526_1572883_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|1572882_1574379_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|1574362_1574533_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|1574541_1575102_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|1575098_1575605_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|1575579_1575990_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|1575986_1576310_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|1576312_1576513_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|1576562_1577768_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|1577782_1578433_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466267.1|1578410_1579652_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|1579651_1579834_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|1579845_1581342_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|1581575_1582070_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|1582195_1582546_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000026993.1|1582648_1583089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332386.1|1583195_1583447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|1583517_1583955_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|1583951_1584428_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|1584414_1584720_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|1584871_1585207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113239879.1|1585392_1585716_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	96.2	1.4e-57
WP_139371347.1|1585772_1586985_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 107
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1592014	1596066	5007984		Klosneuvirus(50.0%)	4	NA	NA
WP_001332373.1|1592014_1593295_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	1.2e-32
WP_001298180.1|1593532_1594933_+	GABA permease	NA	NA	NA	NA	NA
WP_000156818.1|1594953_1595616_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|1595616_1596066_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 108
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1601872	1607169	5007984		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1601872_1602118_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080951.1|1602114_1602525_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.1e-18
WP_000246589.1|1602497_1604642_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.1e-195
WP_000777929.1|1604651_1605611_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000985490.1|1605966_1607169_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 109
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1621773	1627159	5007984	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1621773_1621959_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047209.1|1622193_1624824_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
WP_000140506.1|1624951_1625452_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1625520_1626582_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132237.1|1626661_1627159_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	3.4e-31
>prophage 110
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1632627	1633593	5007984		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287404.1|1632627_1633593_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 111
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1641164	1642175	5007984		Enterobacteria_phage(100.0%)	1	NA	NA
WP_024174326.1|1641164_1642175_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	27.8	3.9e-26
>prophage 112
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1661062	1668202	5007984		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|1661062_1663624_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|1663729_1664386_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|1664436_1665204_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|1665399_1666308_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001513947.1|1666304_1667567_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001279003.1|1667563_1668202_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 113
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1672575	1676291	5007984		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1672575_1673568_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1673630_1674770_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254701.1|1674909_1675536_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1675529_1676291_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 114
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1679402	1681435	5007984		Tupanvirus(50.0%)	2	NA	NA
WP_001173653.1|1679402_1680008_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090357.1|1680007_1681435_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	1.3e-30
>prophage 115
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1696084	1696870	5007984		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021344.1|1696084_1696870_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.4e-20
>prophage 116
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1700444	1701116	5007984		Vibrio_phage(100.0%)	1	NA	NA
WP_001199974.1|1700444_1701116_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
>prophage 117
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1704925	1707949	5007984		Streptococcus_phage(50.0%)	2	NA	NA
WP_000036723.1|1704925_1706224_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1706311_1707949_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 118
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1711982	1716097	5007984		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046816.1|1711982_1713284_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	1.1e-38
WP_000186431.1|1713340_1716097_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.9e-54
>prophage 119
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1723629	1724478	5007984		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|1723629_1724478_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 120
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1729336	1730092	5007984		Bacillus_phage(100.0%)	1	NA	NA
WP_001296330.1|1729336_1730092_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 121
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1741668	1744174	5007984	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_001331603.1|1741668_1742874_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.5	3.2e-75
WP_000184272.1|1742873_1743317_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117716.1|1743367_1744174_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
>prophage 122
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1753008	1758146	5007984		Cronobacter_phage(50.0%)	2	NA	NA
WP_000147358.1|1753008_1755654_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.3	1.9e-96
WP_000512742.1|1755665_1758146_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.4	4.9e-06
>prophage 123
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1761468	1761729	5007984		Burkholderia_virus(100.0%)	1	NA	NA
WP_001117814.1|1761468_1761729_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	37.2	5.7e-06
>prophage 124
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1776544	1794495	5007984	transposase	Paramecium_bursaria_Chlorella_virus(12.5%)	11	NA	NA
WP_001331592.1|1776544_1777492_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-16
WP_001066237.1|1777563_1778160_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
WP_001513957.1|1778162_1779338_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810553.1|1779337_1780918_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	4.5e-05
WP_102384962.1|1781117_1782345_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_077783705.1|1782270_1783065_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|1783367_1784621_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|1784852_1786184_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_021532137.1|1786245_1788072_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	1.0e-24
WP_001331589.1|1788071_1791614_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138098.1|1791606_1794495_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	9.0e-68
>prophage 125
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1799972	1806745	5007984		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1799972_1800767_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1800773_1801649_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|1801799_1804046_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1804058_1804589_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082183.1|1805273_1805963_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1806031_1806745_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 126
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1816376	1818871	5007984		Aichi_virus(50.0%)	2	NA	NA
WP_000256426.1|1816376_1817795_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_021532138.1|1818109_1818871_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 127
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1823157	1823913	5007984		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|1823157_1823913_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 128
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1848192	1863584	5007984	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|1848192_1849593_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001296347.1|1849610_1850927_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012167.1|1850962_1852330_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_000838415.1|1852365_1852854_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001363023.1|1852853_1854773_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001363024.1|1855208_1856657_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	27.0	4.3e-26
WP_001050745.1|1856658_1856784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|1856780_1856852_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192798.1|1856906_1857455_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|1857497_1859015_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1859024_1860123_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813190.1|1860213_1861947_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_000715230.1|1861952_1862663_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806987.1|1862687_1863584_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 129
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1867389	1871862	5007984		Pandoravirus(50.0%)	2	NA	NA
WP_001350137.1|1867389_1868823_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	1.5e-31
WP_000195072.1|1868988_1871862_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	8.2e-263
>prophage 130
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1879998	1881231	5007984		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1879998_1881231_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 131
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1894726	1895404	5007984		Bacillus_virus(100.0%)	1	NA	NA
WP_000956879.1|1894726_1895404_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	6.4e-09
>prophage 132
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1900456	1901365	5007984		Yersinia_phage(100.0%)	1	NA	NA
WP_000646942.1|1900456_1901365_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 133
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1909519	1910674	5007984		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1909519_1910674_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 134
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1933369	1934632	5007984	integrase	Pseudomonas_phage(100.0%)	1	1924386:1924399	1935833:1935846
1924386:1924399	attL	TTTGCTGGCCCCAG	NA	NA	NA	NA
WP_001218820.1|1933369_1934632_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
WP_001218820.1|1933369_1934632_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
1935833:1935846	attR	TTTGCTGGCCCCAG	NA	NA	NA	NA
>prophage 135
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1963486	1971967	5007984	transposase	Mycobacterium_phage(33.33%)	5	NA	NA
WP_000999383.1|1963486_1964719_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.7	2.9e-60
WP_001513967.1|1964854_1965499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350737.1|1965692_1967141_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_162991667.1|1967311_1968525_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	3.9e-166
WP_000792544.1|1969918_1971967_-	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
>prophage 136
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1979942	1982118	5007984		Yersinia_phage(33.33%)	4	NA	NA
WP_021532141.1|1979942_1980761_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	3.0e-45
WP_000860054.1|1980851_1981337_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.2	3.8e-11
WP_001186756.1|1981351_1981828_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692312.1|1981896_1982118_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
>prophage 137
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	1987604	1988588	5007984		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001331698.1|1987604_1988588_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 138
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2002169	2002829	5007984		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000590258.1|2002169_2002829_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	9.0e-08
>prophage 139
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2035508	2036681	5007984		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_016239329.1|2035508_2036681_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.6	4.2e-40
>prophage 140
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2058905	2059790	5007984		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|2058905_2059790_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 141
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2065633	2072952	5007984		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013152.1|2065633_2066461_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_000691616.1|2066660_2067587_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848521.1|2067637_2067895_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095186.1|2067936_2070156_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000438655.1|2070407_2071157_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001331680.1|2071479_2072952_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	1.7e-46
>prophage 142
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2080410	2085450	5007984		Bacillus_virus(50.0%)	4	NA	NA
WP_001281888.1|2080410_2082669_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
WP_001350728.1|2082806_2084414_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183493.1|2084522_2085005_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_000712658.1|2085057_2085450_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 143
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2093292	2105738	5007984		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_000986428.1|2093292_2094276_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
WP_000940869.1|2094272_2095082_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	2.7e-14
WP_001240663.1|2095455_2097597_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195274.1|2097660_2099553_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
WP_000105733.1|2099581_2100163_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444744.1|2100162_2100990_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2101014_2101437_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2101437_2102067_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|2102271_2103753_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2103900_2104572_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442855.1|2104577_2105738_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.4	9.1e-88
>prophage 144
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2116971	2117625	5007984		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|2116971_2117625_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 145
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2121538	2122972	5007984		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|2121538_2122972_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 146
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2128109	2129348	5007984	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708479.1|2128109_2129348_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 147
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2135756	2151941	5007984	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264377.1|2135756_2136770_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
WP_001144069.1|2137007_2137223_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918851.1|2137333_2139079_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	8.4e-77
WP_000437380.1|2139273_2141115_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2141193_2141700_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065876.1|2141953_2142718_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000120223.1|2142994_2143618_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094730.1|2143771_2145292_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_001297164.1|2145709_2147089_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000450588.1|2147130_2147463_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212450.1|2147681_2148665_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082822.1|2148848_2151941_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	8.5e-157
>prophage 148
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2163602	2164568	5007984		Escherichia_phage(100.0%)	1	NA	NA
WP_001098826.1|2163602_2164568_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 149
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2184446	2186741	5007984		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861709.1|2184446_2186741_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 150
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2192889	2194035	5007984		Streptococcus_phage(100.0%)	1	NA	NA
WP_021532145.1|2192889_2194035_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.9	3.1e-48
>prophage 151
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2210718	2218514	5007984		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|2210718_2211582_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_000249171.1|2211646_2213683_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246833.1|2213640_2214036_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|2214055_2214646_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2214655_2215231_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147637.1|2215343_2216384_-	permease	NA	NA	NA	NA	NA
WP_021532146.1|2216456_2217092_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001350722.1|2217219_2217738_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	1.7e-09
WP_000449450.1|2217717_2218161_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189322.1|2218211_2218514_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 152
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2224216	2226106	5007984		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2224216_2226106_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 153
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2231587	2238226	5007984		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133040.1|2231587_2234260_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
WP_001031057.1|2234284_2235772_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2235799_2236252_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207671.1|2236882_2238226_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 154
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2242303	2245176	5007984	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764750.1|2242303_2243152_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	2.6e-23
WP_001107467.1|2243241_2245176_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 155
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2251805	2253288	5007984		Indivirus(50.0%)	2	NA	NA
WP_001047338.1|2251805_2252777_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445401.1|2253009_2253288_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	69.8	2.2e-16
>prophage 156
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2257356	2272151	5007984		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2257356_2258166_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922880.1|2258375_2259353_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2259366_2260353_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|2260373_2260940_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2260936_2261512_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2261480_2262038_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2262044_2262770_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2262817_2264251_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2264273_2264561_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183674.1|2264678_2265170_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2265215_2266070_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2266066_2266339_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620407.1|2266552_2267185_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047069.1|2267181_2267910_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719794.1|2267906_2268560_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809780.1|2268789_2271126_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001296449.1|2271221_2272151_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 157
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2280854	2284865	5007984	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_000108476.1|2280854_2282345_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224714.1|2282453_2283347_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000074795.1|2283468_2284260_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366127.1|2284367_2284865_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 158
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2288832	2291357	5007984	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001298588.1|2288832_2290200_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
WP_000497723.1|2290289_2291357_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 159
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2307851	2308895	5007984		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2307851_2308895_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 160
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2318182	2322694	5007984		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000132905.1|2318182_2319682_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	7.5e-18
WP_001331656.1|2319742_2320633_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275539.1|2320668_2321523_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843960.1|2321863_2322694_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 161
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2328033	2328918	5007984		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258951.1|2328033_2328918_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 162
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2335422	2339576	5007984		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738577.1|2335422_2336448_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
WP_001350717.1|2336515_2337697_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_021532149.1|2337706_2338810_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078319.1|2338817_2339576_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.5e-19
>prophage 163
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2349913	2351385	5007984	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2349913_2350423_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004421.1|2350437_2351385_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 164
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2372609	2374562	5007984		Vibrio_phage(100.0%)	1	NA	NA
WP_001514015.1|2372609_2374562_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 165
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2380698	2393290	5007984	transposase	uncultured_Caudovirales_phage(33.33%)	13	NA	NA
WP_139371347.1|2380698_2381911_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001298207.1|2382645_2383107_+	type II secretion system protein GspM	NA	NA	NA	NA	NA
WP_000178175.1|2383106_2383784_+	prepilin peptidase GspO	NA	NA	NA	NA	NA
WP_000675504.1|2383812_2384289_-	bacterioferritin	NA	NA	NA	NA	NA
WP_000289085.1|2384360_2384555_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_000773166.1|2384723_2387426_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	1.5e-40
WP_000031783.1|2387717_2388902_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2388972_2391087_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_016239342.1|2391183_2391654_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2391750_2392125_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903381.1|2392250_2392538_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820734.1|2392544_2392904_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	3.1e-10
WP_001209702.1|2392903_2393290_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	4.3e-18
>prophage 166
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2398860	2408401	5007984		Tupanvirus(25.0%)	9	NA	NA
WP_001514019.1|2398860_2400774_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.1	8.0e-73
WP_000057415.1|2400773_2401796_+	hydrolase	NA	NA	NA	NA	NA
WP_000907086.1|2401789_2402008_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	4.0e-05
WP_001274684.1|2402061_2402931_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2402985_2403390_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2403691_2404324_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001304921.1|2404374_2406465_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_169063376.1|2406531_2407752_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601853.1|2407837_2408401_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
>prophage 167
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2427311	2428148	5007984		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2427311_2428148_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 168
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2445052	2448819	5007984		Bacillus_phage(66.67%)	3	NA	NA
WP_001309803.1|2445052_2446675_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253708.1|2446750_2448103_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2448099_2448819_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 169
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2455395	2456289	5007984		Sodalis_phage(100.0%)	1	NA	NA
WP_000039083.1|2455395_2456289_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 170
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2462449	2464843	5007984		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081889.1|2462449_2464843_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 171
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2469233	2470460	5007984		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105471.1|2469233_2470460_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 172
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2485863	2488311	5007984		Dickeya_phage(100.0%)	1	NA	NA
WP_000993444.1|2485863_2488311_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 173
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2508181	2509992	5007984		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073603.1|2508181_2508925_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.4e-11
WP_000907827.1|2508921_2509992_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 174
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2513533	2515016	5007984		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|2513533_2514247_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|2514248_2515016_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 175
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2523907	2528634	5007984		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_001332164.1|2523907_2524828_+	phosphoglycerate dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	30.7	3.3e-24
WP_000661262.1|2524827_2525712_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000130217.1|2525815_2526670_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2526914_2527973_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2527965_2528634_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 176
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2531640	2535939	5007984		Dickeya_phage(50.0%)	4	NA	NA
WP_000964729.1|2531640_2532267_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.1	2.7e-30
WP_000106588.1|2532340_2534539_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.6	1.0e-119
WP_000130621.1|2534807_2535053_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|2535273_2535939_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 177
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2543832	2544639	5007984		Bacillus_virus(100.0%)	1	NA	NA
WP_000173679.1|2543832_2544639_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
>prophage 178
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2552078	2554814	5007984		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149183.1|2552078_2554814_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 179
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2564500	2566543	5007984		Indivirus(100.0%)	1	NA	NA
WP_001312164.1|2564500_2566543_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
>prophage 180
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2569682	2570108	5007984		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000065791.1|2569682_2570108_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
>prophage 181
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2580779	2582249	5007984		Pithovirus(50.0%)	2	NA	NA
WP_001332154.1|2580779_2581550_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	1.7e-18
WP_000123131.1|2581601_2582249_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 182
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2629014	2630999	5007984		Bacillus_virus(50.0%)	2	NA	NA
WP_000103579.1|2629014_2630019_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196477.1|2630015_2630999_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 183
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2640884	2643218	5007984		Escherichia_phage(100.0%)	1	NA	NA
WP_000013974.1|2640884_2643218_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	3.7e-72
>prophage 184
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2646872	2647085	5007984		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2646872_2647085_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 185
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2651306	2652302	5007984		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182635.1|2651306_2652302_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.0e-11
>prophage 186
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2657620	2659162	5007984		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146512.1|2657620_2659162_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 187
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2678736	2683348	5007984		Clostridioides_phage(50.0%)	3	NA	NA
WP_000985743.1|2678736_2680032_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	3.7e-21
WP_000741500.1|2680161_2681313_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000582432.1|2681503_2683348_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 188
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2705474	2714980	5007984		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2705474_2705726_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2705866_2706298_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|2706542_2708087_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214150.1|2708096_2709380_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483824.1|2709383_2710343_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982107.1|2710329_2711364_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000646018.1|2711602_2712628_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213847.1|2712637_2713834_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.4e-35
WP_000587750.1|2714047_2714980_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 189
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2718388	2720482	5007984		Catovirus(50.0%)	2	NA	NA
WP_000064025.1|2718388_2719372_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-12
WP_000364803.1|2719453_2720482_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	5.5e-12
>prophage 190
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2727920	2732483	5007984		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|2727920_2728400_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|2728438_2729248_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2729345_2729513_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2729533_2729770_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|2729986_2730655_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050149.1|2730826_2732047_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	8.5e-44
WP_000976066.1|2732024_2732483_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	1.6e-48
>prophage 191
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2735857	2742608	5007984		Morganella_phage(25.0%)	6	NA	NA
WP_001297973.1|2735857_2736682_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.5	1.3e-91
WP_000924289.1|2736973_2737591_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001363072.1|2737587_2739270_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.4	6.7e-23
WP_001295237.1|2739527_2740151_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2740205_2740481_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|2740499_2742608_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 192
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2746909	2748301	5007984		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2746909_2748301_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 193
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2761562	2762600	5007984		Wolbachia_phage(100.0%)	1	NA	NA
WP_001280586.1|2761562_2762600_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 194
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2768041	2769376	5007984		Moraxella_phage(100.0%)	1	NA	NA
WP_001363077.1|2768041_2769376_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 195
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2776680	2788557	5007984		Micromonas_sp._RCC1109_virus(20.0%)	11	NA	NA
WP_000168473.1|2776680_2778369_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.2e-56
WP_001312198.1|2778474_2778573_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001332269.1|2778973_2780158_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_000148034.1|2780165_2780663_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113443.1|2780659_2781022_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2781011_2781359_-	YidH family protein	NA	NA	NA	NA	NA
WP_001087168.1|2782907_2784623_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.0	6.1e-40
WP_001332266.1|2784789_2785656_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279773.1|2785745_2787407_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|2787603_2788032_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2788143_2788557_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 196
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2792986	2794135	5007984		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|2792986_2794135_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 197
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2798840	2806209	5007984		Bacillus_virus(33.33%)	8	NA	NA
WP_001298010.1|2798840_2801255_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.8e-115
WP_000060112.1|2801283_2802357_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2802356_2803457_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2803461_2804865_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122083097.1|2805161_2805242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|2805471_2805612_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2805628_2805988_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2805951_2806209_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 198
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2816406	2817744	5007984		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|2816406_2817744_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 199
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2828115	2835630	5007984		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|2828115_2828889_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251985.1|2828979_2829870_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2829869_2830829_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2830915_2831956_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|2832269_2834099_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933754.1|2834259_2835630_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
>prophage 200
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2847585	2848578	5007984		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845129.1|2847585_2848578_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	2.2e-50
>prophage 201
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2851746	2857599	5007984		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|2851746_2853615_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001350412.1|2853781_2854201_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387779.1|2854208_2855714_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|2855718_2856684_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|2856708_2857599_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 202
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2870995	2872642	5007984		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_021532159.1|2870995_2872642_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.5e-67
>prophage 203
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2880238	2885652	5007984		Bacillus_phage(33.33%)	4	NA	NA
WP_001238853.1|2880238_2882260_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	1.9e-112
WP_001314257.1|2882306_2883791_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|2883926_2885192_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2885322_2885652_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 204
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2889694	2895838	5007984		Enterobacteria_phage(40.0%)	6	NA	NA
WP_021532161.1|2889694_2890825_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
WP_000006614.1|2890821_2892084_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	7.7e-24
WP_001226621.1|2892083_2893151_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.8e-102
WP_000676056.1|2893169_2894051_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145189.1|2894028_2894703_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612051.1|2894707_2895838_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 205
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2903912	2905568	5007984		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395836.1|2903912_2905568_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 206
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2913679	2914996	5007984		Salmonella_phage(100.0%)	1	NA	NA
WP_001014285.1|2913679_2914996_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	49.1	3.5e-11
>prophage 207
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2918415	2922274	5007984		Bacillus_phage(100.0%)	3	NA	NA
WP_000130676.1|2918415_2919312_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213586.1|2919311_2920028_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|2920111_2922274_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 208
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2929644	2931474	5007984		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2929644_2931474_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 209
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2941934	2943443	5007984		Vibrio_phage(100.0%)	1	NA	NA
WP_000037973.1|2941934_2943443_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 210
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2965438	2968725	5007984		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|2965438_2967079_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|2967157_2967427_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459600.1|2967430_2967946_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109949.1|2967948_2968725_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 211
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2977606	2978221	5007984		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|2977606_2978221_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 212
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2991913	2994700	5007984		uncultured_virus(100.0%)	1	NA	NA
WP_000250046.1|2991913_2994700_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 213
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	2998726	3001197	5007984		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001315107.1|2998726_3000136_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190574.1|3000147_3001197_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
>prophage 214
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3005082	3009812	5007984		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|3005082_3005871_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_001363089.1|3005910_3006807_-	sugar kinase	NA	NA	NA	NA	NA
WP_000190782.1|3006978_3007857_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.0e-47
WP_000094544.1|3007881_3008769_+	aldolase	NA	NA	NA	NA	NA
WP_000357981.1|3008801_3009812_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 215
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3022408	3025459	5007984		Escherichia_phage(100.0%)	1	NA	NA
WP_012579028.1|3022408_3025459_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 216
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3036562	3041423	5007984		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001350871.1|3036562_3037183_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	2.4e-63
WP_001166063.1|3037442_3038426_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270237.1|3038574_3039249_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3039354_3040728_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|3040724_3041423_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 217
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3053033	3053879	5007984		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000084268.1|3053033_3053879_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 218
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3057642	3058974	5007984		Erwinia_phage(100.0%)	1	NA	NA
WP_001293344.1|3057642_3058974_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 219
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3072184	3076778	5007984		Pandoravirus(100.0%)	3	NA	NA
WP_000859437.1|3072184_3073735_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	3.4e-05
WP_000105536.1|3073967_3075092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694069.1|3075224_3076778_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	7.8e-10
>prophage 220
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3083591	3090838	5007984		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424854.1|3083591_3084254_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
WP_001185153.1|3084265_3086767_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004469.1|3087075_3088155_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3088169_3088490_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184865.1|3088540_3090838_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 221
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3102982	3104197	5007984		Oenococcus_phage(100.0%)	1	NA	NA
WP_000691040.1|3102982_3104197_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	27.9	3.8e-44
>prophage 222
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3109637	3115420	5007984	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_000125464.1|3109637_3110954_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	1.6e-59
WP_122083113.1|3111057_3111708_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806411.1|3111707_3112067_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000187001.1|3112106_3113207_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_021532167.1|3113575_3115420_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
>prophage 223
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3123766	3126819	5007984		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3123766_3124717_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3125634_3126819_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 224
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3130814	3139143	5007984		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3130814_3134843_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653952.1|3134919_3139143_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
>prophage 225
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3147437	3149201	5007984		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3147437_3148109_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|3148151_3148742_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3148928_3149201_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 226
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3154563	3156153	5007984		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187584.1|3154563_3156153_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 227
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3169855	3173539	5007984		Dickeya_phage(100.0%)	1	NA	NA
WP_000096034.1|3169855_3173539_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 228
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3197880	3198996	5007984		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3197880_3198996_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 229
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3206436	3207045	5007984		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3206436_3207045_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 230
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3219340	3223463	5007984		Escherichia_phage(25.0%)	4	NA	NA
WP_001296639.1|3219340_3220756_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
WP_001147328.1|3220808_3221888_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000122235.1|3221910_3222468_+	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	28.8	1.7e-15
WP_001331852.1|3222464_3223463_+	AAA family ATPase	NA	K4F711	Cronobacter_phage	30.7	7.0e-28
>prophage 231
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3228862	3230281	5007984		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000103922.1|3228862_3230281_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.6e-38
>prophage 232
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3240224	3243837	5007984		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357763.1|3240224_3243047_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
WP_000168305.1|3243300_3243837_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 233
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3247654	3249004	5007984		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|3247654_3249004_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 234
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3255210	3257169	5007984		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078225.1|3255210_3257169_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	2.5e-90
>prophage 235
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3266539	3268067	5007984		Planktothrix_phage(100.0%)	2	NA	NA
WP_000156933.1|3266539_3267244_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.3e-20
WP_000132446.1|3267230_3268067_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
>prophage 236
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3271984	3274132	5007984		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|3271984_3274132_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 237
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3279376	3285747	5007984		Tetraselmis_virus(50.0%)	4	NA	NA
WP_001350810.1|3279376_3281362_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	4.9e-150
WP_001171671.1|3281636_3282566_-	allose kinase	NA	NA	NA	NA	NA
WP_001314355.1|3282549_3283245_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000235242.1|3284214_3285747_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	6.3e-20
>prophage 238
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3291862	3293412	5007984		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611410.1|3291862_3292543_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001075531.1|3292653_3293412_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
>prophage 239
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3299016	3299805	5007984		Pithovirus(100.0%)	1	NA	NA
WP_001193413.1|3299016_3299805_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.9e-12
>prophage 240
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3304645	3306148	5007984		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|3304645_3306148_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 241
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3325711	3328923	5007984	tRNA	Catovirus(50.0%)	2	NA	NA
WP_000003806.1|3325711_3327229_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856826.1|3327465_3328923_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
>prophage 242
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3336529	3337742	5007984	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_139371347.1|3336529_3337742_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 243
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3344106	3345320	5007984	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_139371347.1|3344106_3345320_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 244
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3364508	3365774	5007984	integrase	Enterobacteria_phage(100.0%)	1	3352479:3352492	3367425:3367438
3352479:3352492	attL	AATTACCGTCTTTG	NA	NA	NA	NA
WP_001218869.1|3364508_3365774_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|3364508_3365774_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
3367425:3367438	attR	CAAAGACGGTAATT	NA	NA	NA	NA
>prophage 245
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3374108	3376092	5007984		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3374108_3374402_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3374445_3376092_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 246
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3380296	3380830	5007984		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|3380296_3380830_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 247
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3385750	3386728	5007984		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3385750_3386728_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 248
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3394724	3395270	5007984		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3394724_3395270_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 249
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3399185	3412216	5007984	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990304.1|3399185_3400523_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	3.3e-17
WP_001298688.1|3400532_3402380_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_001280359.1|3402372_3403323_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3403408_3403717_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460357.1|3403792_3405073_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312482.1|3405158_3406418_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3406420_3407425_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3407506_3407704_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3407807_3409106_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3409310_3409736_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076340.1|3409774_3412216_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
>prophage 250
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3416059	3417223	5007984		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944012.1|3416059_3417223_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
>prophage 251
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3459471	3529105	5007984	holin,protease,tRNA,transposase	uncultured_Caudovirales_phage(11.11%)	56	NA	NA
WP_000055072.1|3459471_3460002_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265925.1|3460311_3461268_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205834.1|3461407_3462910_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	6.2e-12
WP_001298067.1|3462923_3463946_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595996.1|3463932_3464928_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3464960_3465959_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|3466134_3467508_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|3467665_3468217_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162189.1|3468310_3469663_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232246.1|3469846_3470233_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106233.1|3470277_3470742_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187799.1|3470899_3473038_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001331760.1|3473431_3475087_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001331761.1|3475136_3476558_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|3476676_3477624_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3477808_3477862_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471858.1|3478002_3480699_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	1.5e-45
WP_000047539.1|3480904_3481291_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3481363_3481825_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3481837_3482773_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|3482776_3482911_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000666045.1|3483000_3483489_-	arginine repressor	NA	NA	NA	NA	NA
WP_001298046.1|3483604_3485008_-	YfcC family protein	NA	NA	NA	NA	NA
WP_000235829.1|3485064_3486069_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000428628.1|3486079_3487024_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001346533.1|3487034_3488255_-	arginine deiminase	NA	NA	NA	NA	NA
WP_000635216.1|3488932_3489385_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000012936.1|3489430_3490435_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002952.1|3490596_3491013_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001298035.1|3491189_3491693_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001000687.1|3491885_3493073_+	DUF898 family protein	NA	NA	NA	NA	NA
WP_000416385.1|3493119_3495975_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|3495974_3496418_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3496675_3498187_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_023150257.1|3498453_3499554_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001331766.1|3499553_3500636_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294566.1|3500796_3502299_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.1e-82
WP_001331768.1|3502376_3503375_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128336.1|3503441_3504761_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|3504825_3505590_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197423.1|3505613_3506645_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|3506861_3507425_+	gluconokinase	NA	NA	NA	NA	NA
WP_001350789.1|3507428_3508448_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_102384962.1|3510351_3511580_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000483767.1|3514341_3515688_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_169063380.1|3516296_3517373_+	MFS transporter	NA	NA	NA	NA	NA
WP_139371347.1|3517412_3518626_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_169063387.1|3518701_3518827_+	transporter	NA	NA	NA	NA	NA
WP_000611568.1|3518838_3519957_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594405.1|3519999_3520125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|3520177_3520435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514090.1|3522325_3524323_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_085947616.1|3524476_3525633_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000177057.1|3526566_3526824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|3527380_3528148_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|3528148_3529105_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 252
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3549274	3551684	5007984		Yersinia_phage(33.33%)	4	NA	NA
WP_001234655.1|3549274_3550093_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	6.1e-46
WP_001350782.1|3550434_3550908_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001186775.1|3550923_3551400_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|3551462_3551684_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 253
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3574623	3575604	5007984		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991438.1|3574623_3575604_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 254
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3578966	3580643	5007984		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|3578966_3579569_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|3580046_3580643_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 255
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3590917	3592378	5007984		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208176.1|3590917_3592378_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	6.2e-49
>prophage 256
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3598947	3599502	5007984		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|3598947_3599502_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 257
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3605448	3606369	5007984	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_001513532.1|3605448_3606369_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	6.4e-60
>prophage 258
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3611245	3615214	5007984		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001387312.1|3611245_3612715_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
WP_001513536.1|3612781_3615214_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
>prophage 259
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3620455	3622129	5007984		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_021532199.1|3620455_3622129_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 260
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3632752	3634032	5007984		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3632752_3633490_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001513545.1|3633492_3634032_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 261
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3642154	3715243	5007984	holin,protease,portal,tRNA,tail,terminase,capsid,head,integrase	Escherichia_phage(31.58%)	87	3639074:3639093	3706811:3706830
3639074:3639093	attL	AGGCGTTCACGCCGCATCCG	NA	NA	NA	NA
WP_001513547.1|3642154_3643390_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.3	4.5e-234
WP_169063381.1|3643549_3644683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023150131.1|3645086_3645707_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.7	2.3e-114
WP_001513549.1|3645708_3646038_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	36.6	6.9e-25
WP_000476211.1|3646034_3646274_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	98.7	2.2e-36
WP_001513550.1|3646266_3646470_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	97.0	5.2e-31
WP_001242718.1|3646466_3646829_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_001401560.1|3646819_3647356_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_000081278.1|3647483_3648308_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135680.1|3648373_3648736_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001513551.1|3649304_3649799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450740.1|3650155_3650782_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	3.2e-47
WP_000205494.1|3650879_3651080_+	cell division protein	NA	NA	NA	NA	NA
WP_000514174.1|3651117_3651702_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001250270.1|3651877_3652090_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_001513552.1|3652046_3653039_+	hypothetical protein	NA	U5P0A0	Shigella_phage	97.0	2.1e-93
WP_001573323.1|3653035_3653530_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000210176.1|3653529_3653856_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|3653852_3654242_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001513553.1|3654261_3655059_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.6e-150
WP_001433852.1|3655066_3656056_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_001204806.1|3656073_3656454_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_077462104.1|3656551_3656884_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.9	2.0e-48
WP_000839572.1|3657615_3657831_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_023150135.1|3657835_3658642_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	85.8	7.4e-129
WP_000551290.1|3658651_3658966_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_016236259.1|3659094_3659628_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.9	6.9e-99
WP_000459345.1|3659787_3659925_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_042094754.1|3660146_3660347_+	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	71.2	1.3e-13
WP_023150316.1|3660414_3660654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140099.1|3660857_3661208_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001330091.1|3661355_3661838_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	2.5e-84
WP_001140907.1|3661837_3663595_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_000811487.1|3663591_3663753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513556.1|3663742_3664969_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	9.0e-203
WP_000999828.1|3664961_3665561_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000766109.1|3665575_3666793_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719066.1|3666869_3667187_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_001147816.1|3667195_3667534_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	89.3	1.7e-50
WP_023910305.1|3667530_3667980_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.9	2.7e-64
WP_001206699.1|3667976_3668321_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.8e-55
WP_001441850.1|3668380_3669085_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	94.4	1.8e-115
WP_000164661.1|3669099_3669471_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978931.1|3669494_3669773_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.9	1.6e-43
WP_000224012.1|3669819_3673047_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	92.9	0.0e+00
WP_000807954.1|3673039_3673381_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_016230622.1|3673380_3674079_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
WP_001513560.1|3674083_3674827_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	1.7e-151
WP_071592395.1|3674763_3675396_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	7.2e-95
WP_001513561.1|3675456_3678936_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001513563.1|3679003_3679603_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	1.8e-108
WP_169063382.1|3679667_3681731_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	64.5	8.7e-150
WP_001204581.1|3681727_3682006_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_001513565.1|3682015_3682303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217553.1|3682420_3682669_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000202563.1|3682888_3684475_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|3684867_3685473_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3685599_3685761_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_021532200.1|3685882_3686956_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563046.1|3686952_3687732_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088372.1|3687948_3688812_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143234.1|3688783_3690334_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001350777.1|3690591_3691371_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477823.1|3691448_3692771_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	3.0e-79
WP_000816460.1|3692822_3694046_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224879.1|3694102_3694822_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001293112.1|3694988_3696320_+	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000105871.1|3696320_3697337_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124624.1|3697364_3698009_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132964.1|3698114_3699083_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|3699131_3700514_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093834.1|3700534_3701767_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000513550.1|3701858_3702191_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000007436.1|3702192_3702477_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000046754.1|3702532_3704200_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000409429.1|3704406_3706344_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068677.1|3706433_3706760_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001339518.1|3706832_3707360_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
3706811:3706830	attR	CGGATGCGGCGTGAACGCCT	NA	NA	NA	NA
WP_000942350.1|3707411_3708059_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371658.1|3708055_3708925_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|3709135_3709609_+	protein CreA	NA	NA	NA	NA	NA
WP_001188687.1|3709621_3710311_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219586.1|3710310_3711735_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	1.1e-10
WP_000920363.1|3711792_3713145_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3713204_3713921_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001295754.1|3714016_3714157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223199.1|3714556_3715243_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 262
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3723390	3724344	5007984		Cyanophage(100.0%)	1	NA	NA
WP_000130187.1|3723390_3724344_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 263
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3727480	3742001	5007984	tRNA	Chrysochromulina_ericina_virus(16.67%)	12	NA	NA
WP_000516135.1|3727480_3729397_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3729485_3730616_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|3730720_3730930_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001274823.1|3731484_3732246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350775.1|3732265_3733759_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	2.8e-28
WP_000494924.1|3733887_3735147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681386.1|3735381_3736548_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.8	3.0e-91
WP_000062878.1|3736607_3737513_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001274021.1|3737608_3737872_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001337277.1|3737974_3738193_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_000767329.1|3738200_3739142_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001286813.1|3739184_3742001_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	25.7	4.6e-77
>prophage 264
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3746809	3747958	5007984		Halovirus(100.0%)	1	NA	NA
WP_001295757.1|3746809_3747958_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 265
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3751420	3759831	5007984	transposase	Saccharomonospora_phage(33.33%)	8	NA	NA
WP_000526115.1|3751420_3751879_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000333104.1|3752168_3752564_+	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_000122880.1|3752682_3753273_-	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_000004399.1|3753278_3754064_-	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001350362.1|3754172_3755726_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.9e-35
WP_000349942.1|3755798_3757016_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3757143_3758286_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|3758316_3759831_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 266
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3767725	3769687	5007984		Bacillus_phage(50.0%)	5	NA	NA
WP_000624375.1|3767725_3768205_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|3768290_3768524_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_001332330.1|3768526_3768649_+	CcdB family protein	NA	NA	NA	NA	NA
WP_146692624.1|3768689_3768842_+	CcdB family protein	NA	NA	NA	NA	NA
WP_000257201.1|3768838_3769687_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 267
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3777464	3782886	5007984		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|3777464_3780371_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035622.1|3780534_3782886_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	6.7e-37
>prophage 268
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3791162	3791861	5007984		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916269.1|3791162_3791861_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-21
>prophage 269
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3803339	3805064	5007984		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425644.1|3803339_3805064_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 270
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3831034	3832078	5007984		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3831034_3832078_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 271
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3836324	3836876	5007984		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923703.1|3836324_3836876_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 272
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3849291	3850716	5007984		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3849291_3850716_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 273
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3858536	3865004	5007984		Mamastrovirus(33.33%)	5	NA	NA
WP_001189635.1|3858536_3860087_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.1e-18
WP_001332319.1|3860133_3862524_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3862729_3863266_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651600.1|3863306_3863969_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|3864077_3865004_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 274
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3868266	3869151	5007984		Sodalis_phage(100.0%)	1	NA	NA
WP_000339931.1|3868266_3869151_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	48.4	1.0e-59
>prophage 275
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3879043	3885849	5007984	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|3879043_3880462_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937401.1|3880500_3881427_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3881463_3881919_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396047.1|3882096_3882801_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294708.1|3882815_3883346_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001362943.1|3883419_3885849_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	1.0e-40
>prophage 276
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3890990	3891788	5007984		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3890990_3891788_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 277
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3897699	3898044	5007984		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3897699_3898044_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 278
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3901973	3903398	5007984	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753936.1|3901973_3903398_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 279
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3914975	3915734	5007984		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|3914975_3915734_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 280
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3924562	3928678	5007984		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569434.1|3924562_3925159_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294798.1|3925195_3928678_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
>prophage 281
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3941635	3942667	5007984		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3941635_3942667_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 282
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3949192	3957044	5007984		Indivirus(25.0%)	9	NA	NA
WP_000997016.1|3949192_3949996_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
WP_000648548.1|3949992_3950907_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3951147_3951948_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211705.1|3952025_3952796_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3952842_3954201_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052741.1|3954272_3955028_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|3955061_3955784_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3955780_3956248_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|3956312_3957044_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 283
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3966306	3969066	5007984		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614314.1|3966306_3969066_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	4.7e-82
>prophage 284
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	3991318	3994641	5007984		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|3991318_3991897_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001331866.1|3992101_3992869_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3992839_3993580_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|3993891_3994641_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
>prophage 285
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4000614	4001766	5007984		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001331869.1|4000614_4001766_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
>prophage 286
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4006514	4016125	5007984		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000749902.1|4006514_4007570_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|4007858_4008962_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|4008973_4010227_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
WP_000772639.1|4010571_4010910_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
WP_001298126.1|4011344_4011869_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021531964.1|4011994_4016125_-	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.6	3.3e-281
>prophage 287
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4034408	4035260	5007984		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|4034408_4035260_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 288
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4041305	4045946	5007984	transposase	Staphylococcus_phage(33.33%)	4	NA	NA
WP_001295799.1|4041305_4042175_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_001298546.1|4042334_4042928_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_102384962.1|4043205_4044433_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001046332.1|4044620_4045946_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
>prophage 289
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4055871	4063444	5007984	holin,integrase	Escherichia_phage(33.33%)	5	4054588:4054601	4057586:4057599
4054588:4054601	attL	AACGCATCCTTCCC	NA	NA	NA	NA
WP_001295805.1|4055871_4056435_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001159135.1|4057506_4059195_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
4057586:4057599	attR	AACGCATCCTTCCC	NA	NA	NA	NA
WP_001350625.1|4059208_4060681_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001314510.1|4060694_4061282_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131041.1|4061410_4063444_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 290
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4076183	4080721	5007984		Bacillus_virus(50.0%)	4	NA	NA
WP_000447331.1|4076183_4077668_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818902.1|4077660_4078632_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750346.1|4078628_4079585_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692719.1|4079671_4080721_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.8e-71
>prophage 291
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4088252	4090139	5007984		Staphylococcus_phage(100.0%)	1	NA	NA
WP_021531968.1|4088252_4090139_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	1.8e-53
>prophage 292
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4095098	4102380	5007984		Herpes_simplex_virus(33.33%)	5	NA	NA
WP_000177872.1|4095098_4098173_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.5	0.0e+00
WP_000805859.1|4098295_4099378_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	2.4e-191
WP_001096705.1|4099579_4100119_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000419070.1|4100344_4101178_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842109.1|4101270_4102380_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 293
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4107672	4108440	5007984		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939359.1|4107672_4108440_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 294
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4115348	4116506	5007984		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830766.1|4115348_4116506_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 295
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4123922	4125038	5007984		Bacillus_phage(100.0%)	1	NA	NA
WP_000484068.1|4123922_4125038_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 296
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4129327	4139425	5007984		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4129327_4130239_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219315.1|4130363_4131272_+	fructokinase	NA	NA	NA	NA	NA
WP_001331503.1|4131540_4132725_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698877.1|4132850_4135994_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221279.1|4135990_4137193_-	exonuclease subunit SbcD	NA	L0LAJ8	Bacillus_phage	25.1	9.1e-06
WP_000113933.1|4137382_4138072_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|4138129_4139425_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 297
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4146502	4155344	5007984	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4146502_4147630_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4147652_4147985_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934823.1|4148012_4149860_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4149870_4150842_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_001317658.1|4150971_4151319_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295827.1|4151356_4152241_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001298536.1|4152538_4153078_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4153228_4153678_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150487.1|4153681_4154785_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.7e-54
WP_001350619.1|4154873_4155344_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 298
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4176786	4181833	5007984	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4176786_4177410_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4177535_4178810_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4178997_4181352_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4181560_4181833_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 299
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4184973	4185669	5007984		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|4184973_4185669_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 300
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4188992	4192539	5007984		Bacillus_phage(100.0%)	2	NA	NA
WP_001235600.1|4188992_4190765_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.4e-50
WP_001256184.1|4190757_4192539_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	2.0e-41
>prophage 301
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4201376	4204526	5007984		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4201376_4204526_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 302
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4211534	4219992	5007984		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4211534_4212086_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122015.1|4212214_4214146_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4214198_4214528_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4214527_4215133_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678211.1|4215242_4217117_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.4e-117
WP_001331495.1|4217297_4217942_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250114.1|4218073_4219036_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801795.1|4219032_4219992_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	5.0e-15
>prophage 303
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4229554	4232796	5007984		Escherichia_phage(66.67%)	3	NA	NA
WP_000057524.1|4229554_4229857_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	2.2e-41
WP_000806442.1|4229892_4230234_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083945.1|4230291_4232796_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.0e-115
>prophage 304
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4239894	4240572	5007984		Bacillus_virus(100.0%)	1	NA	NA
WP_001157551.1|4239894_4240572_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 305
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4243708	4244395	5007984		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110564.1|4243708_4244395_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.9e-32
>prophage 306
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4250648	4252430	5007984		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001331491.1|4250648_4252430_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
>prophage 307
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4258620	4259766	5007984		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331490.1|4258620_4259766_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 308
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4271620	4276096	5007984	tRNA,tail	Moumouvirus(33.33%)	6	NA	NA
WP_000912345.1|4271620_4273006_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143516.1|4273041_4273563_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4273670_4273883_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4273884_4274751_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001287636.1|4274800_4274989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331487.1|4275739_4276096_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	67.5	3.8e-53
>prophage 309
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4284898	4287014	5007984		Hokovirus(50.0%)	2	NA	NA
WP_000253820.1|4284898_4286341_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	1.7e-11
WP_000770953.1|4286330_4287014_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 310
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4290159	4293303	5007984		Leptospira_phage(100.0%)	1	NA	NA
WP_000573983.1|4290159_4293303_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.3e-59
>prophage 311
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4304255	4310298	5007984		Tupanvirus(50.0%)	3	NA	NA
WP_000077765.1|4304255_4308137_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	1.7e-61
WP_000096768.1|4308352_4309486_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140634.1|4309482_4310298_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
>prophage 312
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4324600	4326423	5007984		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502940.1|4324600_4325230_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_000029771.1|4325202_4326423_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	2.7e-58
>prophage 313
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4329528	4331643	5007984		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4329528_4331094_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_001308472.1|4331214_4331643_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
>prophage 314
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4345731	4346378	5007984		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4345731_4345941_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4345994_4346378_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 315
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4350593	4353033	5007984		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4350593_4351805_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_021532017.1|4351944_4353033_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 316
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4360043	4365166	5007984	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001362899.1|4360043_4362626_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	8.9e-184
WP_001044880.1|4362860_4363343_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207539.1|4363387_4364323_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631389.1|4364440_4365166_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 317
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4373113	4374154	5007984		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|4373113_4374154_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 318
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4378292	4379957	5007984		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4378292_4379957_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 319
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4384582	4386529	5007984		Vibrio_phage(100.0%)	1	NA	NA
WP_001023115.1|4384582_4386529_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 320
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4394827	4397473	5007984	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_000679501.1|4394827_4395589_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
WP_001287134.1|4395808_4397473_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 321
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4401625	4402390	5007984		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773263.1|4401625_4402390_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	7.5e-06
>prophage 322
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4409045	4420878	5007984		Hokovirus(40.0%)	10	NA	NA
WP_000186082.1|4409045_4409723_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001350605.1|4409719_4412404_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_001331974.1|4412396_4412969_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087931.1|4412977_4415026_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	7.9e-26
WP_000730081.1|4415048_4416722_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4416721_4416811_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424788.1|4417123_4417330_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001075783.1|4417430_4417940_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000207170.1|4417936_4419355_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	4.7e-62
WP_001032722.1|4419396_4420878_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
>prophage 323
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4424256	4425048	5007984		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114008.1|4424256_4425048_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.4	3.7e-08
>prophage 324
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4452272	4455792	5007984		Vibrio_phage(33.33%)	4	NA	NA
WP_000345406.1|4452272_4452992_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_000951260.1|4452988_4453930_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.7e-23
WP_000784341.1|4454043_4454424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109195.1|4454739_4455792_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
>prophage 325
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4460155	4466731	5007984		Tupanvirus(33.33%)	7	NA	NA
WP_001265445.1|4460155_4461172_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	8.0e-80
WP_000096843.1|4461434_4462907_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	1.6e-12
WP_001147445.1|4462974_4463763_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4463891_4464041_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113014.1|4464207_4464981_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604040.1|4464980_4465670_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891671.1|4465672_4466731_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	9.7e-20
>prophage 326
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4476993	4478283	5007984		Klosneuvirus(100.0%)	1	NA	NA
WP_001362906.1|4476993_4478283_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 327
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4484610	4485519	5007984		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331964.1|4484610_4485519_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	3.7e-28
>prophage 328
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4496117	4507779	5007984		Anomala_cuprea_entomopoxvirus(20.0%)	10	NA	NA
WP_001331962.1|4496117_4497854_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000976402.1|4497846_4498845_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001295890.1|4498844_4499516_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007119.1|4499744_4501106_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001218658.1|4501642_4503793_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_000386565.1|4503820_4504783_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_021532022.1|4504923_4506009_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|4506236_4506497_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|4506761_4507028_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990167.1|4507101_4507779_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	6.9e-19
>prophage 329
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4514342	4519567	5007984		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4514342_4515065_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4515061_4515721_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4515859_4516606_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4517009_4517513_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4517811_4518699_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_122083111.1|4518933_4518999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295296.1|4519051_4519567_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 330
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4524564	4531448	5007984		Tupanvirus(33.33%)	5	NA	NA
WP_000961458.1|4524564_4526157_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000114251.1|4526356_4527172_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209353.1|4527317_4529750_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000576971.1|4529755_4530655_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001350598.1|4530785_4531448_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
>prophage 331
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4534663	4536535	5007984		Planktothrix_phage(100.0%)	1	NA	NA
WP_001350597.1|4534663_4536535_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 332
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4547869	4549072	5007984		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001467835.1|4547869_4549072_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.4e-99
>prophage 333
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4557619	4566768	5007984		Vibrio_phage(25.0%)	11	NA	NA
WP_001195230.1|4557619_4557877_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_001201575.1|4558036_4558324_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|4558307_4559030_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4559090_4559993_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4560080_4560557_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|4560906_4562019_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|4562113_4563247_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105433.1|4563256_4564210_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|4564206_4565052_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4565111_4565600_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149763.1|4565640_4566768_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
>prophage 334
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4569893	4572631	5007984		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|4569893_4570622_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001298306.1|4570839_4571355_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4571480_4571804_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255187.1|4571800_4572631_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
>prophage 335
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4576218	4577937	5007984		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815373.1|4576218_4577937_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
>prophage 336
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4587060	4620335	5007984	protease,tRNA	Vibrio_phage(20.0%)	21	NA	NA
WP_000188147.1|4587060_4589007_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4589079_4589304_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4589626_4589947_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4589977_4592254_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|4593086_4594070_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|4594066_4597300_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000415806.1|4597629_4598937_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001029748.1|4599867_4600869_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000350182.1|4600879_4601434_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001040187.1|4602475_4602694_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|4602978_4603683_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_169063385.1|4603724_4605446_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	26.4	6.9e-23
WP_001043638.1|4605446_4607213_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_000537432.1|4607335_4608301_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|4608844_4609339_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077107.1|4609473_4613517_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4613675_4614287_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|4614297_4615641_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4615731_4617024_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850286.1|4617262_4619707_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	7.8e-222
WP_000213098.1|4619717_4620335_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 337
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4623420	4626635	5007984		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|4623420_4624161_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|4624352_4626635_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 338
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4630733	4631822	5007984		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057124.1|4630733_4631822_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	9.2e-82
>prophage 339
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4636909	4641449	5007984		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|4636909_4637194_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_001513704.1|4637399_4639664_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|4639700_4641449_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 340
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4656154	4667103	5007984	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|4656154_4656703_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109453.1|4656729_4657377_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|4657426_4658617_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977927.1|4658801_4659890_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
WP_000117881.1|4660491_4661892_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_021532027.1|4662060_4663263_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193873.1|4663528_4666141_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	1.2e-18
WP_001090487.1|4666335_4667103_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
>prophage 341
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4675858	4677766	5007984		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|4675858_4677766_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 342
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4690366	4692421	5007984		Bacillus_phage(100.0%)	1	NA	NA
WP_001350178.1|4690366_4692421_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 343
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4696655	4697315	5007984	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4696655_4697315_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 344
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4708309	4720827	5007984		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|4708309_4708522_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|4708532_4708721_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|4708695_4708926_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|4708915_4709089_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818464.1|4709137_4710211_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054739.1|4710293_4713026_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	5.4e-38
WP_001264953.1|4713108_4714137_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|4714109_4714802_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|4714931_4716104_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063164.1|4716103_4718650_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_000210216.1|4718646_4719246_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024569.1|4719601_4719907_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|4719906_4720827_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 345
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4723857	4725851	5007984		Enterobacteria_phage(100.0%)	2	NA	NA
WP_001273658.1|4723857_4724031_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001028100.1|4725356_4725851_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	9.3e-50
>prophage 346
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4740446	4741235	5007984		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533536.1|4740446_4741235_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
>prophage 347
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4748055	4749423	5007984		Bacillus_phage(100.0%)	1	NA	NA
WP_000409834.1|4748055_4749423_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	9.6e-20
>prophage 348
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4752814	4753648	5007984		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|4752814_4753648_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 349
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4757781	4758315	5007984		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|4757781_4758315_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 350
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4767622	4768543	5007984		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|4767622_4768543_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 351
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4773205	4773451	5007984		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4773205_4773451_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 352
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4789331	4790273	5007984		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001331933.1|4789331_4790273_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	4.7e-10
>prophage 353
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4802629	4803811	5007984		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|4802629_4803364_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|4803574_4803811_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 354
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4807082	4808725	5007984		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257012.1|4807082_4807724_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.4	3.8e-27
WP_001267963.1|4807720_4808725_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 355
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4821047	4821305	5007984		Erwinia_phage(100.0%)	1	NA	NA
WP_000800132.1|4821047_4821305_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 356
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4828594	4832317	5007984		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|4828594_4829296_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251363.1|4829295_4830540_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291301.1|4830568_4831480_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952746.1|4831495_4832317_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 357
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4835592	4837570	5007984		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|4835592_4836450_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531578.1|4836433_4837570_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 358
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4842591	4887198	5007984	tRNA,lysis,portal,tail,terminase,transposase,capsid,head	Enterobacteria_phage(62.5%)	53	NA	NA
WP_000423737.1|4842591_4843962_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_001295971.1|4843965_4844607_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001298466.1|4844642_4845749_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4845802_4846264_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|4846273_4846927_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4847098_4848349_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_139371347.1|4849234_4850447_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_032150837.1|4850511_4850901_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.2	2.9e-70
WP_000153286.1|4850897_4851425_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|4851421_4851598_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|4851600_4851942_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099712.1|4852148_4852511_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|4852507_4852648_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|4852733_4853117_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|4853305_4854388_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|4854976_4855192_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|4855191_4855689_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|4855905_4856088_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|4856178_4856472_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|4856952_4857279_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|4857485_4857668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557984.1|4858230_4858779_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_024008913.1|4858750_4860679_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	1.9e-260
WP_000258997.1|4860662_4860869_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_079399632.1|4860865_4862458_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	9.3e-184
WP_001253914.1|4862447_4863953_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|4863989_4864337_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|4864394_4865423_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|4865474_4865849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|4865841_4866195_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|4866206_4866785_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|4866781_4867177_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_021532037.1|4867184_4867964_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	89.2	4.6e-120
WP_000479129.1|4867979_4868402_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459474.1|4868383_4868818_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_021522709.1|4868810_4871372_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.1	0.0e+00
WP_000847402.1|4871368_4871698_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152660.1|4871697_4872396_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|4872401_4873145_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|4873081_4873714_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_021532039.1|4873774_4877257_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.4	0.0e+00
WP_000290543.1|4877315_4879376_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|4879372_4879651_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000355360.1|4879663_4879957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021553117.1|4880048_4880906_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101723.1|4880902_4881760_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983716.1|4881756_4882584_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	29.0	1.9e-07
WP_000555626.1|4882583_4883498_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001304451.1|4884196_4884955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|4885426_4885579_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001445545.1|4885662_4885788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373104.1|4885841_4886246_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332310.1|4886466_4887198_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	9.3e-54
>prophage 359
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4901433	4903121	5007984		Morganella_phage(50.0%)	2	NA	NA
WP_000897380.1|4901433_4901853_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	2.6e-37
WP_000457594.1|4901852_4903121_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.0	5.3e-206
>prophage 360
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4919149	4919908	5007984		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173308.1|4919149_4919908_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-14
>prophage 361
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4932355	4935107	5007984		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033350.1|4932355_4934035_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
WP_001298109.1|4934159_4935107_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 362
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4938243	4944512	5007984		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000804726.1|4938243_4939326_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456474.1|4939325_4940159_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200375.1|4940155_4940548_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257054.1|4940551_4941361_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|4941396_4942251_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170954.1|4942398_4942506_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001313768.1|4942911_4944012_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|4944281_4944512_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 363
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4955643	4966854	5007984	transposase	Escherichia_phage(20.0%)	11	NA	NA
WP_000702647.1|4955643_4957182_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
WP_000571681.1|4957178_4957889_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4957888_4958566_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_001111620.1|4958618_4959818_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|4960492_4961335_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|4961384_4961843_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|4961955_4962861_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|4962952_4963966_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|4964167_4965076_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|4965219_4965633_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|4966236_4966854_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 364
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4976420	4978435	5007984		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110950.1|4976420_4977434_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|4977430_4978435_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
>prophage 365
NZ_CP051719	Escherichia coli strain SCU-116 chromosome, complete genome	5007984	4986367	5007133	5007984	holin,lysis,integrase	Escherichia_phage(26.09%)	32	4981012:4981025	4993938:4993951
4981012:4981025	attL	TTCCCGCTTTCTTT	NA	NA	NA	NA
WP_000113674.1|4986367_4987498_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_023150470.1|4987475_4987724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071686821.1|4987788_4990260_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|4990352_4990544_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4990540_4990729_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|4991129_4991294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|4991294_4991516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|4991675_4991831_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|4992123_4992462_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|4992853_4993096_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|4993079_4993505_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|4993576_4994647_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
4993938:4993951	attR	AAAGAAAGCGGGAA	NA	NA	NA	NA
WP_001151216.1|4994687_4995110_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_014639476.1|4995301_4996264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|4996279_4997281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|4997689_4997797_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000813256.1|4997898_4998054_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_023150468.1|4998221_4998500_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	4.8e-11
WP_021532042.1|4998501_4999548_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	5.0e-109
WP_000904114.1|4999560_4999935_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_169063363.1|4999931_5000753_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	1.7e-80
WP_000917749.1|5000977_5001175_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_001513760.1|5001325_5002375_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.8	1.4e-196
WP_001331709.1|5003649_5003877_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|5004145_5004361_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000731249.1|5004365_5004716_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	93.0	4.0e-55
WP_000992075.1|5004779_5005313_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
WP_000459345.1|5005472_5005610_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082534.1|5005611_5006106_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.7	1.1e-74
WP_000736383.1|5006102_5006327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304598.1|5006525_5006726_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829186.1|5006767_5007133_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	1.7e-61
