The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051725	Escherichia coli strain SCU-112 chromosome, complete genome	5094645	860318	910275	5094645	protease,integrase,tRNA,transposase	Stx2-converting_phage(33.33%)	44	853826:853842	920593:920609
853826:853842	attL	GGAATACGCACGTAATG	NA	NA	NA	NA
WP_000997995.1|860318_861857_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|862984_863335_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|863331_863757_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|864128_864266_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_001149834.1|864417_865335_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|865368_866244_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|866292_867765_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_169063325.1|867768_868599_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|868644_869355_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|869367_870477_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|870538_871462_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|871497_872232_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|872331_873318_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_103103189.1|873469_874697_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|875197_877288_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001296383.1|878149_878392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529396.1|878682_879051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|879054_879270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|884050_885202_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000147017.1|886922_887966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021537217.1|888221_889487_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	1.6e-77
WP_000234491.1|889865_890573_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839794.1|890971_893107_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001327414.1|893155_894412_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000760323.1|894613_895693_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091699.1|895757_896033_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001327411.1|896060_897113_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786915.1|897273_897993_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107565.1|897992_898319_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|898502_899222_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394106.1|899397_900444_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745192.1|900560_901568_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239981.1|901636_902773_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174738.1|902765_903359_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|903366_903657_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|903653_904220_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|904237_904942_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001327409.1|904959_905940_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017106.1|906113_906530_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|906529_907093_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593261.1|907201_908152_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222509.1|908164_908896_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_001327408.1|908975_909683_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|909777_910275_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
920593:920609	attR	GGAATACGCACGTAATG	NA	NA	NA	NA
>prophage 2
NZ_CP051725	Escherichia coli strain SCU-112 chromosome, complete genome	5094645	1149171	1156311	5094645		Escherichia_phage(83.33%)	6	NA	NA
WP_001279001.1|1149171_1149810_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_000590418.1|1149806_1151069_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847998.1|1151065_1151974_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_001298167.1|1152169_1152937_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_001141289.1|1152987_1153644_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_000103863.1|1153749_1156311_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 3
NZ_CP051725	Escherichia coli strain SCU-112 chromosome, complete genome	5094645	1487296	1500253	5094645	integrase	Escherichia_phage(83.33%)	6	1471056:1471070	1497013:1497027
1471056:1471070	attL	GGTAATGCGGGTGGT	NA	NA	NA	NA
WP_001224626.1|1487296_1487866_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
WP_001181152.1|1488613_1489243_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	1.6e-118
WP_000243056.1|1489560_1490181_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	5.9e-118
WP_001537816.1|1490205_1498155_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	99.3	0.0e+00
1497013:1497027	attR	GGTAATGCGGGTGGT	NA	NA	NA	NA
WP_000100043.1|1498202_1498733_+	OmpH family outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	99.4	5.1e-86
WP_000368121.1|1499320_1500253_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	4.6e-167
>prophage 4
NZ_CP051725	Escherichia coli strain SCU-112 chromosome, complete genome	5094645	1736860	1746305	5094645		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569381.1|1736860_1737787_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	2.6e-08
WP_000783150.1|1737791_1738523_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1738503_1738611_-	protein YohO	NA	NA	NA	NA	NA
WP_001240404.1|1738670_1739402_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001295431.1|1739623_1741309_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1741305_1742025_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1742071_1742542_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1742582_1743044_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001327380.1|1743168_1745172_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.1	0.0e+00
WP_001305166.1|1745168_1746305_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	3.8e-163
>prophage 5
NZ_CP051725	Escherichia coli strain SCU-112 chromosome, complete genome	5094645	2794431	2894111	5094645	head,tRNA,capsid,lysis,holin,portal,protease,terminase,tail	Enterobacteria_phage(48.25%)	137	NA	NA
WP_000654167.1|2794431_2794710_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000290543.1|2794706_2796767_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000515327.1|2796825_2800308_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000090917.1|2800368_2801001_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140699.1|2800937_2801681_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_001152660.1|2801686_2802385_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847405.1|2802384_2802714_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_000840269.1|2802710_2805272_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000459474.1|2805264_2805699_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000479129.1|2805680_2806103_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_001351266.1|2806118_2806859_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_001620328.1|2806866_2807262_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	96.9	6.1e-68
WP_000975062.1|2807258_2807837_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_001204540.1|2807848_2808202_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|2808194_2808569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522648.1|2808620_2809649_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000256840.1|2809706_2810054_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_169063339.1|2810090_2811596_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	7.9e-100
WP_000831761.1|2811585_2813178_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000258993.1|2813174_2813381_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_021561948.1|2813364_2815293_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.0	7.9e-262
WP_000867568.1|2815264_2815813_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000881610.1|2816375_2816558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2816764_2817091_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2817571_2817865_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2817955_2818138_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|2818354_2818852_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|2818851_2819067_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737269.1|2819655_2820738_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	1.3e-165
WP_001204776.1|2820926_2821310_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971053.1|2821395_2821536_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001099712.1|2821532_2821895_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000386643.1|2822101_2822443_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254243.1|2822445_2822622_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000153286.1|2822618_2823146_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|2823142_2823583_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145927.1|2823656_2823947_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000788872.1|2823943_2824645_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000185431.1|2824641_2825541_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000442609.1|2825573_2825870_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|2826011_2826227_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2826302_2826998_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|2827037_2827595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|2827591_2828344_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|2828620_2828803_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088199.1|2828780_2829053_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066176.1|2829069_2829651_-	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	5.2e-92
WP_000213979.1|2829864_2830065_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|2830247_2830616_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|2830688_2830853_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|2830821_2830965_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995434.1|2831040_2831337_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000100847.1|2831342_2832128_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186790.1|2832124_2832805_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	5.1e-131
WP_000149544.1|2832801_2832984_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|2832956_2833148_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001360114.1|2833158_2833440_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763378.1|2833538_2833760_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289890.1|2833756_2834521_+	ead/Ea22-like family protein	NA	K7PKG8	Enterobacteria_phage	94.8	3.6e-56
WP_001518554.1|2834522_2834777_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	91.1	1.7e-34
WP_001327280.1|2834794_2835328_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	82.1	2.5e-64
WP_000951713.1|2835329_2835539_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208010.1|2835535_2836276_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.1	6.5e-47
WP_001304460.1|2836268_2836553_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	89.4	4.0e-45
WP_000490215.1|2836578_2836818_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	8.8e-38
WP_000088653.1|2836957_2837194_+	excisionase	NA	NA	NA	NA	NA
WP_000444487.1|2838438_2839689_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248695.1|2839860_2840514_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2840523_2840985_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001443105.1|2841038_2842145_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001295971.1|2842180_2842822_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2842825_2844196_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|2844365_2845037_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000734671.1|2845036_2846497_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|2846572_2847694_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|2847742_2848969_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2849218_2850355_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799413.1|2850338_2851202_+	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_000937496.1|2851433_2851700_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000742376.1|2851768_2852425_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071586406.1|2852479_2852578_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000355700.1|2852617_2852911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204582.1|2852920_2853199_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_000216560.1|2853195_2855259_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	3.7e-148
WP_001228261.1|2855410_2856010_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_000514735.1|2856077_2859770_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_072258937.1|2860113_2860746_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	92.3	1.7e-96
WP_001576728.1|2860691_2861435_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	8.3e-143
WP_001327694.1|2861440_2862139_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_000847298.1|2862138_2862468_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082402.1|2862464_2865026_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.0	0.0e+00
WP_000533402.1|2865006_2865420_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|2865446_2865878_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235037.1|2865896_2866643_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_000683079.1|2866650_2867046_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974995.1|2867042_2867576_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.1	1.2e-55
WP_001204571.1|2867591_2867945_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000201498.1|2867937_2868321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522583.1|2868372_2869401_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	8.6e-114
WP_000256835.1|2869458_2869806_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_001253953.1|2869842_2871348_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	2.7e-100
WP_001537684.1|2871337_2872930_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.9e-185
WP_000258997.1|2872926_2873133_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_169063340.1|2873116_2875045_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.0e-261
WP_000235436.1|2875016_2875526_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000105081.1|2875920_2876154_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	4.3e-21
WP_001537735.1|2876211_2876622_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_001059340.1|2876924_2877449_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.6	2.9e-86
WP_001139682.1|2877651_2877804_-	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001327248.1|2877791_2878259_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	89.7	5.0e-69
WP_000992105.1|2878255_2878789_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_000370546.1|2878894_2879167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193296.1|2879132_2879477_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	92.9	7.0e-36
WP_000372595.1|2879481_2879697_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001327246.1|2879846_2880008_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	2.0e-14
WP_000874243.1|2880004_2880193_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_000871291.1|2880453_2880789_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|2881069_2881201_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000762890.1|2882093_2882915_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_000904092.1|2882929_2883286_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	1.8e-34
WP_001265034.1|2883298_2884348_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.9e-109
WP_001429486.1|2884349_2884628_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_000813254.1|2885086_2885242_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000753059.1|2886163_2886340_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	9.7e-26
WP_001224662.1|2886332_2886515_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2886608_2886965_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151225.1|2887022_2887445_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.3e-64
WP_001262379.1|2887485_2888550_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	7.9e-62
WP_000693837.1|2888621_2889047_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|2889030_2889312_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|2889412_2889832_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379575.1|2890097_2890253_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171946.1|2890412_2890631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2890595_2890799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854564.1|2891199_2891388_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2891384_2891576_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2891669_2894111_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
>prophage 6
NZ_CP051725	Escherichia coli strain SCU-112 chromosome, complete genome	5094645	3850808	3929000	5094645	head,capsid,protease,terminase,integrase,transposase	Enterobacteria_phage(33.33%)	57	3853563:3853579	3915778:3915794
WP_001045652.1|3850808_3854924_+|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
3853563:3853579	attL	GCATTCAATGGTGCCAT	NA	NA	NA	NA
WP_001270785.1|3855170_3855443_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001291700.1|3857195_3857438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001672744.1|3857708_3857924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001336653.1|3857936_3858314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602703.1|3858389_3858848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169063347.1|3858834_3868482_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.5	9.4e-29
WP_001313589.1|3870488_3871112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416159.1|3871866_3872898_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	2.3e-18
WP_000916811.1|3873168_3873612_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705927.1|3873627_3873915_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345349.1|3873927_3875184_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|3875430_3875685_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000107474.1|3876106_3877120_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998353.1|3877131_3878448_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|3878475_3879396_-	ribokinase	NA	NA	NA	NA	NA
WP_001305338.1|3879701_3880484_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001305346.1|3892227_3892425_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001327840.1|3892492_3892708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287897.1|3892812_3893379_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001013326.1|3893850_3894276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270955.1|3894272_3894656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860849.1|3895027_3895627_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_072146520.1|3895858_3896008_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001367564.1|3897073_3897865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001305352.1|3898248_3898455_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804441.1|3898548_3899151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163787.1|3901683_3901941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016205.1|3901994_3902762_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.7e-13
WP_000217077.1|3902758_3903817_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000778018.1|3903835_3904825_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000856947.1|3904835_3907001_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001305362.1|3907483_3908293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019301.1|3908410_3909148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001305361.1|3909375_3909978_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	33.3	1.8e-07
WP_001313577.1|3910376_3911477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001069809.1|3911698_3912133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113472676.1|3912350_3914747_+	dynamin family protein	NA	NA	NA	NA	NA
WP_000203550.1|3914743_3915649_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102646.1|3915645_3916716_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
3915778:3915794	attR	GCATTCAATGGTGCCAT	NA	NA	NA	NA
WP_000238685.1|3916805_3917312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000680181.1|3917367_3917997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682723.1|3918431_3918884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001213776.1|3919001_3919235_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_021566768.1|3919334_3920156_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	8.0e-46
WP_001164966.1|3920155_3920401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000855076.1|3920494_3920968_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	7.4e-12
WP_001313574.1|3920983_3921460_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692315.1|3921522_3921744_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_000086759.1|3921762_3922407_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.7	2.7e-25
WP_001285482.1|3922456_3922831_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854730.1|3922877_3923255_+	toxin	NA	NA	NA	NA	NA
WP_000133418.1|3926070_3926352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835284.1|3926425_3926968_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.1	2.9e-36
WP_000224592.1|3927171_3927585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380882.1|3927597_3927933_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000268554.1|3927944_3929000_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	4.6e-70
>prophage 7
NZ_CP051725	Escherichia coli strain SCU-112 chromosome, complete genome	5094645	4282296	4340537	5094645	protease,integrase,transposase	Erysipelothrix_phage(27.27%)	46	4319809:4319824	4348834:4348849
WP_103103189.1|4282296_4283524_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001304537.1|4283865_4284972_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_000991426.1|4285036_4286017_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	56.0	2.1e-101
WP_001327357.1|4286024_4286147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077634196.1|4286242_4286665_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000988223.1|4286775_4287105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000950586.1|4287398_4288436_+|transposase	IS630-like element ISEc40 family transposase	transposase	NA	NA	NA	NA
WP_000594386.1|4289427_4289679_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000099232.1|4289847_4290753_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000419018.1|4290752_4294031_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.3	2.2e-232
WP_000081952.1|4294027_4294729_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_011076785.1|4295012_4295171_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000413174.1|4295315_4297328_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.5	1.3e-89
WP_000768220.1|4297341_4300413_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	32.9	2.9e-133
WP_001327207.1|4300655_4301729_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.9	7.7e-73
WP_001555250.1|4302192_4302345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839235.1|4302429_4302627_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000976831.1|4302638_4303130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094249044.1|4303126_4303501_-	toxin	NA	NA	NA	NA	NA
WP_024186744.1|4303590_4303953_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692312.1|4304031_4304253_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186708.1|4304321_4304798_-	RadC family protein	NA	NA	NA	NA	NA
WP_000206667.1|4304813_4305299_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.4e-13
WP_001234592.1|4305390_4306209_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.6	2.3e-45
WP_000102675.1|4306548_4307619_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203561.1|4307615_4308521_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000544631.1|4308517_4310902_-	dynamin family protein	NA	NA	NA	NA	NA
WP_169063351.1|4311012_4313859_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069690.1|4314230_4315103_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000241620.1|4315201_4316074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555244.1|4317113_4318328_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	92.6	6.7e-158
WP_063512650.1|4318617_4319226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071594612.1|4319313_4319592_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
4319809:4319824	attL	AATCAGCCTGTGGCTG	NA	NA	NA	NA
WP_000453333.1|4320324_4320537_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000221488.1|4321253_4321823_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271006.1|4322082_4322466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013768.1|4322462_4322888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001193078.1|4323151_4325236_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_001180884.1|4325246_4327844_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_001555243.1|4328020_4331635_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_001019636.1|4331680_4335322_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_000566901.1|4335333_4335936_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_077907039.1|4335932_4336535_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_024193407.1|4338053_4338608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001555240.1|4338761_4339052_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001218943.1|4339271_4340537_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	1.7e-79
4348834:4348849	attR	CAGCCACAGGCTGATT	NA	NA	NA	NA
>prophage 1
NZ_CP051726	Escherichia coli strain SCU-112 plasmid pSCU-112-1, complete sequence	103780	0	66478	103780	protease,transposase,integrase	Escherichia_phage(37.5%)	52	42728:42787	64088:64908
WP_001066947.1|1220_1961_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001332784.1|2081_2270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|2636_3806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|4652_4925_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001189111.1|6538_8047_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000143800.1|9155_10655_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_000065240.1|10651_11407_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_001020413.1|12728_13904_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100763.1|13972_16234_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981091.1|16402_17179_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001537591.1|17186_18062_-	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_001336934.1|20649_20868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000142452.1|20996_21344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|21363_21873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371883.1|21869_22130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|23643_25152_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001336919.1|25717_26287_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.2	6.4e-26
WP_000874189.1|28271_28757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|28781_29267_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|29253_29949_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729218.1|29953_31084_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|31073_32357_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|32359_33739_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|33842_34370_-	iron transporter	NA	NA	NA	NA	NA
WP_001332815.1|34410_36297_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|36643_37459_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_001067855.1|37791_38496_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001620095.1|39224_40085_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_001620096.1|40382_40643_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620097.1|40729_41818_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
42728:42787	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|42790_43495_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|44258_45272_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|45474_45825_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001262765.1|47418_48729_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001398199.1|49013_49415_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|49347_49605_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|49697_50351_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001333237.1|50448_50589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001537577.1|51289_52147_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|52139_52214_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000084404.1|52447_52705_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001336447.1|52989_53139_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000872609.1|53337_53775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109264.1|53927_54311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000760080.1|54413_54875_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	35.1	1.0e-18
WP_001336517.1|55627_55831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139329.1|55982_56540_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205709.1|56594_57341_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	2.4e-09
WP_001545323.1|57360_62631_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_169063359.1|62630_64160_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|64150_64855_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001229309.1|66055_66478_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	86.8	9.4e-67
64088:64908	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCA	NA	NA	NA	NA
>prophage 2
NZ_CP051726	Escherichia coli strain SCU-112 plasmid pSCU-112-1, complete sequence	103780	74619	74841	103780		Vibrio_virus(100.0%)	1	NA	NA
WP_001278695.1|74619_74841_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
>prophage 3
NZ_CP051726	Escherichia coli strain SCU-112 plasmid pSCU-112-1, complete sequence	103780	82795	90808	103780		Yersinia_phage(25.0%)	12	NA	NA
WP_001234445.1|82795_83617_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_001272251.1|83726_84023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012881134.1|84085_84322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|84919_85078_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001309233.1|85157_85337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276217.1|85357_86077_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845953.1|86073_86508_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001537566.1|86576_88541_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.5	3.2e-24
WP_000006003.1|88601_88835_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290834.1|88892_89420_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_024185955.1|89721_90159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309257.1|90244_90808_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	42.9	2.0e-19
>prophage 4
NZ_CP051726	Escherichia coli strain SCU-112 plasmid pSCU-112-1, complete sequence	103780	96446	102724	103780		Enterobacteria_phage(50.0%)	8	NA	NA
WP_000086171.1|96446_97130_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	38.3	7.9e-31
WP_001309256.1|97205_97517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001336695.1|97580_97940_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000270807.1|97946_98090_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000756328.1|99266_100229_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.2	2.3e-113
WP_000817635.1|100225_101431_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.6e-204
WP_001132895.1|102188_102440_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001270422.1|102436_102724_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	1.3e-19
