The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051727	Escherichia coli strain SCU-111 chromosome, complete genome	4806281	1065577	1072717	4806281		Escherichia_phage(83.33%)	6	NA	NA
WP_001279002.1|1065577_1066216_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	3.7e-83
WP_000590411.1|1066212_1067475_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847997.1|1067471_1068380_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001298167.1|1068575_1069343_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_001765077.1|1069393_1070050_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_000103861.1|1070155_1072717_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	6.0e-31
>prophage 2
NZ_CP051727	Escherichia coli strain SCU-111 chromosome, complete genome	4806281	1154184	1247347	4806281	terminase,tail,holin,integrase,protease,portal,tRNA	Escherichia_phage(30.77%)	98	1150503:1150519	1236196:1236212
1150503:1150519	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_000264777.1|1154184_1154952_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1154993_1155341_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589792.1|1155417_1155900_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969007.1|1155915_1157142_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212400.1|1157131_1157650_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001296308.1|1157798_1158164_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|1158374_1159445_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225219.1|1159455_1160577_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200125.1|1160619_1161780_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1161878_1161926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097749545.1|1162091_1163081_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	55.9	9.5e-102
WP_097749566.1|1163171_1163480_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	55.1	4.8e-20
WP_097749546.1|1163596_1164055_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_169061993.1|1164223_1164409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169061994.1|1165564_1165720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169061995.1|1165731_1166307_+	3'-5' exoribonuclease	NA	NA	NA	NA	NA
WP_097749551.1|1166308_1166527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169061996.1|1166529_1168566_+	exonuclease	NA	V5UQJ3	Shigella_phage	33.0	1.9e-51
WP_097749553.1|1168558_1168780_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169061997.1|1168763_1169552_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	43.7	2.3e-42
WP_169061998.1|1169538_1170309_+	ead/Ea22-like family protein	NA	A0A2R2Z307	Escherichia_phage	98.3	2.5e-57
WP_169061999.1|1170407_1170815_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	58.3	5.2e-22
WP_157794728.1|1170999_1171332_+	hypothetical protein	NA	V5URG6	Shigella_phage	98.2	3.8e-63
WP_169061986.1|1171328_1171919_+	hypothetical protein	NA	A0A2I6PID2	Escherichia_phage	65.9	1.7e-18
WP_169062000.1|1172003_1172258_+	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	48.1	6.5e-15
WP_157924814.1|1172440_1173064_+	ash family protein	NA	NA	NA	NA	NA
WP_097749560.1|1173060_1174983_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	37.2	4.8e-110
WP_097749561.1|1175134_1175380_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	38.2	2.1e-10
WP_169062001.1|1175390_1176470_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	38.8	5.7e-60
WP_169062002.1|1176471_1177149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097749564.1|1177371_1177569_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.4	2.6e-27
WP_169062003.1|1177720_1178779_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	91.5	1.0e-194
WP_169062004.1|1179536_1181534_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	53.6	5.3e-184
WP_097749598.1|1181676_1181862_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	58.3	1.2e-10
WP_169062005.1|1181884_1182220_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_087906417.1|1182297_1182513_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	97.2	1.7e-32
WP_169062006.1|1182516_1183158_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	76.6	1.0e-64
WP_169062007.1|1183200_1183734_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	6.9e-99
WP_169062008.1|1184493_1184682_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	81.4	4.7e-18
WP_169062009.1|1184917_1185466_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	90.3	6.4e-84
WP_169062010.1|1186059_1186536_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	1.2e-83
WP_169062011.1|1186532_1188656_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	96.6	0.0e+00
WP_122998037.1|1188652_1188865_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	82.9	7.6e-25
WP_169062012.1|1188864_1190367_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	92.8	5.0e-272
WP_169062061.1|1190356_1192327_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	93.5	0.0e+00
WP_106906715.1|1192414_1192741_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	88.8	2.5e-43
WP_169062013.1|1192733_1193015_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	81.7	7.4e-36
WP_169062014.1|1193017_1193641_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	91.8	4.1e-95
WP_169062015.1|1193652_1194051_+|tail	phage tail protein	tail	S5MW30	Escherichia_phage	89.4	1.8e-64
WP_169062016.1|1194058_1194817_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	77.4	7.7e-104
WP_107180292.1|1194834_1195251_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	51.9	7.9e-26
WP_169062017.1|1195277_1195670_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	79.8	1.1e-40
WP_169062018.1|1195659_1198245_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.1	0.0e+00
WP_169062019.1|1198241_1198571_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	89.0	1.9e-51
WP_169062020.1|1198570_1199269_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	91.8	7.6e-122
WP_169062021.1|1199274_1200018_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	91.5	2.3e-140
WP_169062062.1|1199963_1200560_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	73.3	5.0e-82
WP_169062022.1|1204202_1205351_+|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	68.8	8.9e-35
WP_169062063.1|1205433_1205967_+	DUF4376 domain-containing protein	NA	A0A2L1IV45	Escherichia_phage	45.9	4.1e-35
WP_097749596.1|1206212_1206401_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_169062023.1|1206626_1206764_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	86.7	4.6e-15
WP_097749595.1|1206908_1207205_+	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	71.9	2.1e-17
WP_000178456.1|1207451_1207793_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1208062_1208800_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079111.1|1208934_1209915_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040137.1|1209911_1210643_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001314061.1|1210772_1213346_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	2.0e-127
WP_001764824.1|1219124_1220423_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.2	2.2e-45
WP_001370843.1|1220419_1220743_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1220788_1222144_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001764823.1|1222257_1224918_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001298618.1|1224949_1225648_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1225716_1226136_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997384.1|1226342_1227380_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|1227427_1228117_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|1228421_1228805_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001764822.1|1228858_1229455_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001764821.1|1229557_1230439_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001764820.1|1230471_1231806_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000083664.1|1231937_1232675_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_001764818.1|1232659_1234282_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|1234537_1234693_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|1234689_1235265_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_135149983.1|1235297_1235948_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812041.1|1235947_1236904_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
1236196:1236212	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_000589057.1|1236900_1237380_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790169.1|1237576_1239376_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|1239391_1240366_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1240637_1241318_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000020737.1|1241314_1242220_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399393.1|1242231_1242960_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001296302.1|1242971_1243703_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986038.1|1243702_1244083_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128777.1|1244503_1244584_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_001196297.1|1244777_1245038_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
WP_001296301.1|1245093_1245942_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190644.1|1246150_1246786_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001298403.1|1246810_1247347_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP051727	Escherichia coli strain SCU-111 chromosome, complete genome	4806281	1699659	1709104	4806281		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569385.1|1699659_1700586_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_000783125.1|1700590_1701322_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1701302_1701410_-	protein YohO	NA	NA	NA	NA	NA
WP_001240405.1|1701469_1702201_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001295431.1|1702422_1704108_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1704104_1704824_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1704870_1705341_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001764723.1|1705381_1705843_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.2e-75
WP_001764722.1|1705967_1707971_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	94.9	0.0e+00
WP_001292782.1|1707967_1709104_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	5.9e-164
>prophage 4
NZ_CP051727	Escherichia coli strain SCU-111 chromosome, complete genome	4806281	1974359	2010175	4806281	terminase,tail,holin,plate,integrase,portal,capsid,head	Enterobacteria_phage(85.37%)	49	1992175:1992189	2016768:2016782
WP_000078920.1|1974359_1974500_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|1974689_1974950_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132802.1|1974992_1976102_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	2.2e-195
WP_135150025.1|1976259_1977444_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.2	3.2e-221
WP_135150024.1|1977443_1977956_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	1.2e-92
WP_000665314.1|1978010_1978376_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333494.1|1978384_1978540_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_022296532.1|1978526_1981334_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.2	0.0e+00
WP_001704945.1|1981346_1981835_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	4.0e-85
WP_000905060.1|1981870_1982458_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	100.0	2.4e-105
WP_135150080.1|1983476_1984010_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	87.0	6.3e-84
WP_085435520.1|1984038_1984566_-|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	99.4	1.3e-94
WP_169062031.1|1984569_1986840_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	63.3	1.8e-209
WP_000071721.1|1986842_1987373_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	100.0	1.3e-94
WP_001111955.1|1987365_1988262_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
WP_024182996.1|1988265_1988616_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	1.6e-59
WP_135150032.1|1988612_1989194_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	3.6e-101
WP_135150033.1|1989190_1989826_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_000920594.1|1989818_1990286_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780567.1|1990423_1990831_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.8	1.0e-65
WP_000072327.1|1990827_1991220_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1991216_1991540_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|1991542_1991743_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063094.1|1991742_1992237_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
1992175:1992189	attL	ATCATCGGTATCGGT	NA	NA	NA	NA
WP_000632347.1|1992338_1993139_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_001055119.1|1993184_1994237_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
WP_001262686.1|1994260_1995097_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.9e-119
WP_032083489.1|1995251_1997003_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_135150034.1|1997002_1998049_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	4.4e-206
WP_000723541.1|1998579_1999959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763711.1|1999975_2000314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000484450.1|2000297_2001107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135150035.1|2001152_2003900_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.8	0.0e+00
WP_000599382.1|2003906_2004272_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_167739822.1|2004268_2004886_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2004897_2005197_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_135150036.1|2005193_2005460_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.0	3.7e-29
WP_000985157.1|2005456_2005660_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_135150037.1|2005683_2006100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2006192_2006306_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514274.1|2006302_2006545_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000159462.1|2006556_2006835_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_113287026.1|2006845_2007196_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	3.3e-49
WP_000014504.1|2007217_2007421_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2007492_2007630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|2007720_2008125_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290349.1|2008140_2008791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2008820_2009168_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2009173_2010175_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2016768:2016782	attR	ATCATCGGTATCGGT	NA	NA	NA	NA
>prophage 5
NZ_CP051727	Escherichia coli strain SCU-111 chromosome, complete genome	4806281	2710451	2757210	4806281	terminase,tail,lysis,holin,integrase,portal,capsid,tRNA,head	Enterobacteria_phage(55.77%)	59	2703260:2703275	2764561:2764576
2703260:2703275	attL	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
WP_016232978.1|2710451_2711033_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_071996362.1|2711032_2713984_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	58.3	9.5e-65
WP_001230412.1|2714048_2714648_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	100.0	1.0e-111
WP_032286738.1|2714715_2718114_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.8	0.0e+00
WP_071830222.1|2718174_2718807_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.1	5.1e-93
WP_032286736.1|2718743_2719487_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_016230622.1|2719491_2720190_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
WP_000847355.1|2720189_2720519_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_032286734.1|2720515_2723077_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.9	0.0e+00
WP_000459457.1|2723069_2723504_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479139.1|2723485_2723908_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_021514938.1|2723923_2724664_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	4.7e-130
WP_000683145.1|2724671_2725067_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_000975070.1|2725063_2725642_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000753007.1|2725653_2726007_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_021540908.1|2726018_2726417_-	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063294.1|2726458_2727484_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.1e-192
WP_001295978.1|2727538_2727871_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|2727880_2729200_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|2729180_2730782_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|2730778_2730985_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027295.1|2730981_2732907_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453576.1|2732881_2733427_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_000881610.1|2733990_2734173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2734379_2734706_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2735186_2735480_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2735570_2735753_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|2735969_2736446_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|2736432_2736738_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_032286730.1|2737059_2737749_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	2.2e-57
WP_032286728.1|2737745_2737886_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	5.9e-10
WP_032286726.1|2737882_2738245_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.9	4.7e-59
WP_032286725.1|2738241_2738532_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	5.7e-47
WP_021550626.1|2738524_2738695_-	protein ninE	NA	G8C7V4	Escherichia_phage	65.5	8.2e-14
WP_032286723.1|2738694_2739150_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	2.7e-59
WP_072129709.1|2739146_2739248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032286722.1|2739576_2741079_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	53.7	3.8e-62
WP_032286720.1|2741438_2742986_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.6	9.8e-21
WP_032286718.1|2743635_2744337_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.3	2.4e-128
WP_032150144.1|2744333_2745263_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	65.0	5.6e-112
WP_032286716.1|2745349_2745886_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	1.3e-60
WP_000184665.1|2745916_2746144_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712399.1|2746254_2746947_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_032286713.1|2747237_2747750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032286711.1|2748231_2748438_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	86.8	8.4e-29
WP_000995433.1|2748513_2748810_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|2748815_2749601_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|2749597_2750278_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682294.1|2750274_2750436_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|2750428_2750986_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_077698966.1|2750996_2751278_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763390.1|2751376_2751595_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_032286706.1|2751642_2751882_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	1.1e-37
WP_000088653.1|2752021_2752258_+	excisionase	NA	NA	NA	NA	NA
WP_032334663.1|2752247_2753390_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	99.7	8.1e-206
WP_000444487.1|2753503_2754754_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248695.1|2754925_2755579_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2755588_2756050_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|2756103_2757210_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2764561:2764576	attR	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
>prophage 1
NZ_CP051728	Escherichia coli strain SCU-111 plasmid pSCU-111-1, complete sequence	189717	10856	64443	189717	transposase,integrase	Escherichia_phage(22.22%)	45	42266:42325	63334:65288
WP_169062139.1|10856_11657_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.9e-54
WP_096037716.1|12386_12938_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169062073.1|13012_13813_-	OmpA family protein	NA	NA	NA	NA	NA
WP_169062074.1|13846_15745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169062075.1|20737_21793_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	45.3	1.4e-82
WP_106907055.1|21835_22606_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_169062076.1|22748_23642_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106907051.1|23677_26812_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.0	1.8e-53
WP_169062140.1|26818_27988_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_169062077.1|28016_28358_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106907159.1|28426_28681_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	59.6	1.3e-07
WP_169062078.1|28950_30000_-	NAD(P)-dependent alcohol dehydrogenase	NA	K7Z7U2	Megavirus	42.9	1.2e-78
WP_106907155.1|31557_32142_-	flavodoxin	NA	NA	NA	NA	NA
WP_047626660.1|32151_32913_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_114502118.1|32890_33370_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_106907176.1|33526_34720_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_106907153.1|34965_35253_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_169062079.1|35543_36740_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_169062080.1|37927_38755_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_169062081.1|38821_39970_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_169062141.1|40124_41060_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106907061.1|41385_42162_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	5.8e-14
42266:42325	attL	TTGTCACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAATCAGATCCAGGGGGTA	NA	NA	NA	NA
WP_000255956.1|42352_43375_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_169062029.1|43374_44154_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_169062082.1|44197_44446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106907065.1|44457_45519_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	41.5	6.4e-72
WP_106907067.1|45667_46627_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000813639.1|47283_47502_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|47503_47809_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_077781165.1|47809_48616_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	98.2	1.6e-54
WP_169062083.1|49173_49929_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.4	4.2e-134
WP_000312330.1|50776_51409_+	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	8.1e-30
WP_042021187.1|51408_51783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000526115.1|51960_52419_+|transposase	IS200/IS605 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	2.5e-12
WP_097469860.1|52734_53709_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	44.8	1.2e-72
WP_000272016.1|53712_54105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|56474_56705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096924479.1|56756_58118_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001346267.1|58166_58730_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	8.0e-21
WP_143357838.1|59103_59298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169062084.1|59525_60047_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	2.7e-47
WP_000005990.1|60109_60343_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_169062085.1|60406_62365_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
WP_000845926.1|62419_62854_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000255956.1|63420_64443_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
63334:65288	attR	TTGTCACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAATCAGATCCAGGGGGTAATCTGCTCTCCTGATTCAGGAGAGCTTATGGTCACTTTTGAGACAGTTATGGAAATTAAAATCCTGCACAAGCAGGGAATGAGTAGCCGGGCGATTGCCAGAGAACTGGGGATCTCCCGCAATACCGTTAAACGTTATTTGCAGGCAAAATCTGAGCCGCCAAAATATACGCCGCGACCTGCTGTTGCTTCACTCCTGGATGAATACCGGGATTATATTCGTCAACGCATCGCCGATGCTCATCCTTACAAAATCCCGGCAACGGTAATCGCTCGCGAGATCAGAGACCAGGGATATCGTGGCGGAATGACCATTCTCAGGGGATTCATTCGTTCTCTCTCGGTTCCTCAGGAGCAGGAGCCTGCCGTTCGGTTCGAAACTGAACCCGGACGACAGATGCAGGTTGACTGGGGCACTATGCGTAATGGCCGCTCACCGCTTCACGTGTTCGTTGCTGTTCTCGGATACAGCCGAATGTTGTACATCGAATTCACTGACAATATGCGTTATGACACGCTGGAAACCTGCCATCGTAATGCGTTCCGCTTCTTTGGTGGTGTGCCGCGCGAAGTGTTGTATGACAATATGAAAACTGTGGTTCTGCAACGTGACGCATATCAGACCGGTCAGCACCGGTTCCATCCTTCGCTGTGGCAGTTCGGCAAGGAGATGGGCTTCTCTCCCCGACTGTGTCGCCCCTTCAGGGCACAGACTAAAGGTAAGGTGGAACGGATGGTGCAGTACACCCGTAACAGTTTTTACATCCCACTAATGACTCGCCTGCGCCCGATGGGGATCACTGTCGATGTTGAAACAGCCAACCGCCACGGTCTGCGCTGGCTGCACGATGTCGCTAACCAACGAAAGCATGAAACAATCCAGGCCCGTCCCTGCGATCGCTGGCTCGAAGAGCAGCAGTCCATGCTGGCACTGCCTCCGGAGAAAAAAGAGTATGACGTGCATCCTGGTGAAAATCTGGTGAACTTCGACAAACACCCCCTGCATCATCCACTCTCCATCTACGACTCATTCTGCAGAGGAGTGGCGTGATGATGGAACTGCAACATCAACGACTGATGGCGCTCGCCGGGCAGTTGCAACTGGAAAGCCTTATAAGCGCAGCGCCTGCGCTGTCACAACAGGCAGTAGACCAGGAATGGAGTTATATGGACTTCCTGGAGCATCTGCTTCATGAAGAAAAACTGGCACGTCATCAACGTAAACAGGCGATGTATACCCGAATGGCAGCCTTCCCGGCGGTGAAAACGTTCGAAGAGTATGACTTCACATTCGCCACCGGAGCACCGCAGAAGCAACTCCAGTCGTTACGCTCACTCAGCTTCATAGAACGTAATGAAAATATCGTATTACTGGGGCCATCAGGTGTGGGGAAAACCCATCTGGCAATAGCGATGGGCTATGAAGCCGTCCGTGCAGGTATCAAAGTTCGCTTCACAACAGCAGCAGAGCTGTTACTTCAGTTATCTACGGCACAACGTCAGGGCCGTTATAAAACGACGCTTCAGCGTGGAGTAATGGCCCCCCGCCTGCTCATCATTGATGAAATAGGCTATCTGCCGTTCAGTCAGGAAGAAGCAAAACTGTTCTTCCAGGTCATTGCTAAACGTTACGAAAAGAGCGCAATGATCCTGACATCCAATCTGCCGTTCGGGCAGTGGGATCAAACGTTCGCCGGTGATGCAGCACTGACCTCAGCGATGCTGGACCGTATCTTACACCACTCACATGTCGTTCAAATCAAAGGAGAAAGCTATCGACTCAGACAGAAACGAAAAGCCGGGGTTATAGCAGAAGCTAATCCTGAGTAAAACGGTGGATCAATATTGGGCCGTTGGTGGAGATATAAGTGGATCACTTTTCATCCGTCGTTGACA	NA	NA	NA	NA
>prophage 1
NZ_CP051729	Escherichia coli strain SCU-111 plasmid pSCU-111-2, complete sequence	66467	6662	56300	66467	transposase,integrase,tRNA,bacteriocin	Escherichia_phage(27.27%)	46	NA	NA
WP_169062166.1|6662_6995_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.5	2.3e-36
WP_169062151.1|7022_7154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169062152.1|10543_18355_+	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_169062153.1|19041_19569_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	63.2	5.1e-62
WP_038989268.1|20173_21250_-|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
WP_169062154.1|22541_23105_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_169062155.1|23108_23840_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	2.6e-11
WP_169062156.1|23836_24562_-	microcin B17 immunity protein McbE	NA	NA	NA	NA	NA
WP_169062157.1|24571_25762_-	microcin B17 processing protein McbC	NA	NA	NA	NA	NA
WP_169062158.1|25742_26561_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_169062159.1|26562_27450_-	McbB family protein	NA	NA	NA	NA	NA
WP_000420495.1|27476_27677_-	microcin B17	NA	NA	NA	NA	NA
WP_000079931.1|28422_28692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169062160.1|28688_28970_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000142451.1|29054_29402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042077527.1|29421_30012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169062161.1|30011_30269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000670961.1|30597_31050_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001017348.1|31082_32615_-	FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	5.2e-06
WP_000379710.1|32611_32881_-	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_016230896.1|32882_33899_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_016230897.1|33898_34729_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_024188128.1|34712_35951_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	27.8	4.8e-26
WP_001554354.1|36769_37183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164199.1|37184_37967_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000864812.1|38139_38493_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000449473.1|38542_39358_-|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000203268.1|39600_40128_+	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001282376.1|40145_41681_-|bacteriocin	pore-forming bacteriocin colicin B	bacteriocin	NA	NA	NA	NA
WP_001027529.1|42121_42634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361384.1|42784_43135_-	protein stbB	NA	NA	NA	NA	NA
WP_000959880.1|43137_44100_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	7.1e-94
WP_032146011.1|44246_44540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085940.1|44616_45300_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_001104873.1|45300_45522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274486.1|45535_45970_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|47320_47623_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271682.1|47669_48092_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|48088_48280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|49318_49549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169062162.1|49600_50962_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_096037668.1|51008_51572_+	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	39.3	2.3e-20
WP_169062029.1|51715_52495_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_000255956.1|52494_53517_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_169062163.1|53640_55893_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_097336710.1|55901_56300_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
