The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	0	43202	5050588	capsid,head,protease,tail,terminase	Stx2-converting_phage(41.67%)	40	NA	NA
WP_001304597.1|0_1662_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.6	0.0e+00
WP_000173054.1|1726_3664_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	97.8	0.0e+00
WP_001063027.1|3708_3930_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125984.1|6456_6783_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007909.1|6794_7145_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	4.6e-59
WP_000573362.1|7141_7588_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|7584_7929_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275433.1|7994_8708_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	2.3e-126
WP_000710952.1|8725_9100_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001538679.1|9195_9405_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	2.0e-33
WP_000212987.1|9452_12695_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.0	0.0e+00
WP_000807940.1|12687_13029_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001351100.1|13028_13727_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	8.9e-131
WP_001351101.1|13732_14476_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_122996802.1|14421_15054_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_001773905.1|15397_19090_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_016238842.1|19157_19757_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	1.0e-106
WP_071686802.1|19908_21972_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	3.1e-147
WP_001204581.1|21968_22247_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_000355614.1|22256_22553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304590.1|22670_23003_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001304589.1|23188_23641_+	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_001079492.1|24272_24779_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|24824_25325_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|25410_25590_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|25970_26777_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|26776_27970_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|27981_29340_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|29343_30939_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|30938_32501_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|32592_32637_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|32774_33656_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|33652_34273_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|34300_36196_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|36408_37284_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|37323_37914_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|37910_38669_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|38888_39938_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|39973_40225_-	YciN family protein	NA	NA	NA	NA	NA
WP_001304419.1|40604_43202_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 2
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	48112	48703	5050588		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|48112_48703_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 3
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	56522	58457	5050588		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485006.1|56522_58457_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	4.8e-33
>prophage 4
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	67391	69409	5050588		Salmonella_phage(50.0%)	2	NA	NA
WP_000135020.1|67391_68555_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	1.6e-28
WP_000573407.1|68602_69409_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 5
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	88751	89834	5050588		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057991.1|88751_89834_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-23
>prophage 6
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	107058	107574	5050588		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|107058_107574_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 7
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	112335	121756	5050588	tRNA	Bacillus_phage(20.0%)	7	NA	NA
WP_001350888.1|112335_113568_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|113822_114806_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|115080_115254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123782.1|115283_116657_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157413.1|116785_117721_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_001295593.1|120047_120482_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|120622_121756_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 8
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	126715	127705	5050588		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|126715_127705_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 9
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	145842	149745	5050588		Klosneuvirus(100.0%)	1	NA	NA
WP_000139522.1|145842_149745_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 10
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	153685	154634	5050588		Escherichia_phage(50.0%)	2	NA	NA
WP_001350640.1|153685_154216_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731859.1|154460_154634_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 11
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	166185	168147	5050588		Phage_TP(100.0%)	1	NA	NA
WP_001350637.1|166185_168147_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.6	1.2e-23
>prophage 12
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	171776	172790	5050588		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220436.1|171776_172790_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	4.6e-27
>prophage 13
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	178286	180389	5050588		Salmonella_phage(100.0%)	1	NA	NA
WP_000689338.1|178286_180389_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.1	6.6e-137
>prophage 14
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	185014	187420	5050588		Ralstonia_phage(100.0%)	1	NA	NA
WP_032153376.1|185014_187420_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.6	1.1e-26
>prophage 15
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	191115	192660	5050588		Escherichia_phage(100.0%)	1	NA	NA
WP_000702551.1|191115_192660_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 16
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	204084	205843	5050588		Escherichia_phage(66.67%)	3	NA	NA
WP_000781370.1|204084_204369_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000605675.1|204368_204647_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_000642412.1|204832_205843_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
>prophage 17
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	209249	211649	5050588		Klosneuvirus(100.0%)	1	NA	NA
WP_001362858.1|209249_211649_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	2.1e-09
>prophage 18
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	217117	224053	5050588		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_000402827.1|217117_219913_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	4.4e-19
WP_000832485.1|219957_222330_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001304373.1|222367_224053_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	3.8e-10
>prophage 19
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	245528	246947	5050588		Bacillus_phage(100.0%)	1	NA	NA
WP_000558461.1|245528_246947_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	1.4e-18
>prophage 20
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	253690	255820	5050588		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091198.1|253690_254074_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803537.1|254105_254324_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012592.1|254380_255820_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	4.8e-30
>prophage 21
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	263323	264214	5050588		Bacillus_phage(100.0%)	1	NA	NA
WP_000592858.1|263323_264214_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
>prophage 22
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	268601	273579	5050588		Salmonella_phage(20.0%)	6	NA	NA
WP_000214712.1|268601_268805_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000526706.1|268840_270301_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	5.1e-43
WP_015952996.1|270651_270744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836075.1|270801_271821_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
WP_001298659.1|271832_273047_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_001304355.1|273252_273579_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
>prophage 23
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	278460	283025	5050588		Escherichia_phage(100.0%)	4	NA	NA
WP_001468025.1|278460_280884_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
WP_000213028.1|280894_281512_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526507.1|281513_282368_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148695.1|282410_283025_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
>prophage 24
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	300855	302157	5050588		Bacillus_phage(100.0%)	1	NA	NA
WP_000732519.1|300855_302157_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
>prophage 25
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	312052	313864	5050588		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945903.1|312052_313864_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 26
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	333652	334927	5050588	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001351112.1|333652_334927_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	2.0e-83
>prophage 27
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	341838	343337	5050588		Salmonella_phage(50.0%)	2	NA	NA
WP_001350654.1|341838_342360_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
WP_000250643.1|342440_343337_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	2.1e-07
>prophage 28
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	347752	356544	5050588		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101200.1|347752_348568_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	9.8e-20
WP_000007283.1|348695_349277_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701049.1|349422_350592_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|350757_350847_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190985.1|351145_352171_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_000269493.1|352167_353100_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182336.1|353212_354424_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|354714_355863_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|355902_356544_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 29
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	362049	364316	5050588		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587583.1|362049_362862_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069965.1|362865_363651_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001362847.1|363647_364316_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
>prophage 30
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	372605	377689	5050588		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|372605_373826_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907963.1|373822_375094_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948883.1|375068_375815_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.1	5.1e-07
WP_001304330.1|375824_377312_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367158.1|377320_377689_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
>prophage 31
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	396161	415700	5050588	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001296108.1|396161_397808_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.7e-31
WP_000069409.1|397864_400243_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_000368046.1|400575_401409_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|401565_402612_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001313872.1|402743_402935_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175635.1|402938_404375_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001298229.1|404437_405151_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209783.1|405397_405862_-	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.8e-11
WP_000029464.1|405939_406689_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154198.1|406688_407240_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|407301_408282_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|408382_408682_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672426.1|408686_411074_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|411088_412072_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|412355_412400_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|412522_412879_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|412931_413129_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|413225_413768_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|413771_415700_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 32
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	425076	427338	5050588		Tupanvirus(100.0%)	1	NA	NA
WP_000077882.1|425076_427338_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.9e-143
>prophage 33
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	433463	434291	5050588		Bacillus_virus(100.0%)	1	NA	NA
WP_000175056.1|433463_434291_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	3.5e-73
>prophage 34
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	441767	442988	5050588		Klosneuvirus(100.0%)	1	NA	NA
WP_000081990.1|441767_442988_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.7e-26
>prophage 35
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	449751	450405	5050588		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|449751_450405_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 36
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	454795	456751	5050588		Streptococcus_phage(100.0%)	1	NA	NA
WP_001332112.1|454795_456751_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 37
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	461677	465763	5050588		Tupanvirus(50.0%)	4	NA	NA
WP_001135068.1|461677_462319_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
WP_001313906.1|462411_463770_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|463887_464646_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723732.1|464782_465763_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	6.7e-07
>prophage 38
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	474576	475431	5050588		Indivirus(100.0%)	1	NA	NA
WP_001332110.1|474576_475431_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 39
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	478749	483326	5050588		Bacillus_phage(100.0%)	3	NA	NA
WP_000219684.1|478749_480033_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621390.1|480179_481655_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|481835_483326_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 40
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	492293	500399	5050588	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|492293_493979_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|494183_494765_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220977.1|494804_495500_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128839.1|495557_497468_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	1.0e-91
WP_001351125.1|497599_497944_+	RidA family protein	NA	NA	NA	NA	NA
WP_001304301.1|498305_498665_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|498784_498964_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855011.1|499037_500399_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.9	2.3e-42
>prophage 41
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	504261	505818	5050588		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|504261_505818_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 42
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	511458	511668	5050588		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|511458_511668_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 43
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	517001	519050	5050588		Moraxella_phage(100.0%)	1	NA	NA
WP_001055805.1|517001_519050_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	4.0e-86
>prophage 44
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	526546	531014	5050588		Escherichia_phage(33.33%)	7	NA	NA
WP_000812741.1|526546_527203_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.5	1.4e-56
WP_000984819.1|527597_527939_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879320.1|527951_528824_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|528827_529202_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|529340_529571_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011664.1|529672_530329_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|530351_531014_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 45
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	539070	540546	5050588		Cyanophage(100.0%)	1	NA	NA
WP_000301724.1|539070_540546_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	3.4e-79
>prophage 46
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	544544	551679	5050588		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|544544_545867_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|545882_546815_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|546893_547649_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|547645_548431_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|548647_549658_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|549666_550278_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072123646.1|550416_550482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024939.1|550553_551156_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|551157_551679_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 47
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	555572	557623	5050588		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639256.1|555572_556391_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_001313931.1|556443_556839_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|556879_557623_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 48
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	564239	565973	5050588	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025351.1|564239_565973_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.3	3.7e-85
>prophage 49
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	570500	574769	5050588		Tupanvirus(33.33%)	4	NA	NA
WP_000763860.1|570500_570890_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
WP_000036385.1|570904_571954_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204321.1|571956_572817_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001332092.1|573107_574769_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.5	3.8e-10
>prophage 50
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	584856	586371	5050588		Cedratvirus(100.0%)	1	NA	NA
WP_001187785.1|584856_586371_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	2.1e-12
>prophage 51
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	598353	599106	5050588		Bacillus_virus(100.0%)	1	NA	NA
WP_001273001.1|598353_599106_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 52
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	611372	613636	5050588		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000334564.1|611372_612041_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.2e-79
WP_000737290.1|612553_613636_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.1	6.0e-166
>prophage 53
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	629965	642335	5050588		Bacillus_phage(33.33%)	12	NA	NA
WP_001351132.1|629965_631660_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	1.5e-17
WP_000009302.1|631830_632013_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922688.1|632091_633009_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|633181_634102_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228684.1|634090_634561_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	6.8e-34
WP_001157268.1|634541_635960_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001304276.1|636071_636722_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.6e-07
WP_001330593.1|636761_637127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824389.1|637692_638751_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.1	2.5e-92
WP_000218217.1|639346_640198_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826735.1|640305_641664_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|641663_642335_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 54
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	646385	647606	5050588	integrase	Ralstonia_phage(100.0%)	1	638955:638969	652527:652541
638955:638969	attL	CATTTCTTTATAAAT	NA	NA	NA	NA
WP_001298509.1|646385_647606_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	42.1	2.5e-80
WP_001298509.1|646385_647606_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	42.1	2.5e-80
652527:652541	attR	CATTTCTTTATAAAT	NA	NA	NA	NA
>prophage 55
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	654696	655560	5050588		Enterococcus_phage(100.0%)	1	NA	NA
WP_000282336.1|654696_655560_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	36.4	3.2e-21
>prophage 56
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	663659	694689	5050588	integrase	Bacillus_phage(28.57%)	18	661533:661547	676378:676392
661533:661547	attL	TATTGGCTATCGTGT	NA	NA	NA	NA
WP_000262502.1|663659_664391_-	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	41.4	8.7e-44
WP_001233369.1|664564_665044_+	DUF4756 family protein	NA	NA	NA	NA	NA
WP_001287374.1|665202_665607_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000505229.1|665670_666021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564596.1|666129_666372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091321.1|666444_666741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687678.1|666793_667084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298701.1|667165_667384_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_000830396.1|667600_668437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325918.1|668898_669696_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_024174323.1|670033_671296_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	9.0e-73
WP_000703047.1|671489_672794_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286281.1|672821_674102_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_001327263.1|674094_675897_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001327262.1|675883_677596_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.8e-31
676378:676392	attR	TATTGGCTATCGTGT	NA	NA	NA	NA
WP_000970688.1|677852_678812_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623030.1|679002_685110_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	3.1e-33
WP_000369530.1|685197_694689_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
>prophage 57
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	714155	715427	5050588	integrase	Stenotrophomonas_phage(100.0%)	1	710514:710527	729130:729143
710514:710527	attL	GATATGGCGGTGAT	NA	NA	NA	NA
WP_000055670.1|714155_715427_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.8e-73
WP_000055670.1|714155_715427_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.8e-73
729130:729143	attR	ATCACCGCCATATC	NA	NA	NA	NA
>prophage 58
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	720985	749204	5050588		Tupanvirus(80.0%)	7	NA	NA
WP_001327259.1|720985_725353_-	colibactin non-ribosomal peptide synthetase ClbN	NA	A0A2K9KZV5	Tupanvirus	22.8	4.3e-37
WP_000217768.1|725349_726789_-	precolibactin export MATE transporter ClbM	NA	NA	NA	NA	NA
WP_001297937.1|726850_728314_-	colibactin biosynthesis amidase ClbL	NA	NA	NA	NA	NA
WP_000222467.1|728306_734771_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbK	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-43
WP_001468003.1|734781_741282_-	colibactin non-ribosomal peptide synthetase ClbJ	NA	A0A2K9KZV5	Tupanvirus	23.4	2.5e-102
WP_000829570.1|741325_744358_-	colibactin polyketide synthase ClbI	NA	D0R7J2	Paenibacillus_phage	37.9	4.0e-50
WP_001304254.1|744407_749204_-	colibactin non-ribosomal peptide synthetase ClbH	NA	A0A2K9L3I8	Tupanvirus	28.7	3.0e-44
>prophage 59
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	755448	765069	5050588		Tupanvirus(100.0%)	1	NA	NA
WP_001362828.1|755448_765069_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbB	NA	A0A2K9KZV5	Tupanvirus	23.8	5.0e-46
>prophage 60
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	776033	777886	5050588		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502870.1|776033_776678_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_001362826.1|776662_777886_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	1.5e-61
>prophage 61
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	797370	799172	5050588	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001323403.1|797370_798150_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|798149_799172_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
>prophage 62
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	802682	803450	5050588		Bacillus_virus(100.0%)	1	NA	NA
WP_000016205.1|802682_803450_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.7e-13
>prophage 63
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	814582	816762	5050588		Yersinia_phage(33.33%)	4	NA	NA
WP_001234569.1|814582_815404_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.5	4.7e-46
WP_000213703.1|815494_815980_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.3	9.9e-12
WP_001351157.1|815995_816472_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|816540_816762_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 64
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	821104	822271	5050588		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001297905.1|821104_822271_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	2.2e-227
>prophage 65
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	828468	829368	5050588		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|828468_829368_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 66
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	836723	839544	5050588		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704860.1|836723_837890_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
WP_000043444.1|838137_839544_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.6	2.8e-38
>prophage 67
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	843818	852534	5050588		Enterobacteria_phage(42.86%)	8	NA	NA
WP_000735124.1|843818_844946_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
WP_001362820.1|844955_846194_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_001100791.1|846225_846774_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_000857549.1|846778_847657_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023627.1|847714_848614_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000699418.1|848613_849699_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_000183060.1|850071_850965_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115981.1|851139_852534_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
>prophage 68
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	858132	864835	5050588		Bacillus_phage(25.0%)	6	NA	NA
WP_001296216.1|858132_859503_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_000079277.1|859604_861041_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.3	3.8e-51
WP_000699724.1|861043_862267_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|862263_862743_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|862745_863711_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000048190.1|863713_864835_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 69
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	869152	880051	5050588		Catovirus(33.33%)	11	NA	NA
WP_000654488.1|869152_869992_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
WP_000137112.1|870120_872283_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482915.1|872285_872729_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|872734_873874_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_162829205.1|874182_874332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332223.1|874532_876116_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001227699.1|876190_876529_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000687871.1|876518_876809_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_001252295.1|876861_878715_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|878736_879318_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|879409_880051_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 70
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	884778	886131	5050588		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469710.1|884778_886131_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 71
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	899238	901361	5050588		Bacillus_phage(100.0%)	2	NA	NA
WP_000675178.1|899238_900642_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|900638_901361_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
>prophage 72
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	907200	910694	5050588	tRNA	Phage_TP(50.0%)	3	NA	NA
WP_000476019.1|907200_908562_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_001350699.1|909061_909379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807360.1|909794_910694_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
>prophage 73
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	919835	935884	5050588	integrase,protease	Escherichia_phage(28.57%)	17	915171:915187	936389:936405
915171:915187	attL	TGCGGTTCGTCGAGCAT	NA	NA	NA	NA
WP_000846205.1|919835_920840_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	2.2e-13
WP_000011933.1|920836_921802_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434049.1|921775_922522_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297940.1|922573_923392_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822262.1|923456_924257_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195614.1|924253_925042_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_001596797.1|925723_926005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373414.1|926007_926493_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	66.9	8.6e-48
WP_001017075.1|926750_928664_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	57.2	2.5e-215
WP_001596799.1|929016_929730_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000710161.1|930121_931939_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	1.5e-129
WP_001261489.1|931935_932235_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113145.1|932241_932562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072112918.1|932554_933475_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001075377.1|933484_933709_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	3.6e-17
WP_000163378.1|933812_934667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513576.1|934663_935884_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.8	4.9e-132
936389:936405	attR	TGCGGTTCGTCGAGCAT	NA	NA	NA	NA
>prophage 74
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	944984	947018	5050588	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350700.1|944984_947018_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 75
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	959100	968545	5050588		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|959100_960237_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001332210.1|960233_962237_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|962361_962823_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|962863_963334_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|963380_964100_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|964096_965782_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|966003_966735_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|966794_966902_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|966882_967614_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|967618_968545_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 76
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	988895	990416	5050588		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|988895_990416_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 77
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	994110	997896	5050588		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|994110_994779_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425456.1|995036_995873_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001596802.1|995904_997896_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
>prophage 78
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1001964	1002822	5050588		Catovirus(100.0%)	1	NA	NA
WP_000873879.1|1001964_1002822_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	4.0e-24
>prophage 79
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1016209	1020510	5050588		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001332203.1|1016209_1017676_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
WP_000198797.1|1017793_1018780_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000594599.1|1018818_1019532_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1019943_1020510_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 80
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1026264	1033914	5050588		Vibrio_phage(50.0%)	7	NA	NA
WP_000194888.1|1026264_1027854_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|1027857_1028202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213379.1|1028535_1029726_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|1029753_1030449_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578103.1|1030598_1032359_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	9.9e-102
WP_000494186.1|1032483_1032768_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1032906_1033914_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 81
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1043816	1044434	5050588		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|1043816_1044434_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 82
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1053202	1058968	5050588		Bacillus_phage(25.0%)	5	NA	NA
WP_000422239.1|1053202_1054846_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.6	1.6e-13
WP_000884927.1|1054921_1055572_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
WP_000872522.1|1055571_1056636_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.2	3.1e-18
WP_000406059.1|1056709_1057765_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865556.1|1057876_1058968_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.3	2.7e-118
>prophage 83
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1063245	1068088	5050588		Hokovirus(50.0%)	2	NA	NA
WP_000876050.1|1063245_1066095_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	3.2e-41
WP_001296244.1|1066261_1068088_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
>prophage 84
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1083011	1096887	5050588		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281253.1|1083011_1085639_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
WP_000990768.1|1085785_1086508_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001351169.1|1086647_1090406_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	28.2	3.3e-22
WP_001075170.1|1091087_1093373_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|1093519_1094650_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|1094649_1094904_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301034.1|1094957_1095608_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|1095810_1096887_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 85
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1102779	1107350	5050588	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140576.1|1102779_1103739_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.6e-69
WP_000150339.1|1103751_1103937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992976.1|1103977_1104781_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001297939.1|1104798_1106088_-	MFS transporter	NA	NA	NA	NA	NA
WP_001350710.1|1106144_1107350_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	3.5e-26
>prophage 86
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1110953	1115957	5050588		Tupanvirus(50.0%)	4	NA	NA
WP_000879110.1|1110953_1111556_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
WP_011076488.1|1111863_1113003_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	7.2e-29
WP_000461633.1|1113006_1113975_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_000860295.1|1113974_1115957_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 87
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1150919	1154147	5050588		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|1150919_1151519_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|1151577_1153410_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203415.1|1153496_1154147_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
>prophage 88
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1164706	1166566	5050588		Sodalis_phage(50.0%)	2	NA	NA
WP_000156130.1|1164706_1165597_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	53.1	4.0e-67
WP_001293612.1|1165792_1166566_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 89
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1170777	1172295	5050588		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|1170777_1172295_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 90
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1177153	1248539	5050588	integrase,head,protease,lysis,holin,tail,coat,portal,tRNA,terminase	Enterobacteria_phage(72.88%)	86	1207275:1207291	1248613:1248629
WP_001283598.1|1177153_1177966_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|1177965_1178979_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|1179044_1180181_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|1180279_1181275_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|1181271_1182450_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|1182714_1183935_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683753.1|1184093_1186100_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|1186220_1186499_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089236.1|1186532_1187081_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|1187080_1187890_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|1187889_1188714_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|1188717_1189803_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|1189837_1190770_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|1190935_1191487_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|1191806_1192649_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|1192650_1193178_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|1193174_1193654_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|1193650_1194154_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000120670.1|1194170_1194923_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001447287.1|1194942_1197591_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195816.1|1198780_1199266_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425008.1|1199468_1201613_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|1201612_1202923_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|1203103_1203388_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|1203759_1205100_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|1205157_1205913_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|1206206_1207139_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
1207275:1207291	attL	CTGCAGGGGACACCATT	NA	NA	NA	NA
WP_000958671.1|1207450_1208608_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_072018171.1|1208847_1209675_-	acetyltransferase	NA	C7U0W4	Enterobacteria_phage	99.1	3.2e-79
WP_000132323.1|1209826_1212775_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	98.8	0.0e+00
WP_000835353.1|1212875_1213805_-	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	89.6	4.6e-159
WP_000620145.1|1213868_1214042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410001.1|1214038_1214191_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001051912.1|1214305_1214554_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000903307.1|1214553_1215090_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_000954424.1|1215570_1216014_-	SocA family protein	NA	I6R0L8	Salmonella_phage	70.1	1.2e-59
WP_001331792.1|1216409_1216778_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	97.5	7.2e-63
WP_001362793.1|1216802_1218629_-	hypothetical protein	NA	I6R973	Salmonella_phage	73.1	7.6e-230
WP_000257014.1|1218628_1220044_-	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	80.3	3.7e-200
WP_000964857.1|1220053_1220743_-	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	98.3	6.8e-115
WP_000627624.1|1220745_1221201_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	98.7	3.3e-86
WP_000785520.1|1221200_1221902_-	hypothetical protein	NA	A0A2D1GLK3	Escherichia_phage	98.7	4.6e-119
WP_001122380.1|1221901_1223320_-	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.7	5.1e-274
WP_001140510.1|1223329_1223791_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001362792.1|1223771_1223960_-	hypothetical protein	NA	A5VW71	Enterobacteria_phage	100.0	2.9e-28
WP_000013270.1|1224001_1225255_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	100.0	3.4e-237
WP_000372589.1|1225273_1226167_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818372.1|1226257_1228456_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.4	0.0e+00
WP_000200770.1|1228457_1229873_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	7.5e-278
WP_000113731.1|1229869_1230310_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807790.1|1230312_1230555_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	1.1e-35
WP_001059339.1|1230855_1231380_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001139677.1|1231582_1231735_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	98.0	8.1e-21
WP_000092261.1|1231722_1232190_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.1	4.6e-75
WP_000229392.1|1232186_1232663_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|1232646_1232970_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_032153396.1|1233642_1234266_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.0	2.2e-112
WP_000994515.1|1234262_1234451_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001008202.1|1234447_1234810_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	3.5e-62
WP_001279421.1|1235096_1235366_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000566863.1|1235358_1235529_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	98.2	5.5e-26
WP_001254251.1|1235525_1235708_-	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000814611.1|1235704_1236115_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344551.1|1236086_1236443_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	96.5	6.1e-59
WP_000818846.1|1236460_1236667_-	hypothetical protein	NA	K7PKH6	Enterobacteria_phage	94.1	1.9e-25
WP_001331794.1|1236743_1238624_-	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	100.0	0.0e+00
WP_000067065.1|1238731_1239592_-	replication protein	NA	K7PL20	Enterobacteria_phage	100.0	3.0e-160
WP_000166207.1|1239584_1239731_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000536662.1|1239766_1240048_-	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	100.0	1.9e-44
WP_000391959.1|1240164_1240395_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	100.0	1.1e-37
WP_001331795.1|1240503_1241190_+	helix-turn-helix transcriptional regulator	NA	K7PK07	Enterobacteria_phage	100.0	1.1e-130
WP_072197693.1|1241872_1242235_+	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	3.0e-53
WP_000213976.1|1242313_1242514_+	Restriction inhibitor protein ral	NA	A5VWA0	Enterobacteria_phage	100.0	3.2e-33
WP_000392426.1|1242572_1242995_+	hypothetical protein	NA	A5VWA1	Enterobacteria_phage	100.0	3.3e-72
WP_000638547.1|1244163_1244295_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|1244279_1244432_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031365.1|1244688_1245294_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|1245293_1245677_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|1245700_1245997_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|1246091_1246610_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_000215166.1|1246606_1246906_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|1246907_1247480_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000253290.1|1247479_1247764_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	97.9	3.2e-47
WP_000002115.1|1247756_1248041_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	98.9	1.2e-49
WP_000545737.1|1248113_1248281_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|1248338_1248539_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
1248613:1248629	attR	CTGCAGGGGACACCATT	NA	NA	NA	NA
>prophage 91
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1256406	1263983	5050588		Bacillus_phage(50.0%)	4	NA	NA
WP_001331804.1|1256406_1260000_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001331805.1|1260055_1261201_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1261274_1262219_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283509.1|1262288_1263983_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 92
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1267676	1268597	5050588		Morganella_phage(100.0%)	1	NA	NA
WP_000484022.1|1267676_1268597_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 93
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1272415	1273153	5050588		Clostridioides_phage(100.0%)	1	NA	NA
WP_001314031.1|1272415_1273153_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.3	6.1e-13
>prophage 94
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1298692	1320420	5050588		Streptococcus_phage(25.0%)	22	NA	NA
WP_032153397.1|1298692_1300708_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	2.9e-150
WP_001317975.1|1300778_1301777_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1302006_1302768_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1302952_1303924_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1304307_1304565_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623142.1|1304609_1306337_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1306377_1306887_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096640.1|1306929_1307781_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000724596.1|1307885_1308254_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000105467.1|1308256_1309168_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
WP_000021034.1|1309302_1310400_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1310389_1311265_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458408.1|1311264_1312098_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290262.1|1312097_1313114_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517443.1|1313271_1314063_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_001175632.1|1314342_1315239_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040463.1|1315242_1316667_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000084590.1|1316844_1317744_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838948.1|1317839_1318415_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001331810.1|1318475_1318925_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1318911_1319337_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102910.1|1319550_1320420_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 95
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1339090	1340041	5050588		Cyanophage(100.0%)	1	NA	NA
WP_001003713.1|1339090_1340041_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	7.4e-11
>prophage 96
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1357282	1357996	5050588		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1357282_1357996_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 97
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1365475	1369476	5050588		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198327.1|1365475_1366765_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|1366850_1367477_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001350863.1|1367800_1368838_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.6	2.8e-72
WP_001028626.1|1368837_1369476_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 98
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1375722	1382212	5050588		Escherichia_phage(66.67%)	7	NA	NA
WP_000017553.1|1375722_1375875_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
WP_000076001.1|1375892_1376084_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|1376394_1376913_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|1376928_1377468_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138282.1|1377561_1379139_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|1379207_1380674_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000937882.1|1380835_1382212_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	9.0e-42
>prophage 99
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1402718	1403150	5050588		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|1402718_1403150_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 100
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1413035	1419373	5050588		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133562.1|1413035_1414319_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|1414377_1414578_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|1414589_1414925_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1414926_1416777_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|1416793_1417309_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1417404_1417728_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1417744_1418131_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1418158_1419373_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 101
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1429490	1431002	5050588		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000493462.1|1429490_1431002_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
>prophage 102
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1436760	1448069	5050588		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1436760_1438014_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883117.1|1438342_1439533_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1439577_1439916_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001305238.1|1439976_1441311_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	38.2	1.4e-10
WP_001215879.1|1441300_1442014_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001350885.1|1442178_1443606_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970064.1|1444181_1448069_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	6.5e-130
>prophage 103
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1452189	1452450	5050588		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|1452189_1452450_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 104
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1455909	1459646	5050588		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1455909_1456590_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1456856_1457831_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790169.1|1457846_1459646_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 105
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1464548	1551900	5050588	capsid,head,plate,lysis,tail,holin,portal,tRNA,terminase	Shigella_phage(41.82%)	95	NA	NA
WP_000083664.1|1464548_1465286_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1465417_1466752_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|1466784_1467666_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|1467768_1468356_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1468411_1468795_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|1469099_1469789_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|1469836_1470874_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1471080_1471500_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|1471568_1472267_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|1472298_1474959_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1475072_1476428_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|1476473_1476797_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|1476793_1478092_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001350770.1|1486578_1489152_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|1489281_1490013_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079096.1|1490009_1490990_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1491124_1491862_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1492131_1492473_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|1492576_1492624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|1492722_1493883_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|1493925_1495047_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|1495057_1496128_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|1496337_1496703_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|1496851_1497370_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|1497359_1498586_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|1498601_1499084_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1499160_1499508_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1499549_1500317_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1500347_1500896_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1500914_1501163_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1501299_1502661_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1502827_1503619_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|1503639_1504926_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|1504980_1505574_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|1505696_1506575_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|1506660_1508322_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1508470_1508812_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|1508873_1509164_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|1509153_1509630_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1509761_1510244_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000183405.1|1511400_1512189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174562.1|1512276_1512570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|1512780_1513554_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|1514605_1516495_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|1516748_1517240_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|1517242_1517686_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|1517657_1518260_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554717.1|1518259_1519003_-|tail	tail fiber protein	tail	O22004	Shigella_phage	91.7	1.1e-49
WP_000539246.1|1519006_1519591_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785328.1|1519581_1520640_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|1520626_1521052_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|1521051_1521600_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|1521599_1522679_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|1522675_1524004_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|1524064_1525900_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|1526041_1526311_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|1526310_1526667_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|1526666_1528163_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|1528146_1528317_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|1528325_1528886_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|1528882_1529389_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|1529363_1529774_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|1529770_1530094_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|1530096_1530297_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|1530346_1531552_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_000466267.1|1532194_1533436_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|1533435_1533618_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|1533629_1535126_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|1535359_1535854_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|1535979_1536330_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000026993.1|1536432_1536873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332386.1|1536979_1537231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|1537301_1537739_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|1537735_1538212_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|1538198_1538504_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|1538655_1538991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|1539176_1539929_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001351089.1|1539942_1540932_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	1.1e-190
WP_001061411.1|1540939_1541737_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|1541756_1542146_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210172.1|1542142_1542469_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001332383.1|1542465_1543119_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_001332382.1|1543118_1543613_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|1543609_1544551_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|1544540_1544720_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|1544895_1545447_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|1545490_1545691_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|1545781_1546456_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|1546658_1547171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|1547639_1548002_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|1548067_1548892_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|1549019_1549544_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|1549652_1550519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|1550560_1550767_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|1550727_1551900_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
>prophage 106
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1558373	1562425	5050588		Klosneuvirus(50.0%)	4	NA	NA
WP_001332373.1|1558373_1559654_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	1.2e-32
WP_001298180.1|1559891_1561292_+	GABA permease	NA	NA	NA	NA	NA
WP_000156818.1|1561312_1561975_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|1561975_1562425_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 107
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1568231	1573528	5050588		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223238.1|1568231_1568477_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	36.8	6.3e-07
WP_000080951.1|1568473_1568884_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.1e-18
WP_000246589.1|1568856_1571001_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.1e-195
WP_000777929.1|1571010_1571970_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000985490.1|1572325_1573528_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 108
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1588270	1593656	5050588	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1588270_1588456_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047209.1|1588690_1591321_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
WP_000140506.1|1591448_1591949_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1592017_1593079_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132237.1|1593158_1593656_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	3.4e-31
>prophage 109
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1599124	1600090	5050588		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287404.1|1599124_1600090_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 110
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1607661	1608672	5050588		Enterobacteria_phage(100.0%)	1	NA	NA
WP_024174326.1|1607661_1608672_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	27.8	3.9e-26
>prophage 111
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1627559	1634699	5050588		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|1627559_1630121_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|1630226_1630883_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|1630933_1631701_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|1631896_1632805_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|1632801_1634064_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|1634060_1634699_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 112
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1639072	1642788	5050588		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1639072_1640065_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1640127_1641267_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254701.1|1641406_1642033_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1642026_1642788_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 113
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1645899	1647932	5050588		Tupanvirus(50.0%)	2	NA	NA
WP_001173653.1|1645899_1646505_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090357.1|1646504_1647932_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	1.3e-30
>prophage 114
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1662581	1663367	5050588		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021344.1|1662581_1663367_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.4e-20
>prophage 115
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1666941	1667613	5050588		Vibrio_phage(100.0%)	1	NA	NA
WP_001199974.1|1666941_1667613_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
>prophage 116
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1671428	1674452	5050588		Streptococcus_phage(50.0%)	2	NA	NA
WP_000036723.1|1671428_1672727_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1672814_1674452_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 117
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1678485	1682600	5050588		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046816.1|1678485_1679787_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	1.1e-38
WP_000186431.1|1679843_1682600_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.9e-54
>prophage 118
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1690132	1690981	5050588		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|1690132_1690981_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 119
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1695839	1696595	5050588		Bacillus_phage(100.0%)	1	NA	NA
WP_001296330.1|1695839_1696595_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 120
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1708171	1710677	5050588	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_001331603.1|1708171_1709377_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.5	3.2e-75
WP_000184272.1|1709376_1709820_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117716.1|1709870_1710677_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
>prophage 121
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1719422	1724560	5050588		Cronobacter_phage(50.0%)	2	NA	NA
WP_000147358.1|1719422_1722068_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.3	1.9e-96
WP_000512742.1|1722079_1724560_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.4	4.9e-06
>prophage 122
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1727872	1728133	5050588		Burkholderia_virus(100.0%)	1	NA	NA
WP_001117814.1|1727872_1728133_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	37.2	5.7e-06
>prophage 123
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1742948	1759563	5050588		Paramecium_bursaria_Chlorella_virus(14.29%)	10	NA	NA
WP_001331592.1|1742948_1743896_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-16
WP_001066237.1|1743967_1744564_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
WP_000382413.1|1744566_1745742_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810553.1|1745741_1747322_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	4.5e-05
WP_001314100.1|1747353_1748178_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|1748435_1749689_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|1749920_1751252_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775938.1|1751313_1753140_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	1.0e-24
WP_001331589.1|1753139_1756682_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138098.1|1756674_1759563_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	9.0e-68
>prophage 124
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1765040	1771813	5050588		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1765040_1765835_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1765841_1766717_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|1766867_1769114_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1769126_1769657_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082183.1|1770341_1771031_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1771099_1771813_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 125
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1781444	1783939	5050588		Aichi_virus(50.0%)	2	NA	NA
WP_000256426.1|1781444_1782863_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|1783177_1783939_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 126
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1788225	1788981	5050588		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|1788225_1788981_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 127
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1813260	1828652	5050588	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|1813260_1814661_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001296347.1|1814678_1815995_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012167.1|1816030_1817398_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_000838415.1|1817433_1817922_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001363023.1|1817921_1819841_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001363024.1|1820276_1821725_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	27.0	4.3e-26
WP_001050745.1|1821726_1821852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|1821848_1821920_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192798.1|1821974_1822523_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|1822565_1824083_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1824092_1825191_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813190.1|1825281_1827015_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_000715230.1|1827020_1827731_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806987.1|1827755_1828652_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 128
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1832457	1836930	5050588		Pandoravirus(50.0%)	2	NA	NA
WP_001350137.1|1832457_1833891_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	1.5e-31
WP_000195072.1|1834056_1836930_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	8.2e-263
>prophage 129
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1845066	1846299	5050588		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1845066_1846299_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 130
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1859794	1860472	5050588		Bacillus_virus(100.0%)	1	NA	NA
WP_000956879.1|1859794_1860472_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	6.4e-09
>prophage 131
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1865524	1866433	5050588		Yersinia_phage(100.0%)	1	NA	NA
WP_000646943.1|1865524_1866433_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	7.5e-53
>prophage 132
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1874587	1875742	5050588		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1874587_1875742_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 133
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1898437	1899700	5050588	integrase	Pseudomonas_phage(100.0%)	1	1889454:1889467	1900901:1900914
1889454:1889467	attL	TTTGCTGGCCCCAG	NA	NA	NA	NA
WP_021519596.1|1898437_1899700_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	5.8e-80
WP_021519596.1|1898437_1899700_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	5.8e-80
1900901:1900914	attR	TTTGCTGGCCCCAG	NA	NA	NA	NA
>prophage 134
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1928545	1937026	5050588	transposase	Mycobacterium_phage(33.33%)	5	NA	NA
WP_000999383.1|1928545_1929778_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.7	2.9e-60
WP_059348061.1|1929913_1930558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001332016.1|1930751_1932200_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_169059419.1|1932370_1933584_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.0	1.5e-165
WP_000792544.1|1934977_1937026_-	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
>prophage 135
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1945001	1947177	5050588		Yersinia_phage(33.33%)	4	NA	NA
WP_001175142.1|1945001_1945820_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.8e-45
WP_001596890.1|1945910_1946396_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.2	6.4e-11
WP_001186756.1|1946410_1946887_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692312.1|1946955_1947177_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
>prophage 136
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1952663	1953647	5050588		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001331698.1|1952663_1953647_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 137
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	1967231	1967891	5050588		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000590258.1|1967231_1967891_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.7	2.9e-06
>prophage 138
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2000570	2001743	5050588		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524959.1|2000570_2001743_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 139
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2023967	2024852	5050588		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|2023967_2024852_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 140
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2030695	2038014	5050588		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013152.1|2030695_2031523_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_000691616.1|2031722_2032649_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848521.1|2032699_2032957_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095186.1|2032998_2035218_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000438655.1|2035469_2036219_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001331680.1|2036541_2038014_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	1.7e-46
>prophage 141
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2045472	2050512	5050588		Bacillus_virus(50.0%)	4	NA	NA
WP_001281888.1|2045472_2047731_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
WP_001350728.1|2047868_2049476_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183493.1|2049584_2050067_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_000712658.1|2050119_2050512_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 142
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2058406	2070852	5050588		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_000986428.1|2058406_2059390_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
WP_000940869.1|2059386_2060196_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	2.7e-14
WP_001240663.1|2060569_2062711_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195274.1|2062774_2064667_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
WP_000105733.1|2064695_2065277_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444744.1|2065276_2066104_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2066128_2066551_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2066551_2067181_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|2067385_2068867_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2069014_2069686_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442855.1|2069691_2070852_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.4	9.1e-88
>prophage 143
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2082085	2082739	5050588		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|2082085_2082739_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 144
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2086652	2088086	5050588		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|2086652_2088086_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 145
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2093223	2094462	5050588	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708479.1|2093223_2094462_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 146
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2100870	2117055	5050588	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264377.1|2100870_2101884_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
WP_001144069.1|2102121_2102337_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918851.1|2102447_2104193_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	8.4e-77
WP_000437380.1|2104387_2106229_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2106307_2106814_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065876.1|2107067_2107832_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000120223.1|2108108_2108732_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094730.1|2108885_2110406_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_001297164.1|2110823_2112203_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000450588.1|2112244_2112577_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212450.1|2112795_2113779_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082822.1|2113962_2117055_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	8.5e-157
>prophage 147
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2128716	2129682	5050588		Escherichia_phage(100.0%)	1	NA	NA
WP_001098826.1|2128716_2129682_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 148
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2149560	2151855	5050588		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861709.1|2149560_2151855_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 149
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2158003	2159149	5050588		Streptococcus_phage(100.0%)	1	NA	NA
WP_001298324.1|2158003_2159149_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	2.8e-49
>prophage 150
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2175832	2183628	5050588		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|2175832_2176696_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_000249166.1|2176760_2178797_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246833.1|2178754_2179150_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|2179169_2179760_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2179769_2180345_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147637.1|2180457_2181498_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|2181570_2182206_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001350722.1|2182333_2182852_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	1.7e-09
WP_000449450.1|2182831_2183275_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189322.1|2183325_2183628_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 151
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2189335	2191225	5050588		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2189335_2191225_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 152
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2196706	2203345	5050588		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133040.1|2196706_2199379_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
WP_001031057.1|2199403_2200891_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2200918_2201371_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207671.1|2202001_2203345_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 153
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2207422	2210295	5050588	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764750.1|2207422_2208271_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	2.6e-23
WP_001107467.1|2208360_2210295_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 154
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2216924	2218407	5050588		Indivirus(50.0%)	2	NA	NA
WP_001047338.1|2216924_2217896_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445401.1|2218128_2218407_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	69.8	2.2e-16
>prophage 155
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2222475	2237270	5050588		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2222475_2223285_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922880.1|2223494_2224472_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2224485_2225472_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|2225492_2226059_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2226055_2226631_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2226599_2227157_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2227163_2227889_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2227936_2229370_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2229392_2229680_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183674.1|2229797_2230289_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2230334_2231189_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2231185_2231458_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620407.1|2231671_2232304_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047069.1|2232300_2233029_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719794.1|2233025_2233679_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809780.1|2233908_2236245_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001296449.1|2236340_2237270_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 156
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2245973	2249984	5050588	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_000108476.1|2245973_2247464_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224714.1|2247572_2248466_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000074795.1|2248587_2249379_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366127.1|2249486_2249984_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 157
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2253951	2256476	5050588	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001298588.1|2253951_2255319_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
WP_000497723.1|2255408_2256476_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 158
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2272970	2274014	5050588		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2272970_2274014_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 159
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2283301	2287813	5050588		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000132905.1|2283301_2284801_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.7	5.2e-11
WP_001331656.1|2284861_2285752_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275539.1|2285787_2286642_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843960.1|2286982_2287813_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 160
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2293152	2294037	5050588		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258951.1|2293152_2294037_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 161
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2300541	2304695	5050588		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738577.1|2300541_2301567_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
WP_071686831.1|2301634_2302816_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001351032.1|2302825_2303929_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078319.1|2303936_2304695_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.5e-19
>prophage 162
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2315031	2316503	5050588	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2315031_2315541_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004421.1|2315555_2316503_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 163
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2337727	2339680	5050588		Vibrio_phage(100.0%)	1	NA	NA
WP_001363052.1|2337727_2339680_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	31.1	9.2e-32
>prophage 164
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2348528	2357095	5050588		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773166.1|2348528_2351231_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	1.5e-40
WP_000031783.1|2351522_2352707_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2352777_2354892_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2354988_2355459_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2355555_2355930_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903381.1|2356055_2356343_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820734.1|2356349_2356709_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	3.1e-10
WP_001209702.1|2356708_2357095_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	4.3e-18
>prophage 165
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2362665	2372205	5050588		Tupanvirus(25.0%)	9	NA	NA
WP_000634747.1|2362665_2364579_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.1	4.7e-73
WP_000057415.1|2364578_2365601_+	hydrolase	NA	NA	NA	NA	NA
WP_000907086.1|2365594_2365813_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	4.0e-05
WP_001274684.1|2365866_2366736_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2366790_2367195_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2367496_2368129_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001304921.1|2368179_2370270_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000963803.1|2370336_2371557_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601853.1|2371641_2372205_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
>prophage 166
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2391103	2391940	5050588		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2391103_2391940_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 167
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2408750	2412517	5050588		Bacillus_phage(66.67%)	3	NA	NA
WP_001309803.1|2408750_2410373_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253708.1|2410448_2411801_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2411797_2412517_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 168
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2419093	2419987	5050588		Sodalis_phage(100.0%)	1	NA	NA
WP_000039083.1|2419093_2419987_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 169
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2426147	2428541	5050588		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081889.1|2426147_2428541_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 170
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2432931	2434158	5050588		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105471.1|2432931_2434158_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 171
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2449560	2452008	5050588		Dickeya_phage(100.0%)	1	NA	NA
WP_000993444.1|2449560_2452008_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 172
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2471878	2473689	5050588		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073603.1|2471878_2472622_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.4e-11
WP_000907827.1|2472618_2473689_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 173
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2477230	2478713	5050588		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|2477230_2477944_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|2477945_2478713_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 174
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2487604	2492331	5050588		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_001332164.1|2487604_2488525_+	phosphoglycerate dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	30.7	3.3e-24
WP_000661262.1|2488524_2489409_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000130217.1|2489512_2490367_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2490611_2491670_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2491662_2492331_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 175
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2495337	2499636	5050588		Dickeya_phage(50.0%)	4	NA	NA
WP_000964729.1|2495337_2495964_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.1	2.7e-30
WP_000106588.1|2496037_2498236_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.6	1.0e-119
WP_000130621.1|2498504_2498750_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|2498970_2499636_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 176
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2507529	2508336	5050588		Bacillus_virus(100.0%)	1	NA	NA
WP_000173679.1|2507529_2508336_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
>prophage 177
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2515775	2518511	5050588		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149184.1|2515775_2518511_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 178
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2528197	2530240	5050588		Indivirus(100.0%)	1	NA	NA
WP_032153433.1|2528197_2530240_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	2.3e-46
>prophage 179
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2533379	2533805	5050588		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000065791.1|2533379_2533805_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
>prophage 180
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2544476	2545946	5050588		Pithovirus(50.0%)	2	NA	NA
WP_001332154.1|2544476_2545247_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	1.7e-18
WP_000123131.1|2545298_2545946_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 181
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2588483	2590468	5050588		Bacillus_virus(50.0%)	2	NA	NA
WP_000103579.1|2588483_2589488_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196477.1|2589484_2590468_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 182
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2600353	2602687	5050588		Escherichia_phage(100.0%)	1	NA	NA
WP_000013974.1|2600353_2602687_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	3.7e-72
>prophage 183
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2606341	2606554	5050588		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2606341_2606554_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 184
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2610775	2611771	5050588		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182635.1|2610775_2611771_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.0e-11
>prophage 185
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2617089	2618631	5050588		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146514.1|2617089_2618631_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	8.6e-17
>prophage 186
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2638205	2642817	5050588		Clostridioides_phage(50.0%)	3	NA	NA
WP_000985743.1|2638205_2639501_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	3.7e-21
WP_000741500.1|2639630_2640782_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000582432.1|2640972_2642817_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 187
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2664943	2674449	5050588		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2664943_2665195_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2665335_2665767_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|2666011_2667556_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214150.1|2667565_2668849_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483824.1|2668852_2669812_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982107.1|2669798_2670833_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000646018.1|2671071_2672097_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213847.1|2672106_2673303_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.4e-35
WP_000587750.1|2673516_2674449_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 188
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2677857	2679951	5050588		Catovirus(50.0%)	2	NA	NA
WP_000064025.1|2677857_2678841_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-12
WP_000364803.1|2678922_2679951_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	5.5e-12
>prophage 189
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2687390	2691953	5050588		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|2687390_2687870_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|2687908_2688718_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2688815_2688983_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2689003_2689240_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|2689456_2690125_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050149.1|2690296_2691517_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	8.5e-44
WP_000976066.1|2691494_2691953_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	1.6e-48
>prophage 190
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2695294	2720046	5050588	integrase	Morganella_phage(35.71%)	28	2692515:2692528	2722321:2722334
2692515:2692528	attL	GACGGATGAAACCC	NA	NA	NA	NA
WP_001351217.1|2695294_2696563_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.3	5.1e-193
WP_001059729.1|2696559_2697210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001363069.1|2697681_2697900_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000412532.1|2697899_2698331_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
WP_001019373.1|2698343_2699177_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	9.0e-21
WP_000042975.1|2699169_2699349_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000613400.1|2699345_2700413_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	8.6e-16
WP_001065741.1|2700405_2700600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024678.1|2700596_2700860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|2700856_2701078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058741.1|2701070_2701673_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	33.3	2.6e-22
WP_001332287.1|2701685_2704037_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	48.2	1.7e-72
WP_000987941.1|2704213_2704444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001064134.1|2704433_2705171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018522.1|2705774_2705948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000246976.1|2705952_2707296_+	phage DNA ejection protein	NA	A0A0M5M1J8	Salmonella_phage	71.4	1.0e-159
WP_000729825.1|2707280_2709398_+	hypothetical protein	NA	A0A2D1GLK8	Escherichia_phage	54.1	1.2e-162
WP_001363070.1|2709417_2709813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072645.1|2710724_2711207_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
WP_000204055.1|2711210_2711588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000230710.1|2711604_2712048_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	65.7	4.8e-45
WP_000617439.1|2712307_2712595_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297973.1|2713295_2714120_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.5	1.3e-91
WP_000924289.1|2714411_2715029_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001363072.1|2715025_2716708_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.4	6.7e-23
WP_001295237.1|2716965_2717589_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2717643_2717919_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|2717937_2720046_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
2722321:2722334	attR	GACGGATGAAACCC	NA	NA	NA	NA
>prophage 191
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2724347	2725739	5050588		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2724347_2725739_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 192
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2739000	2740038	5050588		Wolbachia_phage(100.0%)	1	NA	NA
WP_001280586.1|2739000_2740038_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 193
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2745479	2746814	5050588		Moraxella_phage(100.0%)	1	NA	NA
WP_001363077.1|2745479_2746814_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 194
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2754118	2765995	5050588		Micromonas_sp._RCC1109_virus(20.0%)	11	NA	NA
WP_000168473.1|2754118_2755807_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.2e-56
WP_001312198.1|2755912_2756011_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001332269.1|2756411_2757596_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_000148034.1|2757603_2758101_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113443.1|2758097_2758460_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2758449_2758797_-	YidH family protein	NA	NA	NA	NA	NA
WP_001087168.1|2760345_2762061_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.0	6.1e-40
WP_001332266.1|2762227_2763094_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279773.1|2763183_2764845_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|2765041_2765470_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2765581_2765995_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 195
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2770424	2771573	5050588		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|2770424_2771573_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 196
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2776278	2783647	5050588		Bacillus_virus(33.33%)	8	NA	NA
WP_001298010.1|2776278_2778693_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.8e-115
WP_000060112.1|2778721_2779795_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2779794_2780895_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2780899_2782303_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122083097.1|2782599_2782680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|2782909_2783050_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2783066_2783426_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2783389_2783647_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 197
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2793844	2795182	5050588		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|2793844_2795182_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 198
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2805553	2813068	5050588		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|2805553_2806327_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251985.1|2806417_2807308_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2807307_2808267_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2808353_2809394_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|2809707_2811537_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933754.1|2811697_2813068_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
>prophage 199
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2825023	2826016	5050588		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845129.1|2825023_2826016_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	2.2e-50
>prophage 200
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2829184	2835037	5050588		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|2829184_2831053_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001350412.1|2831219_2831639_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387779.1|2831646_2833152_+	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	5.1e-14
WP_000211858.1|2833156_2834122_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|2834146_2835037_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 201
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2848433	2850080	5050588		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012594.1|2848433_2850080_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.5e-67
>prophage 202
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2857676	2863090	5050588		Bacillus_phage(33.33%)	4	NA	NA
WP_001238853.1|2857676_2859698_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	1.9e-112
WP_001314257.1|2859744_2861229_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|2861364_2862630_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2862760_2863090_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 203
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2867132	2873276	5050588		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866674.1|2867132_2868263_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	2.3e-27
WP_000006614.1|2868259_2869522_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	7.7e-24
WP_001226621.1|2869521_2870589_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.8e-102
WP_000676056.1|2870607_2871489_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145189.1|2871466_2872141_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612051.1|2872145_2873276_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 204
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2881350	2883006	5050588		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395836.1|2881350_2883006_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 205
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2891129	2892446	5050588		Salmonella_phage(100.0%)	1	NA	NA
WP_001014285.1|2891129_2892446_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	49.1	3.5e-11
>prophage 206
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2895865	2899724	5050588		Bacillus_phage(100.0%)	3	NA	NA
WP_000130676.1|2895865_2896762_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213586.1|2896761_2897478_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|2897561_2899724_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 207
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2907094	2908924	5050588		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2907094_2908924_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 208
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2919383	2920892	5050588		Vibrio_phage(100.0%)	1	NA	NA
WP_000037973.1|2919383_2920892_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 209
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2942887	2946174	5050588		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|2942887_2944528_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|2944606_2944876_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459600.1|2944879_2945395_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109949.1|2945397_2946174_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 210
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2955055	2955670	5050588		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|2955055_2955670_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 211
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2969359	2972146	5050588		uncultured_virus(100.0%)	1	NA	NA
WP_000250046.1|2969359_2972146_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 212
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2976172	2978643	5050588		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001315107.1|2976172_2977582_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190574.1|2977593_2978643_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
>prophage 213
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2982528	2987258	5050588		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|2982528_2983317_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_001363089.1|2983356_2984253_-	sugar kinase	NA	NA	NA	NA	NA
WP_000190782.1|2984424_2985303_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.0e-47
WP_000094544.1|2985327_2986215_+	aldolase	NA	NA	NA	NA	NA
WP_000357981.1|2986247_2987258_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 214
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	2999854	3002905	5050588		Escherichia_phage(100.0%)	1	NA	NA
WP_012579028.1|2999854_3002905_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 215
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3014008	3018869	5050588		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001350871.1|3014008_3014629_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	2.4e-63
WP_016233703.1|3014888_3015872_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270237.1|3016020_3016695_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3016800_3018174_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|3018170_3018869_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 216
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3030479	3034982	5050588		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3030479_3031325_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3031749_3031995_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3032079_3032565_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|3032657_3033584_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3033650_3034982_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 217
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3048192	3052786	5050588		Pandoravirus(100.0%)	3	NA	NA
WP_000859437.1|3048192_3049743_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	3.4e-05
WP_000105536.1|3049975_3051100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694069.1|3051232_3052786_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	7.8e-10
>prophage 218
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3059599	3066846	5050588		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424854.1|3059599_3060262_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
WP_001185153.1|3060273_3062775_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004469.1|3063083_3064163_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3064177_3064498_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184865.1|3064548_3066846_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 219
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3078990	3080205	5050588		Oenococcus_phage(100.0%)	1	NA	NA
WP_000691040.1|3078990_3080205_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	27.9	3.8e-44
>prophage 220
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3085516	3091299	5050588	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_000125464.1|3085516_3086833_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	1.6e-59
WP_122083113.1|3086936_3087587_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806411.1|3087586_3087946_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000187001.1|3087985_3089086_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000591379.1|3089454_3091299_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
>prophage 221
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3099640	3102693	5050588		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3099640_3100591_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3101508_3102693_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 222
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3106688	3115017	5050588		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3106688_3110717_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653952.1|3110793_3115017_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
>prophage 223
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3123311	3125075	5050588		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3123311_3123983_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|3124025_3124616_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3124802_3125075_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 224
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3130437	3132027	5050588		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187584.1|3130437_3132027_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 225
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3145724	3149408	5050588		Dickeya_phage(100.0%)	1	NA	NA
WP_000096034.1|3145724_3149408_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 226
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3173749	3174865	5050588		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3173749_3174865_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 227
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3182305	3182914	5050588		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3182305_3182914_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 228
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3195209	3199332	5050588		Escherichia_phage(25.0%)	4	NA	NA
WP_001296639.1|3195209_3196625_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
WP_001147328.1|3196677_3197757_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000122235.1|3197779_3198337_+	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	28.8	1.7e-15
WP_001331852.1|3198333_3199332_+	AAA family ATPase	NA	K4F711	Cronobacter_phage	30.7	7.0e-28
>prophage 229
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3204731	3206150	5050588		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000103922.1|3204731_3206150_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.6e-38
>prophage 230
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3216093	3219706	5050588		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357763.1|3216093_3218916_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
WP_000168305.1|3219169_3219706_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 231
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3223523	3224873	5050588		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|3223523_3224873_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 232
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3231079	3233038	5050588		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078225.1|3231079_3233038_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	2.5e-90
>prophage 233
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3242408	3243936	5050588		Bacillus_virus(50.0%)	2	NA	NA
WP_000156933.1|3242408_3243113_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	4.6e-18
WP_000132446.1|3243099_3243936_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
>prophage 234
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3247853	3250001	5050588		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|3247853_3250001_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 235
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3255245	3261616	5050588		Tetraselmis_virus(50.0%)	4	NA	NA
WP_001363000.1|3255245_3257231_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	3.8e-150
WP_001171671.1|3257505_3258435_-	allose kinase	NA	NA	NA	NA	NA
WP_001314355.1|3258418_3259114_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000235242.1|3260083_3261616_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	4.4e-13
>prophage 236
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3267731	3269281	5050588		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611410.1|3267731_3268412_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001075531.1|3268522_3269281_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
>prophage 237
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3274885	3275674	5050588		Pithovirus(100.0%)	1	NA	NA
WP_001193413.1|3274885_3275674_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.9e-12
>prophage 238
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3280514	3282017	5050588		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|3280514_3282017_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 239
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3301580	3304792	5050588	tRNA	Catovirus(50.0%)	2	NA	NA
WP_000003806.1|3301580_3303098_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856826.1|3303334_3304792_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
>prophage 240
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3313127	3315490	5050588		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692347.1|3313127_3313349_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
WP_001186193.1|3313435_3313912_-	RadC family protein	NA	NA	NA	NA	NA
WP_000706978.1|3313926_3314406_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	1.2e-12
WP_001175155.1|3314671_3315490_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	2.5e-47
>prophage 241
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3326993	3330575	5050588		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001001003.1|3326993_3328145_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.2	1.3e-107
WP_000494233.1|3328273_3329329_-	response regulator	NA	NA	NA	NA	NA
WP_000792585.1|3329345_3330575_-	PocR ligand-binding domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	30.3	5.6e-19
>prophage 242
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3337400	3337976	5050588		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000722279.1|3337400_3337976_-	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.8	1.5e-14
>prophage 243
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3372778	3374044	5050588	integrase	Enterobacteria_phage(100.0%)	1	3360749:3360762	3375695:3375708
3360749:3360762	attL	AATTACCGTCTTTG	NA	NA	NA	NA
WP_001218869.1|3372778_3374044_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|3372778_3374044_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
3375695:3375708	attR	CAAAGACGGTAATT	NA	NA	NA	NA
>prophage 244
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3382378	3384362	5050588		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3382378_3382672_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3382715_3384362_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 245
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3388566	3389100	5050588		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|3388566_3389100_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 246
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3394020	3394998	5050588		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3394020_3394998_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 247
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3402994	3403540	5050588		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3402994_3403540_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 248
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3407455	3420486	5050588	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990304.1|3407455_3408793_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	3.3e-17
WP_001298688.1|3408802_3410650_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_001280359.1|3410642_3411593_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3411678_3411987_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460357.1|3412062_3413343_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312482.1|3413428_3414688_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3414690_3415695_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3415776_3415974_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3416077_3417376_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3417580_3418006_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076340.1|3418044_3420486_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
>prophage 249
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3424329	3425493	5050588		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944012.1|3424329_3425493_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
>prophage 250
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3467741	3474229	5050588		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|3467741_3468272_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265925.1|3468581_3469538_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205834.1|3469677_3471180_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	6.2e-12
WP_001298067.1|3471193_3472216_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595996.1|3472202_3473198_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3473230_3474229_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 251
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3478547	3481308	5050588		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106233.1|3478547_3479012_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187799.1|3479169_3481308_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 252
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3484946	3491043	5050588		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|3484946_3485894_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3486078_3486132_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471858.1|3486272_3488969_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	1.5e-45
WP_000047539.1|3489174_3489561_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3489633_3490095_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3490107_3491043_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 253
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3501389	3510569	5050588	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416385.1|3501389_3504245_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|3504244_3504688_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3504945_3506457_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3506723_3507824_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001331766.1|3507823_3508906_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294566.1|3509066_3510569_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.1e-82
>prophage 254
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3515698	3516718	5050588		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000061766.1|3515698_3516718_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
>prophage 255
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3519985	3520897	5050588		Caulobacter_phage(100.0%)	1	NA	NA
WP_001082109.1|3519985_3520897_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.6	5.5e-48
>prophage 256
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3524576	3528836	5050588		Escherichia_phage(50.0%)	2	NA	NA
WP_000236931.1|3524576_3527546_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	32.9	7.3e-81
WP_000643690.1|3527639_3528836_-	DNA cytosine methyltransferase	NA	A0A191SAU1	Nostoc_phage	30.8	2.2e-36
>prophage 257
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3541286	3545105	5050588	transposase	Enterobacteria_phage(100.0%)	5	NA	NA
WP_000416151.1|3541286_3542318_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|3542588_3543032_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|3543047_3543335_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|3543347_3544604_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|3544850_3545105_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
>prophage 258
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3552665	3554824	5050588	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_031935995.1|3552665_3554060_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.2	1.2e-256
WP_000612632.1|3554099_3554447_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_001171523.1|3554443_3554824_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 259
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3566064	3568465	5050588		Yersinia_phage(33.33%)	4	NA	NA
WP_001234738.1|3566064_3566883_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_000855061.1|3567224_3567689_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.0	1.2e-14
WP_001557203.1|3567704_3568181_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|3568243_3568465_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 260
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3574977	3576168	5050588		Bacillus_phage(100.0%)	1	NA	NA
WP_001295727.1|3574977_3576168_+	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
>prophage 261
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3579308	3581384	5050588		Acidithiobacillus_phage(100.0%)	1	NA	NA
WP_000366620.1|3579308_3581384_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	33.8	7.7e-37
>prophage 262
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3605027	3606008	5050588		Escherichia_phage(100.0%)	1	NA	NA
WP_000991462.1|3605027_3606008_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
>prophage 263
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3609367	3611044	5050588		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|3609367_3609970_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|3610447_3611044_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 264
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3621247	3622708	5050588		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|3621247_3622708_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 265
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3630052	3630607	5050588		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|3630052_3630607_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 266
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3643192	3648555	5050588		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000919544.1|3643192_3644857_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000091572.1|3646479_3647394_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106037.1|3647532_3648555_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 267
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3651779	3653059	5050588		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3651779_3652517_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|3652519_3653059_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 268
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3660885	3663761	5050588		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|3660885_3662475_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3662867_3663473_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3663599_3663761_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 269
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3669739	3671062	5050588		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3669739_3671062_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 270
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3677804	3683159	5050588		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093807.1|3677804_3679037_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|3679343_3681011_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409455.1|3681221_3683159_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 271
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3686442	3688556	5050588		Bacillus_phage(50.0%)	2	NA	NA
WP_001188687.1|3686442_3687132_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219586.1|3687131_3688556_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	1.1e-10
>prophage 272
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3700211	3701165	5050588		Cyanophage(100.0%)	1	NA	NA
WP_000130187.1|3700211_3701165_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 273
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3704301	3718822	5050588	tRNA	Chrysochromulina_ericina_virus(16.67%)	12	NA	NA
WP_000516135.1|3704301_3706218_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3706306_3707437_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|3707541_3707751_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001274823.1|3708305_3709067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350775.1|3709086_3710580_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	2.8e-28
WP_000494924.1|3710708_3711968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681386.1|3712202_3713369_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.8	3.0e-91
WP_000062878.1|3713428_3714334_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001274021.1|3714429_3714693_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001337277.1|3714795_3715014_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_000767329.1|3715021_3715963_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001286813.1|3716005_3718822_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	25.7	4.6e-77
>prophage 274
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3723630	3724779	5050588		Halovirus(100.0%)	1	NA	NA
WP_001295757.1|3723630_3724779_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 275
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3728241	3736652	5050588	transposase	Saccharomonospora_phage(33.33%)	8	NA	NA
WP_000526115.1|3728241_3728700_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000333104.1|3728989_3729385_+	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_032153352.1|3729503_3730094_-	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_000004399.1|3730099_3730885_-	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001350362.1|3730993_3732547_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.9e-35
WP_000349942.1|3732619_3733837_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3733964_3735107_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|3735137_3736652_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 276
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3744546	3746508	5050588		Bacillus_phage(50.0%)	5	NA	NA
WP_000624375.1|3744546_3745026_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|3745111_3745345_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_001332330.1|3745347_3745470_+	CcdB family protein	NA	NA	NA	NA	NA
WP_146692624.1|3745510_3745663_+	CcdB family protein	NA	NA	NA	NA	NA
WP_000257201.1|3745659_3746508_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 277
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3754285	3759707	5050588		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|3754285_3757192_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035622.1|3757355_3759707_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	6.7e-37
>prophage 278
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3767983	3768682	5050588		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916269.1|3767983_3768682_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-21
>prophage 279
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3780160	3781885	5050588		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425644.1|3780160_3781885_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 280
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3807855	3808899	5050588		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3807855_3808899_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 281
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3813145	3813697	5050588		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923703.1|3813145_3813697_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 282
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3826111	3827536	5050588		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3826111_3827536_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 283
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3835356	3841824	5050588		Mamastrovirus(33.33%)	5	NA	NA
WP_001189635.1|3835356_3836907_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.1e-18
WP_001332319.1|3836953_3839344_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3839549_3840086_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651600.1|3840126_3840789_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|3840897_3841824_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 284
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3845086	3845971	5050588		Sodalis_phage(100.0%)	1	NA	NA
WP_000339931.1|3845086_3845971_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	48.4	1.0e-59
>prophage 285
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3855862	3862668	5050588	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|3855862_3857281_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937401.1|3857319_3858246_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3858282_3858738_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396047.1|3858915_3859620_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294708.1|3859634_3860165_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001362943.1|3860238_3862668_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	1.0e-40
>prophage 286
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3867809	3868607	5050588		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3867809_3868607_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 287
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3874518	3874863	5050588		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3874518_3874863_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 288
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3878792	3880217	5050588	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753936.1|3878792_3880217_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 289
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3891794	3892553	5050588		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|3891794_3892553_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 290
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3901381	3905497	5050588		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569434.1|3901381_3901978_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294798.1|3902014_3905497_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
>prophage 291
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3918456	3919488	5050588		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3918456_3919488_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 292
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3926013	3933865	5050588		Indivirus(25.0%)	9	NA	NA
WP_000997016.1|3926013_3926817_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
WP_000648548.1|3926813_3927728_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3927968_3928769_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211705.1|3928846_3929617_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3929663_3931022_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052741.1|3931093_3931849_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|3931882_3932605_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3932601_3933069_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|3933133_3933865_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 293
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	3943127	3992894	5050588	plate,transposase	Enterobacteria_phage(27.27%)	45	NA	NA
WP_000614314.1|3943127_3945887_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	4.7e-82
WP_001282178.1|3945896_3946661_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000224515.1|3946665_3948012_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013423.1|3948014_3948539_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433564.1|3948535_3949828_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896714.1|3949832_3950882_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863402.1|3950845_3952687_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000946068.1|3952692_3953118_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|3953122_3954607_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|3954629_3955133_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|3955838_3956357_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000053636.1|3956577_3958560_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-26
WP_000571853.1|3958666_3959713_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528852.1|3959705_3961145_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|3961119_3961410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227712.1|3962660_3963164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|3963257_3963746_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|3964016_3964787_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|3964940_3965414_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973137.1|3965456_3967901_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|3968140_3968719_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001331866.1|3968923_3969691_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3969661_3970402_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|3970713_3971463_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_000006241.1|3971638_3972136_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_014639450.1|3972218_3972377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331867.1|3972455_3974195_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207544.1|3974139_3974925_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|3974995_3976051_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|3976102_3976396_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|3976398_3976797_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|3976806_3977259_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001331869.1|3977436_3978588_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
WP_000602123.1|3978584_3979199_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|3979255_3980713_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291988.1|3980973_3981432_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189577.1|3981523_3982768_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|3982825_3983227_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749902.1|3983336_3984392_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|3984680_3985784_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|3985795_3987049_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
WP_000772638.1|3987393_3987732_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	49.5	4.3e-22
WP_001298126.1|3988166_3988691_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000952372.1|3990924_3992097_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|3992096_3992894_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
>prophage 294
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4013365	4014217	5050588		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|4013365_4014217_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 295
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4020262	4023567	5050588		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001295799.1|4020262_4021132_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_001298546.1|4021291_4021885_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474088.1|4021896_4022133_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046332.1|4022241_4023567_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
>prophage 296
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4033492	4041064	5050588	integrase,holin	Escherichia_phage(33.33%)	5	4032209:4032222	4035206:4035219
4032209:4032222	attL	AACGCATCCTTCCC	NA	NA	NA	NA
WP_001295805.1|4033492_4034056_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001159135.1|4035126_4036815_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
4035206:4035219	attR	AACGCATCCTTCCC	NA	NA	NA	NA
WP_001350625.1|4036828_4038301_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001314510.1|4038314_4038902_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131041.1|4039030_4041064_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 297
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4053803	4058341	5050588		Bacillus_virus(50.0%)	4	NA	NA
WP_000447331.1|4053803_4055288_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818902.1|4055280_4056252_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750346.1|4056248_4057205_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692719.1|4057291_4058341_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.8e-71
>prophage 298
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4065872	4067759	5050588		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010273.1|4065872_4067759_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	1.8e-53
>prophage 299
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4072718	4080000	5050588		Herpes_simplex_virus(33.33%)	5	NA	NA
WP_000177872.1|4072718_4075793_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.5	0.0e+00
WP_000805859.1|4075915_4076998_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	2.4e-191
WP_001096705.1|4077199_4077739_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000419070.1|4077964_4078798_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842109.1|4078890_4080000_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 300
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4085292	4086060	5050588		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939359.1|4085292_4086060_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 301
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4092968	4094126	5050588		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830766.1|4092968_4094126_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 302
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4101541	4102657	5050588		Bacillus_phage(100.0%)	1	NA	NA
WP_000484068.1|4101541_4102657_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 303
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4106946	4117044	5050588		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4106946_4107858_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219315.1|4107982_4108891_+	fructokinase	NA	NA	NA	NA	NA
WP_001331503.1|4109159_4110344_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698877.1|4110469_4113613_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221279.1|4113609_4114812_-	exonuclease subunit SbcD	NA	L0LAJ8	Bacillus_phage	25.1	9.1e-06
WP_000113932.1|4115001_4115691_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	1.5e-37
WP_000893603.1|4115748_4117044_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 304
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4124121	4132963	5050588	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4124121_4125249_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4125271_4125604_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934823.1|4125631_4127479_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4127489_4128461_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_001317658.1|4128590_4128938_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_071686815.1|4128975_4129860_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001298536.1|4130157_4130697_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4130847_4131297_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150487.1|4131300_4132404_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.7e-54
WP_001350619.1|4132492_4132963_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 305
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4154405	4159452	5050588	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4154405_4155029_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4155154_4156429_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4156616_4158971_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4159179_4159452_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 306
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4162592	4163288	5050588		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|4162592_4163288_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 307
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4166611	4170158	5050588		Bacillus_phage(100.0%)	2	NA	NA
WP_001235600.1|4166611_4168384_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.4e-50
WP_001256184.1|4168376_4170158_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	2.0e-41
>prophage 308
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4178995	4182145	5050588		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4178995_4182145_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 309
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4189153	4197611	5050588		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4189153_4189705_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122015.1|4189833_4191765_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4191817_4192147_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4192146_4192752_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678211.1|4192861_4194736_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.4e-117
WP_001331495.1|4194916_4195561_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250114.1|4195692_4196655_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801795.1|4196651_4197611_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	5.0e-15
>prophage 310
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4207173	4210415	5050588		Escherichia_phage(66.67%)	3	NA	NA
WP_000057524.1|4207173_4207476_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	2.2e-41
WP_000806442.1|4207511_4207853_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083945.1|4207910_4210415_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.0e-115
>prophage 311
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4217513	4218191	5050588		Bacillus_virus(100.0%)	1	NA	NA
WP_001157551.1|4217513_4218191_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 312
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4221327	4222014	5050588		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110564.1|4221327_4222014_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.9e-32
>prophage 313
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4236239	4237385	5050588		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331490.1|4236239_4237385_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 314
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4249239	4253715	5050588	tRNA,tail	Moumouvirus(33.33%)	5	NA	NA
WP_000912345.1|4249239_4250625_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143516.1|4250660_4251182_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4251289_4251502_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4251503_4252370_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001331487.1|4253358_4253715_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	67.5	3.8e-53
>prophage 315
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4262518	4264634	5050588		Hokovirus(50.0%)	2	NA	NA
WP_000253820.1|4262518_4263961_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	1.7e-11
WP_000770953.1|4263950_4264634_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 316
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4267779	4270923	5050588		Leptospira_phage(100.0%)	1	NA	NA
WP_000573983.1|4267779_4270923_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.3e-59
>prophage 317
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4281875	4287918	5050588		Tupanvirus(50.0%)	3	NA	NA
WP_000077765.1|4281875_4285757_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	1.7e-61
WP_000096768.1|4285972_4287106_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140634.1|4287102_4287918_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
>prophage 318
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4302220	4304043	5050588		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502940.1|4302220_4302850_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_000029771.1|4302822_4304043_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	2.7e-58
>prophage 319
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4307148	4309263	5050588		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4307148_4308714_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_001308472.1|4308834_4309263_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
>prophage 320
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4323351	4323998	5050588		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4323351_4323561_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4323614_4323998_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 321
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4328213	4330653	5050588		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4328213_4329425_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231442.1|4329564_4330653_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 322
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4337663	4342786	5050588	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001362899.1|4337663_4340246_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	8.9e-184
WP_001044880.1|4340480_4340963_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207539.1|4341007_4341943_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631389.1|4342060_4342786_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 323
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4350733	4351774	5050588		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|4350733_4351774_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 324
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4355912	4357577	5050588		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4355912_4357577_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 325
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4362202	4364149	5050588		Vibrio_phage(100.0%)	1	NA	NA
WP_001023115.1|4362202_4364149_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 326
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4372447	4375093	5050588	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_000679501.1|4372447_4373209_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
WP_001287134.1|4373428_4375093_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 327
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4379245	4380010	5050588		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773263.1|4379245_4380010_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	7.5e-06
>prophage 328
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4386665	4398498	5050588		Hokovirus(40.0%)	10	NA	NA
WP_000186082.1|4386665_4387343_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001350605.1|4387339_4390024_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_001331974.1|4390016_4390589_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087931.1|4390597_4392646_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	7.9e-26
WP_000730081.1|4392668_4394342_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4394341_4394431_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424788.1|4394743_4394950_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001075783.1|4395050_4395560_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000207170.1|4395556_4396975_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	4.7e-62
WP_001032722.1|4397016_4398498_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
>prophage 329
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4401876	4402668	5050588		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114008.1|4401876_4402668_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.4	3.7e-08
>prophage 330
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4430203	4433723	5050588		Vibrio_phage(33.33%)	4	NA	NA
WP_000345406.1|4430203_4430923_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_000951260.1|4430919_4431861_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.7e-23
WP_000784341.1|4431974_4432355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109195.1|4432670_4433723_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
>prophage 331
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4438086	4444662	5050588		Tupanvirus(33.33%)	7	NA	NA
WP_001265445.1|4438086_4439103_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	8.0e-80
WP_000096843.1|4439365_4440838_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	1.6e-12
WP_001147445.1|4440905_4441694_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4441822_4441972_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113014.1|4442138_4442912_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604040.1|4442911_4443601_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891671.1|4443603_4444662_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	9.7e-20
>prophage 332
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4454922	4456212	5050588		Klosneuvirus(100.0%)	1	NA	NA
WP_001362906.1|4454922_4456212_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 333
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4462539	4463448	5050588		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331964.1|4462539_4463448_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	3.7e-28
>prophage 334
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4474046	4479035	5050588		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_001596675.1|4474046_4475783_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000976402.1|4475775_4476774_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001295890.1|4476773_4477445_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007119.1|4477673_4479035_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
>prophage 335
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4484689	4485707	5050588		Salmonella_phage(50.0%)	2	NA	NA
WP_000146357.1|4484689_4484956_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990167.1|4485029_4485707_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	6.9e-19
>prophage 336
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4492270	4497495	5050588		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4492270_4492993_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4492989_4493649_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4493787_4494534_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4494937_4495441_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4495739_4496627_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_122083111.1|4496861_4496927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295296.1|4496979_4497495_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 337
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4502492	4509376	5050588		Tupanvirus(33.33%)	5	NA	NA
WP_000961458.1|4502492_4504085_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000114251.1|4504284_4505100_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209353.1|4505245_4507678_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000576970.1|4507683_4508583_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001350598.1|4508713_4509376_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
>prophage 338
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4512591	4514463	5050588		Planktothrix_phage(100.0%)	1	NA	NA
WP_001350597.1|4512591_4514463_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 339
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4525797	4527000	5050588		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001467835.1|4525797_4527000_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.4e-99
>prophage 340
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4535547	4544696	5050588		Vibrio_phage(25.0%)	11	NA	NA
WP_001195230.1|4535547_4535805_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_001201575.1|4535964_4536252_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|4536235_4536958_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4537018_4537921_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4538008_4538485_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|4538834_4539947_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|4540041_4541175_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105433.1|4541184_4542138_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061669.1|4542134_4542980_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4543039_4543528_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149763.1|4543568_4544696_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
>prophage 341
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4547821	4550559	5050588		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|4547821_4548550_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001298306.1|4548767_4549283_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4549408_4549732_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255187.1|4549728_4550559_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
>prophage 342
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4554146	4555865	5050588		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815373.1|4554146_4555865_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
>prophage 343
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4564988	4598323	5050588	protease,tRNA	Vibrio_phage(20.0%)	21	NA	NA
WP_000188147.1|4564988_4566935_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4567007_4567232_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4567554_4567875_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4567905_4570182_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|4571074_4572058_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|4572054_4575288_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000415806.1|4575617_4576925_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001029748.1|4577855_4578857_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000350182.1|4578867_4579422_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001040187.1|4580463_4580682_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|4580966_4581671_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202198.1|4581712_4583434_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043638.1|4583434_4585201_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_000537432.1|4585323_4586289_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|4586832_4587327_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077107.1|4587461_4591505_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4591663_4592275_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|4592285_4593629_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4593719_4595012_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850286.1|4595250_4597695_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	7.8e-222
WP_000213098.1|4597705_4598323_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 344
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4601408	4604623	5050588		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|4601408_4602149_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|4602340_4604623_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 345
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4608721	4609810	5050588		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057124.1|4608721_4609810_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	9.2e-82
>prophage 346
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4614897	4619437	5050588		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|4614897_4615182_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705727.1|4615387_4617652_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|4617688_4619437_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 347
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4634142	4645091	5050588	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|4634142_4634691_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109453.1|4634717_4635365_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|4635414_4636605_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977927.1|4636789_4637878_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
WP_000117881.1|4638479_4639880_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001298298.1|4640048_4641251_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193873.1|4641516_4644129_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	1.2e-18
WP_001090487.1|4644323_4645091_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
>prophage 348
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4653846	4655754	5050588		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|4653846_4655754_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 349
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4668354	4670409	5050588		Bacillus_phage(100.0%)	1	NA	NA
WP_001350178.1|4668354_4670409_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 350
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4674643	4675303	5050588	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4674643_4675303_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 351
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4686297	4698815	5050588		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|4686297_4686510_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|4686520_4686709_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|4686683_4686914_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|4686903_4687077_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818464.1|4687125_4688199_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054739.1|4688281_4691014_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	5.4e-38
WP_001264953.1|4691096_4692125_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|4692097_4692790_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|4692919_4694092_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063164.1|4694091_4696638_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_000210216.1|4696634_4697234_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024569.1|4697589_4697895_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|4697894_4698815_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 352
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4701845	4703839	5050588		Enterobacteria_phage(100.0%)	2	NA	NA
WP_001273658.1|4701845_4702019_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001028100.1|4703344_4703839_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	9.3e-50
>prophage 353
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4718434	4719223	5050588		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533536.1|4718434_4719223_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
>prophage 354
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4726043	4727411	5050588		Bacillus_phage(100.0%)	1	NA	NA
WP_000409834.1|4726043_4727411_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	9.6e-20
>prophage 355
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4730802	4731636	5050588		Pelagibacter_phage(100.0%)	1	NA	NA
WP_032153366.1|4730802_4731636_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 356
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4745610	4746531	5050588		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|4745610_4746531_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 357
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4751193	4751439	5050588		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4751193_4751439_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 358
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4767319	4768261	5050588		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001331933.1|4767319_4768261_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	4.7e-10
>prophage 359
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4780617	4781799	5050588		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|4780617_4781352_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|4781562_4781799_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 360
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4785070	4786713	5050588		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257012.1|4785070_4785712_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.4	3.8e-27
WP_001267963.1|4785708_4786713_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 361
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4799035	4799293	5050588		Erwinia_phage(100.0%)	1	NA	NA
WP_000800132.1|4799035_4799293_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 362
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4806582	4810305	5050588		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|4806582_4807284_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251360.1|4807283_4808528_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291301.1|4808556_4809468_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952746.1|4809483_4810305_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 363
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4813580	4815558	5050588		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|4813580_4814438_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531578.1|4814421_4815558_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 364
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4820579	4875378	5050588	portal,integrase,capsid,head,protease,tail,lysis,tRNA,terminase	Enterobacteria_phage(50.82%)	77	4815266:4815281	4875627:4875642
4815266:4815281	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_000423737.1|4820579_4821950_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_001295971.1|4821953_4822595_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001298466.1|4822630_4823737_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4823790_4824252_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|4824261_4824915_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4825086_4826337_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|4826450_4827593_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|4827582_4827819_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|4827958_4828198_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|4828181_4828508_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|4828507_4828729_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|4829115_4829307_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|4829279_4829462_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|4829458_4830139_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|4830135_4830921_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|4830926_4831223_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|4831298_4831442_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|4831410_4831575_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|4831647_4832016_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|4832198_4832399_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|4832612_4833194_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|4833210_4833483_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|4833460_4833643_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|4833919_4834672_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|4834668_4835226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|4835265_4835961_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|4836036_4836252_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|4836393_4836690_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|4836722_4837622_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|4837618_4838320_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|4838316_4838607_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|4838680_4839121_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|4839117_4839645_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|4839641_4839818_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|4839820_4840162_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099712.1|4840368_4840731_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|4840727_4840868_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|4840953_4841337_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|4841525_4842608_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|4843196_4843412_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|4843411_4843909_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|4844125_4844308_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|4844398_4844692_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|4845172_4845499_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|4845705_4845888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867574.1|4846450_4846999_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_021573274.1|4846970_4848899_+|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	66.8	2.2e-259
WP_000258997.1|4848882_4849089_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|4849085_4850678_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001588554.1|4850667_4852173_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
WP_000256840.1|4852209_4852557_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|4852614_4853643_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|4853694_4854069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|4854061_4854415_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|4854426_4855005_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|4855001_4855397_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001351266.1|4855404_4856145_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|4856160_4856583_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459475.1|4856564_4856999_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.8	1.4e-57
WP_032153373.1|4856991_4859553_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.2	0.0e+00
WP_000847402.1|4859549_4859879_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152660.1|4859878_4860577_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|4860582_4861326_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|4861262_4861895_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515327.1|4861955_4865438_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000290543.1|4865496_4867557_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|4867553_4867832_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000355360.1|4867844_4868138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001596715.1|4868229_4869087_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101730.1|4869083_4869941_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983716.1|4869937_4870765_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	29.0	1.9e-07
WP_000555630.1|4870764_4871679_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001304451.1|4872377_4873136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|4873607_4873760_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001445545.1|4873843_4873969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373104.1|4874021_4874426_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332310.1|4874646_4875378_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	9.3e-54
4875627:4875642	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 365
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4889613	4891301	5050588		Morganella_phage(50.0%)	2	NA	NA
WP_000897380.1|4889613_4890033_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	2.6e-37
WP_000457594.1|4890032_4891301_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.0	5.3e-206
>prophage 366
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4907329	4908088	5050588		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173308.1|4907329_4908088_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-14
>prophage 367
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4920535	4923287	5050588		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033349.1|4920535_4922215_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
WP_001298109.1|4922339_4923287_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 368
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4926423	4932692	5050588		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000804726.1|4926423_4927506_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456474.1|4927505_4928339_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200375.1|4928335_4928728_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257054.1|4928731_4929541_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|4929576_4930431_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170954.1|4930578_4930686_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001313768.1|4931091_4932192_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|4932461_4932692_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 369
NZ_CP051735	Escherichia coli strain SCU-108 chromosome, complete genome	5050588	4943823	5049737	5050588	portal,integrase,capsid,head,holin,tail,lysis,terminase,transposase	Escherichia_phage(42.39%)	136	4991637:4991667	5043329:5043359
WP_000702647.1|4943823_4945362_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
WP_000571681.1|4945358_4946069_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4946068_4946746_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_001111620.1|4946798_4947998_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|4948790_4949633_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|4949682_4950141_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|4950253_4951159_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|4951250_4952264_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000719002.1|4952465_4953374_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	6.3e-60
WP_001287378.1|4953517_4953931_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|4954534_4955152_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|4956609_4959285_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|4959761_4960409_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001362935.1|4960435_4960591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297114.1|4961146_4962778_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|4962863_4963784_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|4963798_4964707_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|4964718_4965732_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|4965728_4966733_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|4966785_4967115_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|4967149_4968610_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|4968752_4968926_+	YciY family protein	NA	NA	NA	NA	NA
WP_001313775.1|4968980_4970234_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_032153388.1|4970533_4970830_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|4971053_4971770_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|4971809_4972208_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808672.1|4972313_4972853_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|4972882_4973626_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|4973981_4974620_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|4974665_4975796_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|4975773_4976022_-	excisionase	NA	NA	NA	NA	NA
WP_169059427.1|4976086_4978558_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090203.1|4978650_4978842_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4978838_4979027_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|4979427_4979592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|4979592_4979814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|4979973_4980129_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|4980421_4980760_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|4981151_4981394_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|4981377_4981803_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|4981874_4982945_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151216.1|4982985_4983408_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_014639476.1|4983599_4984562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|4984577_4985579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|4985987_4986095_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000813256.1|4986196_4986352_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_011478175.1|4986519_4986798_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|4986799_4987846_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|4987858_4988233_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|4988229_4989051_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|4989275_4989473_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935515.1|4989623_4990673_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
4991637:4991667	attL	CTGAACTCACCGGGAGGCACCCGGCACCATG	NA	NA	NA	NA
WP_001331709.1|4991947_4992175_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|4992443_4992659_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|4992663_4993008_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|4992973_4993246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992052.1|4993351_4993885_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
WP_001082537.1|4994183_4994648_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|4994955_4995366_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|4995423_4995657_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867574.1|4996043_4996592_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000622379.1|4996563_4998492_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000259002.1|4998475_4998682_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|4998678_5000271_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_001253958.1|5000260_5001766_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000256823.1|5001802_5002150_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|5002207_5003236_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_169059428.1|5003287_5003671_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|5003663_5004017_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|5004032_5004566_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|5004562_5004958_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|5004965_5005718_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|5005731_5006163_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|5006189_5006603_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|5006583_5009157_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847402.1|5009153_5009483_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152522.1|5009482_5010181_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|5010185_5010929_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|5010865_5011468_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|5011541_5011880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515773.1|5011946_5015426_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001233195.1|5015493_5016093_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216497.1|5016244_5019352_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_000885580.1|5019351_5019936_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240999.1|5019990_5020659_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|5020715_5020985_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|5021099_5021270_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000113674.1|5021744_5022875_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|5022852_5023101_-	excisionase	NA	NA	NA	NA	NA
WP_000048416.1|5023165_5025637_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090203.1|5025729_5025921_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|5025917_5026106_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001351093.1|5026506_5026944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394526.1|5026921_5027242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071686822.1|5027264_5027483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|5027642_5027798_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|5028051_5028513_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_001053425.1|5028620_5028896_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000702041.1|5028879_5029305_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|5029376_5030417_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|5030328_5030871_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450708.1|5030904_5031675_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	1.5e-86
WP_001141099.1|5031690_5032083_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|5032079_5032376_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|5032372_5032834_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403780.1|5032811_5033111_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.3e-50
WP_001224665.1|5033263_5033446_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000753053.1|5033438_5033615_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001289989.1|5033611_5033971_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000510387.1|5033971_5034187_+	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001142588.1|5034188_5034407_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000224216.1|5034408_5034672_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_000207997.1|5034682_5034850_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000206826.1|5034846_5035191_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000967408.1|5035425_5035638_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001004956.1|5035803_5036454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|5036434_5037538_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687431.1|5037695_5037869_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001403449.1|5037928_5038201_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|5038202_5039249_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_000904114.1|5039261_5039636_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|5039632_5040454_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917768.1|5040680_5040878_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_000935524.1|5041028_5042087_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.9	5.2e-207
WP_001304604.1|5042550_5042982_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.1	8.1e-66
WP_000216690.1|5042978_5043143_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
WP_000874510.1|5044110_5046072_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	3.3e-239
5043329:5043359	attR	CTGAACTCACCGGGAGGCACCCGGCACCATG	NA	NA	NA	NA
WP_001304601.1|5046207_5046390_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_001304600.1|5046427_5046673_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284510.1|5046749_5046965_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731249.1|5046969_5047320_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	93.0	4.0e-55
WP_000992075.1|5047383_5047917_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
WP_001082534.1|5048215_5048710_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.7	1.1e-74
WP_000736383.1|5048706_5048931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304598.1|5049129_5049330_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829186.1|5049371_5049737_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	1.7e-61
>prophage 1
NZ_CP051736	Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence	116897	0	1961	116897	integrase	Macacine_betaherpesvirus(100.0%)	1	1106:1119	2201:2214
1106:1119	attL	ATCTGCCTGTTCCT	NA	NA	NA	NA
WP_001066947.1|1220_1961_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001066947.1|1220_1961_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
2201:2214	attR	AGGAACAGGCAGAT	NA	NA	NA	NA
>prophage 2
NZ_CP051736	Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence	116897	9674	15314	116897	transposase	Escherichia_phage(40.0%)	5	NA	NA
WP_001323403.1|9674_10454_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|10453_11476_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|12555_12903_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|12899_13304_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|13805_15314_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
>prophage 3
NZ_CP051736	Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence	116897	27549	33980	116897	transposase	Enterobacteria_phage(33.33%)	6	NA	NA
WP_000065240.1|27549_28305_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_000143800.1|28301_29801_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_001189106.1|30909_31398_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
WP_000874189.1|32302_32788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|32812_33298_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|33284_33980_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
>prophage 4
NZ_CP051736	Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence	116897	42425	43130	116897	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067837.1|42425_43130_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	5.8e-138
>prophage 5
NZ_CP051736	Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence	116897	46725	50101	116897		Moraxella_phage(33.33%)	5	NA	NA
WP_001233838.1|46725_47187_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001309245.1|47431_47644_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139321.1|47772_48333_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704523.1|48435_49296_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.9e-10
WP_000205725.1|49354_50101_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
>prophage 6
NZ_CP051736	Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence	116897	75814	76036	116897		Vibrio_virus(100.0%)	1	NA	NA
WP_001278694.1|75814_76036_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
>prophage 7
NZ_CP051736	Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence	116897	84076	94769	116897		Yersinia_phage(20.0%)	13	NA	NA
WP_001234489.1|84076_84898_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	5.7e-44
WP_000107526.1|85016_85304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337416.1|85367_85604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032195784.1|85647_85983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302184.1|86219_86378_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001276230.1|86653_87373_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845910.1|87369_87804_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145501.1|87858_89817_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	7.3e-21
WP_000006018.1|89875_90109_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032145664.1|90165_90651_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.8	1.7e-40
WP_000936285.1|90800_92702_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	3.1e-32
WP_024187070.1|93655_94120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298559.1|94205_94769_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
>prophage 8
NZ_CP051736	Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence	116897	100404	103685	116897	transposase	Enterobacteria_phage(66.67%)	5	NA	NA
WP_000086169.1|100404_101088_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	2.8e-28
WP_001310011.1|101163_101475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298677.1|101471_101675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952372.1|101715_102888_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|102887_103685_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
>prophage 9
NZ_CP051736	Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence	116897	106819	112234	116897	integrase	Escherichia_phage(40.0%)	7	105601:105613	112420:112432
105601:105613	attL	GCCAGTGCCCGCC	NA	NA	NA	NA
WP_000619112.1|106819_107068_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_000109079.1|107064_107502_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
WP_000340835.1|108776_109169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103694.1|109173_110145_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|110373_111018_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|111011_111287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016979.1|111424_112234_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
112420:112432	attR	GGCGGGCACTGGC	NA	NA	NA	NA
