The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	0	43965	4863332	holin,protease,lysis,capsid,portal,tail,terminase,plate,head	Escherichia_phage(45.16%)	48	NA	NA
WP_172636097.1|0_2289_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.6	0.0e+00
WP_172636098.1|2516_4724_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_087891950.1|5199_6234_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	1.2e-200
WP_172636099.1|6233_8006_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_001601069.1|8179_9034_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.0	2.7e-137
WP_052916267.1|9092_10166_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI8	Enterobacteria_phage	99.7	1.9e-201
WP_000203428.1|10169_10913_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_024142328.1|11012_11522_+|head	head completion/stabilization protein	head	Q858W4	Yersinia_virus	99.4	1.5e-90
WP_000846399.1|11521_11725_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|11728_12010_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|12009_12507_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_172636100.1|12521_12947_+	protein lysA	NA	M1SV74	Escherichia_phage	94.3	5.7e-56
WP_172636101.1|12934_13378_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.9	1.3e-66
WP_172636102.1|13467_13935_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	97.4	4.8e-80
WP_001001805.1|13927_14380_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	3.1e-76
WP_172636103.1|14446_15082_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	1.3e-112
WP_010835475.1|15078_15426_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	1.9e-57
WP_001121474.1|15430_16339_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_097339451.1|16331_16862_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.9	8.6e-102
WP_172636104.1|16872_19632_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	77.4	0.0e+00
WP_001164158.1|19635_20163_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.1	2.2e-89
WP_021525935.1|20432_20978_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.4	3.9e-97
WP_172636105.1|21307_22498_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	3.7e-225
WP_001251408.1|22510_23029_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001774111.1|23085_23361_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	6.3e-40
WP_000785970.1|23393_23513_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_172636106.1|23505_25953_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	96.0	0.0e+00
WP_000978907.1|25967_26447_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882969.1|26446_27610_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_000468308.1|27691_27910_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076737.1|28146_29049_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|29229_30192_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|30511_31501_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001366736.1|31607_32363_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|32417_33185_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802214.1|33292_33892_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155251.1|33992_34433_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|34644_34944_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|34970_35399_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796316.1|35403_36150_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|36246_37257_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|37391_38900_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|38922_39768_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|40192_40438_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|40522_41008_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|41100_42027_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|42093_43425_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|43434_43965_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	60657	67904	4863332		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424836.1|60657_61320_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	3.2e-29
WP_001185155.1|61331_63833_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004467.1|64141_65221_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|65235_65556_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184834.1|65606_67904_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 3
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	87616	89461	4863332		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001366808.1|87616_89461_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 4
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	97803	100856	4863332		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023085.1|97803_98754_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
WP_000031784.1|99671_100856_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 5
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	104972	113301	4863332		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|104972_109001_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|109077_113301_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 6
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	122664	124428	4863332		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|122664_123336_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941122.1|123378_123969_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|124155_124428_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 7
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	129796	131386	4863332		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187544.1|129796_131386_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.7e-68
>prophage 8
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	147143	150827	4863332		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|147143_150827_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 9
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	174259	175375	4863332		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|174259_175375_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 10
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	184498	185107	4863332		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|184498_185107_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 11
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	191673	194221	4863332		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|191673_193089_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|193141_194221_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 12
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	198409	202023	4863332		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|198409_201232_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|201486_202023_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 13
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	205838	207188	4863332		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|205838_207188_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 14
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	212798	214757	4863332		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078208.1|212798_214757_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 15
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	224041	226189	4863332		Escherichia_phage(100.0%)	1	NA	NA
WP_077632889.1|224041_226189_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 16
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	231467	233453	4863332		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001366716.1|231467_233453_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	1.9e-149
>prophage 17
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	237450	239000	4863332		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611392.1|237450_238131_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	6.7e-06
WP_001075537.1|238241_239000_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	7.9e-16
>prophage 18
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	244624	245413	4863332		Pithovirus(100.0%)	1	NA	NA
WP_001193403.1|244624_245413_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	3.2e-12
>prophage 19
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	250252	251755	4863332		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|250252_251755_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 20
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	276599	291805	4863332	tRNA	Enterobacteria_phage(50.0%)	8	NA	NA
WP_001045645.1|276599_280442_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	45.3	0.0e+00
WP_001088102.1|281348_282179_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001080130.1|283334_287264_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.1	7.6e-219
WP_000405647.1|287476_287749_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001560287.1|287977_288274_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_001173343.1|288301_288475_+	type V toxin-antitoxin system toxin GhoT	NA	NA	NA	NA	NA
WP_000003806.1|288593_290111_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856827.1|290347_291805_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.8	2.3e-48
>prophage 21
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	306081	308065	4863332		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|306081_306375_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|306418_308065_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 22
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	312265	312799	4863332		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|312265_312799_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 23
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	317718	318696	4863332		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|317718_318696_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 24
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	326123	326669	4863332		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|326123_326669_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 25
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	330583	343615	4863332	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_000990303.1|330583_331921_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122471.1|331930_333778_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280339.1|333770_334721_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|334806_335115_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|335191_336472_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312497.1|336557_337817_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|337819_338824_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|338905_339103_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|339206_340505_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|340709_341135_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076336.1|341173_343615_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	2.9e-67
>prophage 26
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	352672	353836	4863332		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944020.1|352672_353836_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	5.4e-80
>prophage 27
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	368128	369337	4863332	transposase	Morganella_phage(100.0%)	1	NA	NA
WP_001366541.1|368128_369337_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1W6JP07	Morganella_phage	98.4	1.8e-208
>prophage 28
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	390485	406143	4863332	transposase,protease	uncultured_Caudovirales_phage(37.5%)	15	NA	NA
WP_000055075.1|390485_391016_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265935.1|391325_392282_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001095665.1|392414_393917_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001376149.1|393930_394953_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_048967561.1|394939_395935_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|395967_396966_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219814.1|397141_398515_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_100190663.1|398653_400001_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
WP_000166295.1|400101_400653_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|400746_402099_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232246.1|402281_402668_+	cytochrome b562	NA	NA	NA	NA	NA
WP_000212715.1|402859_403102_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
WP_001105433.1|403091_403382_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_001106233.1|403382_403847_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187798.1|404004_406143_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 29
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	409781	415878	4863332		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181318.1|409781_410729_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|410913_410967_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471842.1|411107_413804_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	2.6e-45
WP_001315167.1|414009_414396_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|414468_414930_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|414942_415878_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 30
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	424403	433459	4863332	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_048967622.1|424403_427259_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.6	3.9e-140
WP_000786399.1|427258_427702_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|427835_429347_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|429613_430714_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|430713_431796_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294526.1|431956_433459_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	6.1e-84
>prophage 31
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	438588	454566	4863332	integrase	Liberibacter_phage(55.56%)	10	439226:439239	444837:444850
WP_001376155.1|438588_439608_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	2.4e-44
439226:439239	attL	AACTTCTCGGCAAA	NA	NA	NA	NA
WP_148115936.1|440086_441346_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.4	6.9e-81
WP_148115935.1|441593_441821_+	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	43.2	2.3e-11
WP_148115934.1|441820_443320_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	77.2	5.3e-229
WP_135487976.1|443316_444810_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	77.4	5.3e-205
WP_135487975.1|444802_445936_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	46.4	7.0e-24
444837:444850	attR	TTTGCCGAGAAGTT	NA	NA	NA	NA
WP_000481474.1|445936_448999_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	71.1	0.0e+00
WP_001097954.1|449079_450987_-	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	25.1	6.9e-16
WP_000404909.1|450983_452717_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024210280.1|453579_454566_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.7	7.2e-102
>prophage 32
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	457926	459604	4863332		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|457926_458529_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|459007_459604_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 33
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	469869	471330	4863332		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208190.1|469869_471330_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 34
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	477897	478482	4863332		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151856.1|477897_478482_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.2e-37
>prophage 35
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	494385	495342	4863332	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181152.1|494385_495342_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	6.6e-60
>prophage 36
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	515320	520676	4863332		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919592.1|515320_516976_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410125.1|517024_518386_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|518600_519515_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106033.1|519653_520676_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 37
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	523901	525181	4863332		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|523901_524639_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|524641_525181_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 38
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	533009	535885	4863332		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|533009_534599_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|534991_535597_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|535723_535885_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 39
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	541472	542795	4863332		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|541472_542795_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 40
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	549515	550748	4863332		Enterococcus_phage(100.0%)	1	NA	NA
WP_000093813.1|549515_550748_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 41
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	556619	560560	4863332		Tupanvirus(50.0%)	2	NA	NA
WP_000046754.1|556619_558287_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000409418.1|558622_560560_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 42
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	563746	565860	4863332		Bacillus_phage(50.0%)	2	NA	NA
WP_000554505.1|563746_564436_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219589.1|564435_565860_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	2.1e-09
>prophage 43
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	577515	586584	4863332		Cyanophage(20.0%)	9	NA	NA
WP_000130187.1|577515_578469_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094685.1|578583_579171_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528541.1|579205_579772_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|579920_580634_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843579.1|580659_581064_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|581439_583356_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|583444_584575_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|584678_584888_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_000681352.1|585417_586584_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	1.7e-89
>prophage 44
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	596071	598888	4863332	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286871.1|596071_598888_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	4.6e-77
>prophage 45
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	603293	604442	4863332		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|603293_604442_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 46
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	608433	617027	4863332	transposase	Bacillus_phage(33.33%)	7	NA	NA
WP_100190663.1|608433_609781_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
WP_000122881.1|609887_610478_-	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_000004399.1|610483_611269_-	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001366787.1|611377_612931_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	7.8e-34
WP_000349952.1|613004_614222_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|614339_615482_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|615512_617027_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 47
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	624921	626882	4863332		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|624921_625401_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|625486_625720_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_001160967.1|625722_626037_+	CcdB family protein	NA	NA	NA	NA	NA
WP_000257196.1|626033_626882_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 48
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	635987	641409	4863332		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|635987_638894_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_024177884.1|639057_641409_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.8	1.7e-32
>prophage 49
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	647741	648440	4863332		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916292.1|647741_648440_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 50
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	660929	662654	4863332		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425671.1|660929_662654_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 51
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	688624	689668	4863332		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|688624_689668_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 52
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	693913	694465	4863332		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923726.1|693913_694465_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 53
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	703092	704517	4863332		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|703092_704517_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 54
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	712263	718731	4863332		Mamastrovirus(33.33%)	5	NA	NA
WP_001189649.1|712263_713814_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	4.6e-18
WP_001306211.1|713860_716251_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|716456_716993_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|717033_717696_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|717804_718731_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 55
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	721993	722938	4863332	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339915.1|721993_722938_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.7e-60
>prophage 56
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	733113	739919	4863332	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174642.1|733113_734532_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_032321515.1|734570_735467_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|735533_735989_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000397286.1|736166_736871_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294687.1|736885_737416_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001366780.1|737489_739919_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.9	3.9e-40
>prophage 57
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	745048	745846	4863332		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_172636111.1|745048_745846_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.1	2.6e-09
>prophage 58
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	751757	752102	4863332		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|751757_752102_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 59
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	756031	757456	4863332	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|756031_757456_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 60
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	769304	770063	4863332		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|769304_770063_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 61
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	778891	783007	4863332		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569428.1|778891_779488_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.5	6.7e-26
WP_001294757.1|779524_783007_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 62
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	795840	796872	4863332		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|795840_796872_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 63
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	803395	811247	4863332		Indivirus(25.0%)	9	NA	NA
WP_000997027.1|803395_804199_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	7.1e-39
WP_000648581.1|804195_805110_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|805350_806151_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211700.1|806228_806999_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644680.1|807045_808404_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052722.1|808475_809231_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001366121.1|809264_809987_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|809983_810451_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001366128.1|810515_811247_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 64
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	821727	871116	4863332	integrase,plate,transposase	Enterobacteria_phage(22.22%)	42	812882:812896	872789:872803
812882:812896	attL	TTAGTAAAAATATAA	NA	NA	NA	NA
WP_049293523.1|821727_824505_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.7	2.8e-82
WP_000343111.1|824513_825275_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246417.1|825279_826611_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|826613_827138_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113718.1|827134_828415_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348803.1|828439_829522_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393830.1|829485_831336_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611735.1|831339_831753_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056997.1|831759_833235_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000718847.1|833303_833510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037390.1|833544_834045_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|834741_835260_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103285.1|835469_837245_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.5e-25
WP_133296700.1|837251_837578_+	type VI secretion protein VgrG	NA	NA	NA	NA	NA
WP_172636112.1|837644_841898_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.0	6.0e-20
WP_024177823.1|841910_842360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000981126.1|846418_846667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425547.1|846667_847066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420964.1|847346_848483_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001118049.1|848665_849436_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532699.1|849589_850063_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973081.1|850105_852550_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|852789_853368_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|853489_854257_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|854227_854968_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093948.1|855268_856018_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_048967441.1|856179_857919_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207554.1|857863_858649_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226183.1|858719_859775_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554755.1|859826_860120_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_048967440.1|860122_860521_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059899.1|860530_860983_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389960.1|861215_861482_+	RtcB family protein	NA	NA	NA	NA	NA
WP_001366468.1|861641_861782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293009.1|861838_863296_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|863556_864015_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189541.1|864106_865351_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174681.1|865408_865810_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749879.1|865848_866904_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
WP_001285288.1|867191_868295_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893287.1|868306_869560_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
WP_000772654.1|869913_871116_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.8	3.4e-130
872789:872803	attR	TTAGTAAAAATATAA	NA	NA	NA	NA
>prophage 65
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	875438	877538	4863332		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001078521.1|875438_877538_-	RecQ family ATP-dependent DNA helicase	NA	Q9DSV4	Diadromus_pulchellus_ascovirus	33.6	5.8e-40
>prophage 66
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	883941	887203	4863332		Yersinia_phage(50.0%)	5	NA	NA
WP_000197392.1|883941_884766_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.3	1.4e-45
WP_000189396.1|884974_885685_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219796.1|885710_886247_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_000853946.1|886288_886726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000912998.1|886792_887203_+	hypothetical protein	NA	A0A1B2IBY1	Erwinia_phage	53.0	1.8e-30
>prophage 67
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	899812	902011	4863332		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000667055.1|899812_902011_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.5	9.6e-38
>prophage 68
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	920297	921149	4863332		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174466.1|920297_921149_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 69
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	927194	930499	4863332		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001366477.1|927194_928064_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	1.6e-52
WP_001361806.1|928223_928817_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|928828_929065_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046303.1|929173_930499_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 70
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	936071	941991	4863332	holin	Catovirus(50.0%)	4	NA	NA
WP_001159137.1|936071_937742_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	4.0e-60
WP_000089094.1|937755_939228_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001305448.1|939241_939829_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|939957_941991_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 71
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	954672	959210	4863332		Bacillus_virus(50.0%)	4	NA	NA
WP_000447343.1|954672_956157_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_048968013.1|956149_957121_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750346.1|957117_958074_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692721.1|958160_959210_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	44.7	9.2e-71
>prophage 72
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	967587	973182	4863332		Staphylococcus_phage(50.0%)	4	NA	NA
WP_172636113.1|967587_969474_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
WP_000076242.1|969710_970970_+	cytosine permease	NA	NA	NA	NA	NA
WP_001366517.1|970959_972243_+	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000952493.1|972282_973182_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	2.5e-16
>prophage 73
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	977708	981988	4863332		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_172636114.1|977708_980783_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.2	0.0e+00
WP_000805887.1|980905_981988_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.9	4.1e-191
>prophage 74
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	987398	989359	4863332		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_000044324.1|987398_988349_+	acetaldehyde dehydrogenase	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	2.5e-35
WP_001013507.1|988345_989359_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
>prophage 75
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	992441	993551	4863332		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|992441_993551_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 76
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	998843	999611	4863332		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939354.1|998843_999611_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 77
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1006482	1007640	4863332		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830732.1|1006482_1007640_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 78
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1015052	1016168	4863332		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|1015052_1016168_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 79
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1020457	1030429	4863332		Bacillus_phage(60.0%)	7	NA	NA
WP_001366457.1|1020457_1021369_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219329.1|1021493_1022402_+	fructokinase	NA	NA	NA	NA	NA
WP_001695489.1|1022544_1023729_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698897.1|1023854_1026998_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221327.1|1026994_1028197_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|1028386_1029076_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|1029133_1030429_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 80
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1039245	1048225	4863332	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667322.1|1039245_1040373_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
WP_000007629.1|1040395_1040728_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|1040755_1042603_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|1042613_1043585_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|1043713_1044061_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|1044236_1045121_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001366485.1|1045419_1045959_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|1046109_1046559_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150429.1|1046562_1047666_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	3.7e-54
WP_001021161.1|1047754_1048225_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 81
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1071581	1076628	4863332	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|1071581_1072205_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|1072330_1073605_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001366471.1|1073792_1076147_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.2e-224
WP_001043542.1|1076355_1076628_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 82
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1079756	1080452	4863332		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817245.1|1079756_1080452_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 83
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1083775	1087322	4863332		Bacillus_phage(100.0%)	2	NA	NA
WP_001235590.1|1083775_1085548_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256201.1|1085540_1087322_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 84
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1096158	1099308	4863332		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|1096158_1099308_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 85
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1106316	1115486	4863332	transposase	Klosneuvirus(20.0%)	9	NA	NA
WP_000127356.1|1106316_1106868_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122015.1|1106996_1108928_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1108980_1109310_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1109309_1109915_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|1110024_1111899_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_000526135.1|1112080_1112539_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001366519.1|1112791_1113436_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250111.1|1113567_1114530_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801805.1|1114526_1115486_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	2.5e-14
>prophage 86
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1123765	1126270	4863332		uncultured_virus(100.0%)	1	NA	NA
WP_000083996.1|1123765_1126270_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.7e-115
>prophage 87
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1152242	1154405	4863332		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000739041.1|1152242_1154405_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	2.4e-17
>prophage 88
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1160539	1161217	4863332		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|1160539_1161217_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 89
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1164353	1165040	4863332		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110571.1|1164353_1165040_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	3.8e-33
>prophage 90
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1171947	1173729	4863332		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001305518.1|1171947_1173729_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 91
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1179920	1180910	4863332		Streptococcus_phage(100.0%)	1	NA	NA
WP_089563090.1|1179920_1180910_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.0	2.9e-34
>prophage 92
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1192313	1278049	4863332	protease,lysis,tRNA,portal,integrase,capsid,terminase,tail,transposase,head	Enterobacteria_phage(54.1%)	99	1202465:1202511	1260092:1260138
WP_000912345.1|1192313_1193699_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143513.1|1193734_1194256_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1194363_1194576_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|1194577_1195444_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1195914_1196457_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988384.1|1196676_1197369_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001308462.1|1197399_1200009_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691065.1|1200021_1201029_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255232.1|1201039_1201555_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1201557_1202190_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1202465:1202511	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|1202524_1203688_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488408.1|1203886_1204165_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	8.4e-48
WP_000763390.1|1204212_1204431_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001386642.1|1204529_1204811_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000129285.1|1204821_1205379_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682294.1|1205371_1205533_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000186833.1|1205529_1206210_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_001366481.1|1206206_1206992_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000995433.1|1206997_1207294_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|1207369_1207576_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|1208171_1208861_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|1208965_1209196_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|1209265_1209805_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_000147902.1|1209801_1210821_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	5.2e-111
WP_000788853.1|1210817_1211519_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	97.9	9.3e-128
WP_000145904.1|1211515_1211818_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	96.7	2.3e-43
WP_001070451.1|1211885_1212218_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001299444.1|1212265_1212415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709074.1|1212472_1213999_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	3.6e-31
WP_000338660.1|1214110_1214434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366525.1|1214608_1215391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097297.1|1215485_1215587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053028.1|1215583_1216039_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.1e-60
WP_000224915.1|1216038_1216209_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774488.1|1216201_1216492_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099707.1|1216488_1216851_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	1.4e-58
WP_000971055.1|1216847_1216988_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204777.1|1217073_1217451_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|1217606_1218131_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592545.1|1218323_1219283_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_001146309.1|1219634_1220366_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839582.1|1220554_1220770_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001135296.1|1220769_1221267_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_001228695.1|1221483_1221666_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|1221756_1222050_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001205742.1|1222219_1222375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000453592.1|1222718_1223264_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.1e-94
WP_001027304.1|1223238_1225164_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|1225160_1225367_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001366490.1|1225363_1226965_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	2.1e-311
WP_021552139.1|1226945_1228265_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	97.9	2.6e-232
WP_001299443.1|1228274_1228607_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000896723.1|1229070_1230306_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	44.7	5.5e-99
WP_000737991.1|1230307_1230535_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001049526.1|1230604_1231141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001588496.1|1231491_1231794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000929264.1|1232002_1232368_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000999172.1|1232360_1232585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790824.1|1232588_1232876_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000817024.1|1232872_1234693_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.6	4.9e-128
WP_000125506.1|1234980_1235226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126721.1|1235222_1235672_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000526135.1|1235794_1236253_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000228108.1|1236600_1237641_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.7	5.2e-66
WP_000190773.1|1237650_1237992_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001178671.1|1238003_1238387_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001366487.1|1239290_1240196_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000158889.1|1241162_1241558_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.8e-57
WP_000753019.1|1241569_1241923_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975058.1|1241934_1242513_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	1.7e-79
WP_000683105.1|1242509_1242905_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001577918.1|1242912_1243653_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000479163.1|1243668_1244091_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_000459457.1|1244072_1244507_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840281.1|1244499_1247061_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.8	0.0e+00
WP_000847355.1|1247057_1247387_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_001152530.1|1247386_1248085_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	1.5e-130
WP_024177847.1|1248089_1248833_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
WP_000090882.1|1248769_1249372_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000515622.1|1249432_1252828_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.5	0.0e+00
WP_001228248.1|1252895_1253495_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	7.5e-102
WP_000741765.1|1253559_1255959_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.2	3.9e-133
WP_000654153.1|1255955_1256237_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	51.1	1.1e-18
WP_059329874.1|1256246_1257287_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	1.7e-125
WP_000355601.1|1257329_1257623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239887.1|1257816_1258485_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001201826.1|1258715_1259669_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|1260181_1260943_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1260092:1260138	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224583.1|1261125_1262016_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001366498.1|1262016_1264989_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383939.1|1264975_1267213_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000253831.1|1267362_1268805_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.6	2.3e-11
WP_000770953.1|1268794_1269478_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074189.1|1269634_1271008_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709885.1|1271165_1271498_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717103.1|1271513_1272737_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573934.1|1272748_1275892_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
WP_000786307.1|1275993_1277370_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000526135.1|1277590_1278049_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 93
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1288044	1294087	4863332		Tupanvirus(50.0%)	3	NA	NA
WP_000077751.1|1288044_1291926_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	1.3e-61
WP_000096731.1|1292141_1293275_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140646.1|1293271_1294087_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 94
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1308379	1310202	4863332		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502939.1|1308379_1309009_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_000029831.1|1308981_1310202_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	6.1e-58
>prophage 95
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1313310	1315425	4863332		Bacillus_virus(50.0%)	2	NA	NA
WP_001366511.1|1313310_1314876_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.9e-44
WP_001366526.1|1314996_1315425_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	37.8	2.1e-18
>prophage 96
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1329516	1330163	4863332		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|1329516_1329726_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|1329779_1330163_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 97
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1334982	1337422	4863332		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|1334982_1336194_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_048968162.1|1336333_1337422_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 98
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1344432	1349555	4863332	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001366479.1|1344432_1347015_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	2.0e-183
WP_001044880.1|1347249_1347732_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207487.1|1347776_1348712_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|1348829_1349555_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 99
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1357509	1358550	4863332		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1357509_1358550_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 100
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1362684	1364349	4863332		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337063.1|1362684_1364349_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 101
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1368975	1372789	4863332	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023128.1|1368975_1370922_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	9.2e-08
WP_001287130.1|1371124_1372789_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 102
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1376941	1386244	4863332		Mycobacterium_phage(25.0%)	7	NA	NA
WP_000773272.1|1376941_1377706_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	32.4	5.8e-06
WP_000848387.1|1377890_1378436_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_001297249.1|1378461_1380102_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_000186084.1|1380263_1380941_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	5.2e-27
WP_001366443.1|1380937_1383622_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_001366451.1|1383614_1384187_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087937.1|1384195_1386244_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
>prophage 103
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1394116	1397058	4863332		Hokovirus(50.0%)	2	NA	NA
WP_000207156.1|1394116_1395535_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	4.3e-63
WP_001032674.1|1395576_1397058_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	5.5e-45
>prophage 104
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1400436	1401228	4863332		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113980.1|1400436_1401228_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.2	1.7e-08
>prophage 105
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1421026	1421485	4863332	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000526135.1|1421026_1421485_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 106
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1445918	1449438	4863332		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|1445918_1446638_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951284.1|1446634_1447576_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	3.7e-23
WP_000784342.1|1447689_1448070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109212.1|1448385_1449438_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.6e-81
>prophage 107
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1453800	1461085	4863332	transposase	Tupanvirus(25.0%)	8	NA	NA
WP_001265452.1|1453800_1454817_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	5.2e-79
WP_000096834.1|1455077_1456550_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	1.2e-12
WP_001147439.1|1456617_1457406_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|1457534_1457684_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000526135.1|1457861_1458320_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000101996.1|1458561_1459335_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|1459334_1460024_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|1460026_1461085_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 108
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1471347	1472637	4863332		Klosneuvirus(100.0%)	1	NA	NA
WP_001375839.1|1471347_1472637_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 109
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1479118	1480027	4863332		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308507.1|1479118_1480027_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 110
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1490301	1507090	4863332		Anomala_cuprea_entomopoxvirus(16.67%)	13	NA	NA
WP_001366240.1|1490301_1492038_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|1492030_1493026_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|1493028_1493700_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007112.1|1493928_1495290_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_172636116.1|1495896_1497909_+	type III secretion system effector EspX2	NA	NA	NA	NA	NA
WP_001218663.1|1498192_1500343_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_000386512.1|1500370_1501333_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443545.1|1501473_1502559_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|1502698_1502959_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146354.1|1503223_1503490_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|1503563_1504241_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430001.1|1504282_1506565_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|1506829_1507090_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 111
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1510630	1515855	4863332		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|1510630_1511353_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|1511349_1512009_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|1512147_1512894_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|1513297_1513801_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|1514099_1514987_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|1515221_1515287_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|1515339_1515855_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 112
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1520851	1522447	4863332		Tupanvirus(100.0%)	1	NA	NA
WP_000961457.1|1520851_1522447_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.3e-62
>prophage 113
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1530048	1534179	4863332		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209332.1|1530048_1532481_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001308514.1|1532486_1533386_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001366269.1|1533516_1534179_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	2.2e-25
>prophage 114
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1537405	1539277	4863332		Bacillus_virus(100.0%)	1	NA	NA
WP_001366246.1|1537405_1539277_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G3M9Y6	Bacillus_virus	30.2	4.5e-12
>prophage 115
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1550612	1551815	4863332		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1550612_1551815_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 116
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1560383	1569634	4863332		Vibrio_phage(25.0%)	11	NA	NA
WP_001195234.1|1560383_1560641_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_001201589.1|1560800_1561088_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189139.1|1561071_1561794_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1561854_1562757_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1562844_1563321_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126075.1|1563671_1564784_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996030.1|1564988_1566122_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	2.5e-29
WP_000105416.1|1566131_1567076_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|1567072_1567918_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1567977_1568466_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149736.1|1568506_1569634_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 117
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1572759	1573488	4863332		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|1572759_1573488_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 118
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1577165	1577996	4863332		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255176.1|1577165_1577996_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.6	1.1e-07
>prophage 119
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1581583	1583302	4863332		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815359.1|1581583_1583302_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	3.1e-31
>prophage 120
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1592588	1616570	4863332	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188185.1|1592588_1594535_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1594607_1594832_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1595154_1595475_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934042.1|1595505_1597782_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1598646_1598865_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1599149_1599854_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202144.1|1599895_1601617_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.3	9.9e-22
WP_001043573.1|1601617_1603384_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537432.1|1603506_1604472_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|1605016_1605511_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077033.1|1605645_1609752_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001305929.1|1609910_1610522_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1610532_1611876_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1611966_1613259_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850305.1|1613497_1615942_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000213096.1|1615952_1616570_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	2.9e-77
>prophage 121
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1621408	1624623	4863332		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|1621408_1622149_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292809.1|1622340_1624623_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 122
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1628721	1629810	4863332		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057132.1|1628721_1629810_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	2.0e-81
>prophage 123
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1634896	1639437	4863332		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|1634896_1635181_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705751.1|1635387_1637652_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551266.1|1637688_1639437_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 124
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1654142	1666568	4863332	tRNA,transposase	Rhodobacter_phage(16.67%)	9	NA	NA
WP_001295932.1|1654142_1654691_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109449.1|1654717_1655365_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462700.1|1655414_1656605_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977905.1|1656789_1657863_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	2.3e-101
WP_000117881.1|1658465_1659866_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001305916.1|1660034_1661237_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193816.1|1661502_1664115_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	1.2e-18
WP_100190663.1|1664183_1665532_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
WP_001090520.1|1665800_1666568_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 125
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1682490	1684398	4863332		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|1682490_1684398_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 126
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1697009	1699064	4863332		Bacillus_phage(100.0%)	1	NA	NA
WP_000420538.1|1697009_1699064_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 127
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1703298	1703958	4863332	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1703298_1703958_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 128
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1714951	1727207	4863332		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|1714951_1715164_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1715174_1715363_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|1715337_1715568_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1715557_1715731_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000137001.1|1715779_1716853_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054729.1|1716924_1719669_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	7.0e-38
WP_001264942.1|1719751_1720780_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120121.1|1720752_1721445_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230244.1|1721574_1722747_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063133.1|1722746_1725293_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.0	4.1e-72
WP_000209891.1|1725289_1725889_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1725981_1726287_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|1726286_1727207_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 129
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1731515	1733615	4863332		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|1731515_1731689_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240609.1|1731771_1733100_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.2	1.2e-232
WP_001028082.1|1733120_1733615_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 130
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1750645	1751434	4863332		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533536.1|1750645_1751434_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
>prophage 131
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1756061	1756895	4863332		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1756061_1756895_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 132
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1761030	1761564	4863332		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857406.1|1761030_1761564_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 133
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1770872	1771793	4863332		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1770872_1771793_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 134
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1776455	1776701	4863332		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1776455_1776701_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 135
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1792547	1793489	4863332		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001366226.1|1792547_1793489_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 136
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1805846	1807028	4863332		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1805846_1806581_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1806791_1807028_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 137
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1810300	1811943	4863332		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001256995.1|1810300_1810942_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	1.0e-27
WP_001267922.1|1810938_1811943_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 138
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1824196	1824454	4863332		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1824196_1824454_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 139
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1831742	1835465	4863332		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|1831742_1832444_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251363.1|1832443_1833688_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|1833716_1834628_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|1834643_1835465_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 140
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1838737	1840715	4863332		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799393.1|1838737_1839595_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	8.7e-11
WP_000531594.1|1839578_1840715_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 141
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1845737	1847108	4863332		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|1845737_1847108_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 142
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1850244	1854695	4863332	transposase	Phage_21(25.0%)	6	NA	NA
WP_000444487.1|1850244_1851495_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_172636118.1|1851597_1851921_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	62.6	5.3e-38
WP_000526135.1|1852559_1853018_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_019842521.1|1853175_1853286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373096.1|1853338_1853743_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332286.1|1853963_1854695_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 143
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1871400	1873088	4863332		Morganella_phage(50.0%)	2	NA	NA
WP_000897377.1|1871400_1871820_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	1.2e-37
WP_000457633.1|1871819_1873088_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.9	8.7e-209
>prophage 144
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1891224	1891983	4863332		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173311.1|1891224_1891983_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 145
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1907840	1910592	4863332		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033344.1|1907840_1909520_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|1909644_1910592_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 146
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1913728	1920532	4863332		Pseudomonas_phage(33.33%)	9	NA	NA
WP_000804726.1|1913728_1914811_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456478.1|1914810_1915644_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|1915640_1916033_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|1916036_1916846_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1916881_1917736_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000176713.1|1917883_1917991_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000170955.1|1918418_1918526_-	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
WP_001366250.1|1918931_1920032_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|1920301_1920532_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 147
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1931665	1942388	4863332		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|1931665_1933204_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571694.1|1933200_1933911_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1933910_1934588_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|1936025_1936868_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_024044061.1|1936917_1937376_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1937488_1938394_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|1938485_1939499_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718999.1|1939700_1940609_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1940753_1941167_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|1941770_1942388_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 148
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1950799	1952814	4863332		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110954.1|1950799_1951813_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|1951809_1952814_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 149
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1964456	1967414	4863332		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000983850.1|1964456_1965818_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	5.0e-37
WP_000763524.1|1965818_1967414_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
>prophage 150
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1974389	1979681	4863332	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559270.1|1974389_1975148_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	1.5e-06
WP_000422045.1|1975367_1976417_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1976452_1976704_-	YciN family protein	NA	NA	NA	NA	NA
WP_001366271.1|1977083_1979681_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.8	2.9e-89
>prophage 151
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1984605	1985196	4863332		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1984605_1985196_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 152
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	1993009	1994944	4863332		Lactococcus_phage(100.0%)	1	NA	NA
WP_000484983.1|1993009_1994944_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 153
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2003877	2005896	4863332		Salmonella_phage(50.0%)	2	NA	NA
WP_000135018.1|2003877_2005041_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	1.3e-28
WP_000573407.1|2005089_2005896_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 154
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2018686	2019952	4863332		Klosneuvirus(100.0%)	1	NA	NA
WP_000069241.1|2018686_2019952_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	2.7e-24
>prophage 155
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2038339	2038855	4863332		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|2038339_2038855_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 156
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2048670	2057585	4863332	tRNA,transposase	Saccharomonospora_phage(28.57%)	8	NA	NA
WP_024177825.1|2048670_2049903_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2050157_2051141_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123748.1|2051618_2052992_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|2053120_2054056_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001295593.1|2054231_2054666_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837928.1|2054806_2055940_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	2.4e-117
WP_000526135.1|2056414_2056873_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000526135.1|2057126_2057585_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 157
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2062318	2063308	4863332		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|2062318_2063308_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 158
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2094597	2098500	4863332		Klosneuvirus(100.0%)	1	NA	NA
WP_000139594.1|2094597_2098500_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 159
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2102439	2103388	4863332		Escherichia_phage(50.0%)	2	NA	NA
WP_001308636.1|2102439_2102970_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.1e-19
WP_000731854.1|2103214_2103388_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	65.2	5.8e-07
>prophage 160
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2116572	2123622	4863332		Phage_TP(25.0%)	7	NA	NA
WP_024177865.1|2116572_2118534_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.5	1.6e-23
WP_000494241.1|2118625_2118856_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813798.1|2119077_2119254_+	hypothetical protein	NA	A0A0M3LQ86	Mannheimia_phage	57.9	1.8e-11
WP_001270286.1|2119299_2119716_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760631.1|2119794_2121201_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047443.1|2121445_2122591_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220411.1|2122608_2123622_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 161
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2130755	2132858	4863332		Salmonella_phage(100.0%)	1	NA	NA
WP_000689319.1|2130755_2132858_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.5	3.3e-136
>prophage 162
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2137639	2143969	4863332		Ralstonia_phage(50.0%)	3	NA	NA
WP_000103285.1|2137639_2139415_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.5e-25
WP_133296700.1|2139421_2139748_+	type VI secretion protein VgrG	NA	NA	NA	NA	NA
WP_172636120.1|2139814_2143969_+	RHS domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.2	5.1e-24
>prophage 163
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2150491	2152036	4863332		Escherichia_phage(100.0%)	1	NA	NA
WP_000702569.1|2150491_2152036_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 164
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2160313	2161414	4863332		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768396.1|2160313_2161414_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.4	4.1e-138
>prophage 165
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2167427	2168868	4863332		Escherichia_phage(50.0%)	2	NA	NA
WP_000781368.1|2167427_2167712_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642394.1|2167857_2168868_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	2.1e-24
>prophage 166
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2178889	2180795	4863332		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285548.1|2178889_2179816_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	3.5e-13
WP_000193520.1|2179808_2180795_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.1e-17
>prophage 167
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2185111	2188918	4863332		Klosneuvirus(50.0%)	2	NA	NA
WP_024177842.1|2185111_2187511_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.2e-09
WP_000426277.1|2187535_2188918_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 168
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2194196	2201132	4863332		Megavirus(50.0%)	3	NA	NA
WP_001366364.1|2194196_2196980_-	insulinase family protein	NA	A0A2P1EIE5	Megavirus	23.0	3.7e-18
WP_000832476.1|2197036_2199409_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628562.1|2199446_2201132_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	1.0e-10
>prophage 169
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2217302	2218703	4863332		Escherichia_phage(100.0%)	1	NA	NA
WP_123056263.1|2217302_2218703_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	50.0	2.1e-107
>prophage 170
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2226118	2227654	4863332		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194899.1|2226118_2227654_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.4e-21
>prophage 171
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2235525	2236944	4863332		Bacillus_phage(100.0%)	1	NA	NA
WP_000558440.1|2235525_2236944_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 172
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2244691	2245075	4863332		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|2244691_2245075_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 173
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2248077	2248968	4863332		Bacillus_phage(100.0%)	1	NA	NA
WP_000592854.1|2248077_2248968_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 174
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2253860	2313737	4863332	protease,lysis,portal,integrase,terminase,tail	Enterobacteria_phage(43.14%)	71	2259805:2259820	2303114:2303129
WP_000214712.1|2253860_2254064_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527776.1|2254099_2255560_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.5	6.6e-43
WP_000347493.1|2255649_2256933_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2257536_2257650_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2257718_2257952_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|2258268_2258859_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355601.1|2259086_2259380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059329874.1|2259422_2260463_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	1.7e-125
2259805:2259820	attL	GCATGACATGCACCAT	NA	NA	NA	NA
WP_000654155.1|2260472_2260754_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_172636122.1|2260750_2263147_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	57.2	3.3e-132
WP_021560600.1|2263205_2266685_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.7	0.0e+00
WP_044061166.1|2266745_2267354_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.5	2.1e-104
WP_097744663.1|2267290_2268034_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.9e-147
WP_089563165.1|2268039_2268738_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.1e-134
WP_000447253.1|2268747_2269077_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372027.1|2269076_2272142_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|2272113_2272443_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|2272451_2272838_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|2272898_2273642_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_021560603.1|2273652_2274054_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	3.2e-72
WP_000677102.1|2274050_2274629_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_021560604.1|2274640_2274916_-	phage protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_001097039.1|2274908_2275232_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001136588.1|2275318_2277346_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_000985958.1|2277290_2278799_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001072975.1|2278798_2279011_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934104.1|2279007_2281110_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_048967449.1|2281109_2281604_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	1.1e-82
WP_000548593.1|2282156_2282363_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|2282658_2282832_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001447381.1|2283004_2283160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2283239_2283305_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2283307_2283496_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2283506_2283719_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2284081_2284579_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092974.1|2284575_2285109_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.1	3.2e-96
WP_000189915.1|2285105_2285417_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2285421_2285637_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2286389_2286605_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_001047131.1|2287280_2288033_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.4	1.4e-129
WP_001265197.1|2288046_2289096_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.3	1.3e-112
WP_001309521.1|2289097_2289376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980999.1|2289442_2289694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|2289910_2290123_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_048968506.1|2290739_2292527_+	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.1	9.3e-15
WP_001151189.1|2292745_2293147_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_000054487.1|2293187_2294153_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705349.1|2294133_2294655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|2294638_2294866_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2294943_2295351_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_001741760.1|2295543_2295696_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	5.6e-06
WP_001241299.1|2295695_2296073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|2296041_2296329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048968501.1|2296744_2296933_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|2296929_2297121_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_048968500.1|2297214_2299686_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|2299758_2300010_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000877006.1|2300044_2301325_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.1e-155
WP_001360138.1|2301344_2301455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836034.1|2301512_2302532_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.3e-16
WP_001295394.1|2302543_2303758_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
2303114:2303129	attR	ATGGTGCATGTCATGC	NA	NA	NA	NA
WP_001314753.1|2303963_2304290_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_000705205.1|2304424_2304766_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2304800_2305361_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|2305363_2306074_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001366368.1|2306181_2306487_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041654.1|2306685_2309112_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	3.6e-211
WP_075208812.1|2309172_2311596_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|2311606_2312224_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526519.1|2312225_2313080_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148697.1|2313122_2313737_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	7.3e-28
>prophage 175
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2331497	2332799	4863332		Bacillus_phage(100.0%)	1	NA	NA
WP_000732507.1|2331497_2332799_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 176
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2342694	2344506	4863332		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945936.1|2342694_2344506_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.3	0.0e+00
>prophage 177
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2364400	2365675	4863332	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2364400_2365675_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 178
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2372585	2374084	4863332		Salmonella_phage(50.0%)	2	NA	NA
WP_001298528.1|2372585_2373107_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
WP_000250656.1|2373187_2374084_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 179
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2382887	2391691	4863332		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101168.1|2382887_2383715_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|2383842_2384424_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701039.1|2384569_2385739_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|2385904_2385994_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|2386292_2387318_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269493.1|2387314_2388247_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182362.1|2388359_2389571_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098914.1|2389861_2391010_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	3.2e-85
WP_000493947.1|2391049_2391691_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 180
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2397197	2399464	4863332		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587586.1|2397197_2398010_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001070008.1|2398013_2398799_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001361451.1|2398795_2399464_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
>prophage 181
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2407754	2412838	4863332		environmental_halophage(33.33%)	5	NA	NA
WP_000144590.1|2407754_2408975_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	1.3e-92
WP_000908004.1|2408971_2410243_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948887.1|2410217_2410964_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_001366332.1|2410973_2412461_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367171.1|2412469_2412838_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 182
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2426420	2429211	4863332		Vibrio_phage(50.0%)	3	NA	NA
WP_024177836.1|2426420_2426672_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	65.2	7.4e-19
WP_001281433.1|2427508_2427661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366354.1|2427729_2429211_+	AAA family ATPase	NA	A0A291LBG4	Klebsiella_phage	24.7	1.8e-11
>prophage 183
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2443124	2462518	4863332	tRNA	Tupanvirus(22.22%)	18	NA	NA
WP_001366355.1|2443124_2444771_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	5.3e-33
WP_000069370.1|2444827_2447206_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	1.6e-171
WP_000368046.1|2447538_2448372_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|2448528_2449575_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|2449706_2449898_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001309535.1|2451399_2452113_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209785.1|2452359_2452824_-	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|2452901_2453651_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|2453650_2454202_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956530.1|2454264_2455245_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|2455345_2455645_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672373.1|2455649_2458037_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2458051_2459035_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2459173_2459218_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2459340_2459697_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2459749_2459947_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2460043_2460586_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2460589_2462518_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 184
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2473814	2476076	4863332		Tupanvirus(100.0%)	1	NA	NA
WP_000077831.1|2473814_2476076_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 185
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2482203	2483031	4863332		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|2482203_2483031_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 186
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2490507	2491728	4863332		Klosneuvirus(100.0%)	1	NA	NA
WP_000081999.1|2490507_2491728_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	4.2e-27
>prophage 187
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2498480	2499134	4863332		Bacillus_phage(100.0%)	1	NA	NA
WP_001366359.1|2498480_2499134_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	1.1e-10
>prophage 188
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2504731	2506690	4863332		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235852.1|2504731_2506690_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	4.1e-40
>prophage 189
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2511615	2515701	4863332		Tupanvirus(50.0%)	4	NA	NA
WP_001140090.1|2511615_2512257_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.2	1.3e-19
WP_000438816.1|2512349_2513708_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|2513825_2514584_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723728.1|2514720_2515701_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.8e-07
>prophage 190
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2524514	2525369	4863332		Indivirus(100.0%)	1	NA	NA
WP_001366372.1|2524514_2525369_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 191
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2528687	2533264	4863332		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|2528687_2529971_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621402.1|2530117_2531593_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|2531773_2533264_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 192
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2548018	2556124	4863332	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|2548018_2549704_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2549908_2550490_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220980.1|2550529_2551225_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128837.1|2551282_2553193_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	1.0e-91
WP_001295493.1|2553324_2553669_+	RidA family protein	NA	NA	NA	NA	NA
WP_001322969.1|2554030_2554390_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2554509_2554689_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855031.1|2554762_2556124_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.1	4.4e-41
>prophage 193
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2559986	2561543	4863332		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2559986_2561543_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 194
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2567184	2567394	4863332		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2567184_2567394_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 195
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2571715	2575486	4863332	transposase,protease	Saccharomonospora_phage(50.0%)	3	NA	NA
WP_000526135.1|2571715_2572174_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000984517.1|2572364_2573246_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055785.1|2573437_2575486_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 196
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2582982	2590090	4863332	transposase	Escherichia_phage(25.0%)	9	NA	NA
WP_000812730.1|2582982_2583639_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.0	8.9e-56
WP_000976471.1|2584033_2584375_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879330.1|2584387_2585260_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204700.1|2585263_2585638_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2585776_2586007_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011651.1|2586108_2586765_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2586788_2587451_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936963.1|2587447_2589508_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000064873.1|2589664_2590090_-|transposase	IS200/IS605-like element ISEc46 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.6	8.9e-25
>prophage 197
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2597276	2598752	4863332		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|2597276_2598752_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 198
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2602751	2609818	4863332		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|2602751_2604074_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_011076428.1|2604089_2605022_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202985.1|2605100_2605856_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.7e-18
WP_000571479.1|2605852_2606638_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568522.1|2606787_2607798_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2607806_2608418_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072123646.1|2608556_2608622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024936.1|2608692_2609295_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2609296_2609818_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 199
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2613836	2615887	4863332		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639259.1|2613836_2614655_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	96.9	7.9e-70
WP_000252980.1|2614707_2615103_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2615143_2615887_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 200
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2622502	2624236	4863332	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|2622502_2624236_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 201
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2628756	2634400	4863332		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|2628756_2629146_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036383.1|2629160_2630210_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204344.1|2630212_2631073_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483197.1|2631091_2632693_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	8.3e-15
WP_001366374.1|2632738_2634400_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 202
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2644489	2646004	4863332		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187822.1|2644489_2646004_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 203
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2657996	2658749	4863332		Bacillus_virus(100.0%)	1	NA	NA
WP_001273013.1|2657996_2658749_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 204
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2670946	2671615	4863332		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334628.1|2670946_2671615_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	4.3e-82
>prophage 205
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2687454	2703621	4863332	transposase	Bacillus_phage(42.86%)	16	NA	NA
WP_077632868.1|2687454_2689149_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2689319_2689502_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2689580_2690498_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2690670_2691591_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000503014.1|2691579_2692050_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157226.1|2692030_2693449_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000365594.1|2693515_2694211_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|2694250_2694616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824360.1|2695181_2696297_+	porin	NA	Q1MVN1	Enterobacteria_phage	47.9	2.0e-92
WP_000218219.1|2696888_2697740_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826777.1|2697846_2699205_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_024177834.1|2699204_2699876_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920134.1|2700008_2700422_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740108.1|2700530_2701535_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240095.1|2701535_2702171_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_100190663.1|2702273_2703621_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
>prophage 206
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2722488	2732070	4863332	integrase	uncultured_Caudovirales_phage(33.33%)	4	2706260:2706319	2734052:2734135
2706260:2706319	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
WP_095844186.1|2722488_2726670_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.0	1.7e-22
WP_000983501.1|2727648_2727903_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	59.2	8.5e-15
WP_001366306.1|2728753_2729470_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_000055679.1|2730807_2732070_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.6	4.8e-74
2734052:2734135	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAAATT	NA	NA	NA	NA
>prophage 207
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2743185	2744352	4863332		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830156.1|2743185_2744352_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	2.9e-227
>prophage 208
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2750550	2751450	4863332		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131790.1|2750550_2751450_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 209
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2758891	2778497	4863332		Bacillus_phage(16.67%)	17	NA	NA
WP_000704872.1|2758891_2760058_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	2.9e-110
WP_000043487.1|2760306_2761713_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	2.3e-37
WP_000736848.1|2761876_2763247_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	6.4e-32
WP_000868618.1|2763271_2764018_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	41.6	2.1e-08
WP_001361571.1|2764101_2765487_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	1.9e-47
WP_001042472.1|2765498_2765954_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000163129.1|2765956_2766922_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.7	9.9e-88
WP_000335121.1|2766925_2768047_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.7	2.2e-131
WP_000699785.1|2768057_2769065_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000026027.1|2769133_2770150_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	43.7	6.3e-77
WP_000022057.1|2770170_2771238_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000610525.1|2771239_2772475_-	O11 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_001361572.1|2772471_2773197_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-09
WP_000916633.1|2773205_2774441_-	O11 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000183060.1|2774813_2775707_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999477.1|2775949_2776945_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001116053.1|2777102_2778497_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	4.9e-19
>prophage 210
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2784005	2790708	4863332		Bacillus_phage(25.0%)	6	NA	NA
WP_001366308.1|2784005_2785376_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	9.9e-33
WP_000079285.1|2785477_2786914_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699730.1|2786916_2788140_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|2788136_2788616_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043605.1|2788618_2789584_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	2.4e-86
WP_000048190.1|2789586_2790708_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 211
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2794945	2805355	4863332		uncultured_marine_virus(20.0%)	9	NA	NA
WP_000654494.1|2794945_2795785_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	7.5e-07
WP_000137159.1|2795877_2798040_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482918.1|2798042_2798486_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2798491_2799631_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_162829205.1|2799939_2800089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366304.1|2800289_2801873_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252364.1|2802165_2804019_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|2804040_2804622_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|2804713_2805355_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 212
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2810018	2811371	4863332		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469729.1|2810018_2811371_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	1.6e-06
>prophage 213
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2824485	2830602	4863332	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675144.1|2824485_2825889_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137877.1|2825885_2826608_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2826787_2827120_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476044.1|2827267_2828629_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	98.9	2.7e-216
WP_001303579.1|2828970_2829288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2829702_2830602_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 214
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2839742	2843299	4863332		Serratia_phage(50.0%)	4	NA	NA
WP_000846216.1|2839742_2840747_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011938.1|2840743_2841709_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434044.1|2841682_2842429_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001366297.1|2842480_2843299_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
>prophage 215
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2848928	2849480	4863332		Sodalis_phage(100.0%)	1	NA	NA
WP_001273871.1|2848928_2849480_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	2.0e-29
>prophage 216
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2861850	2863884	4863332	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001366292.1|2861850_2863884_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
>prophage 217
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2876351	2885793	4863332		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292747.1|2876351_2877488_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	6.5e-163
WP_001366299.1|2877484_2879485_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2879609_2880071_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2880111_2880582_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2880628_2881348_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2881344_2883030_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|2883251_2883983_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|2884042_2884150_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|2884130_2884862_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|2884866_2885793_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 218
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2905912	2907433	4863332		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255046.1|2905912_2907433_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 219
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2911127	2914913	4863332		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|2911127_2911796_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425463.1|2912053_2912890_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489272.1|2912921_2914913_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 220
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2918980	2919838	4863332		Hokovirus(100.0%)	1	NA	NA
WP_000873875.1|2918980_2919838_+	deoxyribonuclease IV	NA	A0A1V0SFR4	Hokovirus	34.3	1.4e-24
>prophage 221
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2934332	2938633	4863332		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001091937.1|2934332_2935799_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	3.3e-42
WP_000198790.1|2935916_2936903_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000594599.1|2936941_2937655_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|2938066_2938633_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 222
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2944387	2952036	4863332		Vibrio_phage(50.0%)	7	NA	NA
WP_000194914.1|2944387_2945977_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|2945980_2946325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213371.1|2946657_2947848_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	1.7e-20
WP_001234850.1|2947875_2948571_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|2948720_2950481_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494186.1|2950605_2950890_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|2951028_2952036_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 223
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2963733	2964351	4863332		Bacillus_virus(100.0%)	1	NA	NA
WP_001328413.1|2963733_2964351_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 224
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2973117	2978886	4863332		Bacillus_phage(25.0%)	5	NA	NA
WP_000422235.1|2973117_2974761_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884958.1|2974836_2975487_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786365.1|2975486_2976551_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	5.4e-18
WP_000406069.1|2976624_2977680_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865538.1|2977791_2978886_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	8.8e-117
>prophage 225
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2983048	2985898	4863332		Hokovirus(100.0%)	1	NA	NA
WP_000876033.1|2983048_2985898_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 226
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	2995599	2998227	4863332		Bacillus_virus(100.0%)	1	NA	NA
WP_001281251.1|2995599_2998227_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 227
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3003603	3011378	4863332		Pseudomonas_phage(50.0%)	6	NA	NA
WP_001075170.1|3003603_3005889_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332037.1|3006034_3007165_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000101257.1|3007164_3007419_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	61.9	2.6e-24
WP_000301029.1|3007472_3008123_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_001366439.1|3009010_3010081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000779071.1|3010301_3011378_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 228
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3017270	3021684	4863332	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140566.1|3017270_3018230_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.1e-69
WP_000150344.1|3018242_3018416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992981.1|3018456_3019260_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001240424.1|3019276_3020431_-	MFS transporter	NA	NA	NA	NA	NA
WP_172636125.1|3020475_3021684_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	6.4e-209
>prophage 229
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3024759	3029763	4863332		Tupanvirus(50.0%)	4	NA	NA
WP_001366411.1|3024759_3025362_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001388277.1|3025669_3026809_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.1e-29
WP_000461668.1|3026812_3027781_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	1.5e-35
WP_000860314.1|3027780_3029763_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
>prophage 230
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3064586	3067814	4863332		Salmonella_phage(50.0%)	3	NA	NA
WP_000813874.1|3064586_3065186_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	36.2	2.0e-06
WP_001012889.1|3065244_3067077_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203403.1|3067163_3067814_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
>prophage 231
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3078373	3080233	4863332		Sodalis_phage(50.0%)	2	NA	NA
WP_000156119.1|3078373_3079264_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	53.1	3.1e-67
WP_001293612.1|3079459_3080233_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 232
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3084444	3085962	4863332		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|3084444_3085962_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 233
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3092426	3093563	4863332		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699135.1|3092426_3093563_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
>prophage 234
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3102044	3103130	4863332		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|3102044_3103130_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 235
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3121136	3122069	4863332		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|3121136_3122069_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 236
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3125109	3126543	4863332		Bacillus_phage(100.0%)	1	NA	NA
WP_000194524.1|3125109_3126543_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	9.1e-29
>prophage 237
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3133197	3140773	4863332		Hokovirus(50.0%)	4	NA	NA
WP_024177843.1|3133197_3136791_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	29.3	1.0e-36
WP_001366424.1|3136845_3137991_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|3138064_3139009_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283514.1|3139078_3140773_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	1.0e-23
>prophage 238
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3144464	3145385	4863332		Morganella_phage(100.0%)	1	NA	NA
WP_000484405.1|3144464_3145385_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 239
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3149203	3149938	4863332		Clostridioides_phage(100.0%)	1	NA	NA
WP_001298580.1|3149203_3149938_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	4.7e-13
>prophage 240
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3171640	3187022	4863332		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443704.1|3171640_3173656_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	1.7e-150
WP_001317975.1|3173726_3174725_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|3174954_3175716_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|3175900_3176872_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|3177255_3177513_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|3177557_3179285_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|3179325_3179835_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096672.1|3179876_3180728_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719960.1|3180832_3181201_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001309637.1|3181203_3182115_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	2.9e-57
WP_000021011.1|3182248_3183346_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	1.2e-25
WP_000852686.1|3183335_3184211_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|3184210_3185044_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290240.1|3185043_3186060_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517443.1|3186230_3187022_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
>prophage 241
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3190675	3194251	4863332		Pandoravirus(50.0%)	5	NA	NA
WP_000084590.1|3190675_3191575_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838960.1|3191670_3192246_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001308832.1|3192306_3192756_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|3192742_3193168_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102892.1|3193381_3194251_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 242
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3212858	3213809	4863332		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|3212858_3213809_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 243
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3231062	3231776	4863332		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3231062_3231776_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 244
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3253076	3257078	4863332		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|3253076_3254366_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|3254451_3255078_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|3255402_3256440_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028621.1|3256439_3257078_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.9	9.0e-29
>prophage 245
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3263325	3269808	4863332		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|3263325_3263478_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|3263495_3263687_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|3263997_3264516_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755173.1|3264531_3265071_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138279.1|3265163_3266741_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|3266809_3268276_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000937937.1|3268437_3269808_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
>prophage 246
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3278637	3279069	4863332		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963835.1|3278637_3279069_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	2.8e-18
>prophage 247
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3289220	3295744	4863332		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133605.1|3289220_3290504_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
WP_000523616.1|3290748_3290949_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|3290960_3291296_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196617.1|3291297_3293148_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|3293164_3293680_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|3293775_3294099_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|3294115_3294502_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|3294529_3295744_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 248
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3311008	3312520	4863332		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493484.1|3311008_3312520_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 249
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3318277	3329565	4863332		Bacillus_phage(50.0%)	7	NA	NA
WP_000919149.1|3318277_3319531_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	1.0e-100
WP_000883103.1|3319857_3321048_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3321092_3321431_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|3321491_3322826_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215883.1|3322815_3323529_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|3323693_3325121_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970168.1|3325677_3329565_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.0e-130
>prophage 250
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3333684	3333945	4863332		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|3333684_3333945_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 251
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3337406	3341149	4863332		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|3337406_3338087_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|3338359_3339334_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3339349_3341149_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 252
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3346920	3353002	4863332	tRNA	Cafeteria_roenbergensis_virus(25.0%)	6	NA	NA
WP_000219193.1|3346920_3348255_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000189205.1|3349271_3349859_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|3349913_3350297_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262721.1|3350601_3351291_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_000997382.1|3351338_3352376_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3352582_3353002_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 253
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3358293	3359592	4863332		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841107.1|3358293_3359592_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	1.6e-45
>prophage 254
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3365415	3367989	4863332		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001366559.1|3365415_3367989_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 255
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3373895	3374966	4863332		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|3373895_3374966_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 256
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3388711	3389194	4863332		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|3388711_3389194_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 257
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3394946	3395114	4863332		Salmonella_phage(100.0%)	1	NA	NA
WP_071526532.1|3394946_3395114_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	73.8	3.5e-09
>prophage 258
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3404554	3408606	4863332		Klosneuvirus(50.0%)	4	NA	NA
WP_000097682.1|3404554_3405835_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	3.2e-33
WP_001295173.1|3406072_3407473_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|3407493_3408156_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|3408156_3408606_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 259
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3414412	3419709	4863332		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|3414412_3414658_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080954.1|3414654_3415056_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.6e-18
WP_000246631.1|3415037_3417182_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	6.4e-196
WP_000777926.1|3417191_3418151_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.7e-133
WP_000985490.1|3418506_3419709_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 260
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3432456	3437842	4863332	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3432456_3432642_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047205.1|3432876_3435507_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|3435634_3436135_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3436203_3437265_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|3437344_3437842_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 261
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3443309	3444275	4863332		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|3443309_3444275_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 262
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3451688	3452699	4863332		Enterobacteria_phage(100.0%)	1	NA	NA
WP_024177861.1|3451688_3452699_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	2.3e-26
>prophage 263
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3470957	3478097	4863332		Escherichia_phage(83.33%)	6	NA	NA
WP_001272905.1|3470957_3473519_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	6.6e-30
WP_001141297.1|3473624_3474281_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001295181.1|3474331_3475099_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847993.1|3475294_3476203_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_000590400.1|3476199_3477462_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_001278992.1|3477458_3478097_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
>prophage 264
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3483310	3487026	4863332		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|3483310_3484303_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3484365_3485505_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3485644_3486271_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3486264_3487026_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 265
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3490138	3492171	4863332		Tupanvirus(50.0%)	2	NA	NA
WP_001173667.1|3490138_3490744_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	1.2e-27
WP_001090372.1|3490743_3492171_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 266
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3506820	3507606	4863332		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001308910.1|3506820_3507606_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.4e-20
>prophage 267
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3511242	3516162	4863332		Vibrio_phage(33.33%)	4	NA	NA
WP_001199983.1|3511242_3511914_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001268435.1|3512207_3513080_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|3513139_3514438_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|3514524_3516162_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 268
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3519558	3523673	4863332		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046792.1|3519558_3520860_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.6e-38
WP_000186450.1|3520916_3523673_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 269
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3531208	3532057	4863332		Vibrio_phage(100.0%)	1	NA	NA
WP_000100411.1|3531208_3532057_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 270
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3536913	3537669	4863332		Bacillus_phage(100.0%)	1	NA	NA
WP_001296330.1|3536913_3537669_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 271
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3549245	3564630	4863332	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001366616.1|3549245_3550451_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	3.0e-73
WP_000184262.1|3550450_3550894_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117726.1|3550944_3551751_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.9	1.7e-16
WP_000678646.1|3551826_3552924_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|3553502_3554756_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|3554987_3556319_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775995.1|3556380_3558207_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.4	2.3e-24
WP_001366594.1|3558206_3561749_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138145.1|3561741_3564630_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	4.5e-67
>prophage 272
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3570107	3576880	4863332		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|3570107_3570902_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|3570908_3571784_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|3571934_3574181_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|3574193_3574724_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|3575408_3576098_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|3576166_3576880_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 273
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3586511	3589006	4863332		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|3586511_3587930_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603526.1|3588244_3589006_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
>prophage 274
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3622099	3623941	4863332		Escherichia_phage(100.0%)	1	NA	NA
WP_000365259.1|3622099_3623941_-	hypothetical protein	NA	A0A1Q1N989	Escherichia_phage	27.4	2.0e-36
>prophage 275
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3631911	3635770	4863332	integrase	Bacillus_phage(50.0%)	5	3625465:3625478	3639926:3639939
3625465:3625478	attL	CGGCATTGCTACGC	NA	NA	NA	NA
WP_000676395.1|3631911_3632490_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	24.9	1.2e-11
WP_000017243.1|3632704_3633124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534365.1|3633146_3633782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001558205.1|3633797_3634352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001316603.1|3635014_3635770_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
3639926:3639939	attR	GCGTAGCAATGCCG	NA	NA	NA	NA
>prophage 276
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3660048	3675439	4863332	tRNA	environmental_Halophage(14.29%)	13	NA	NA
WP_001280198.1|3660048_3661449_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001366582.1|3661466_3662783_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|3662818_3664186_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838422.1|3664221_3664710_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_002431258.1|3664709_3666629_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|3667064_3668513_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|3668514_3668640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192781.1|3668761_3669310_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|3669352_3670870_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|3670879_3671978_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813188.1|3672068_3673802_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.1e-60
WP_000715210.1|3673807_3674518_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806650.1|3674542_3675439_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	1.8e-30
>prophage 277
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3679244	3684623	4863332		Pandoravirus(50.0%)	3	NA	NA
WP_024177858.1|3679244_3680678_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.1	2.6e-31
WP_001366570.1|3680739_3681483_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195038.1|3681749_3684623_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
>prophage 278
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3692760	3693993	4863332		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3692760_3693993_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 279
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3718112	3719021	4863332		Yersinia_phage(100.0%)	1	NA	NA
WP_001600456.1|3718112_3719021_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	2.6e-53
>prophage 280
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3726845	3728000	4863332		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3726845_3728000_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 281
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3753830	3755093	4863332	integrase	Pseudomonas_phage(100.0%)	1	3744848:3744861	3756343:3756356
3744848:3744861	attL	TTTGCTGGCCCCAG	NA	NA	NA	NA
WP_001680727.1|3753830_3755093_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_001680727.1|3753830_3755093_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
3756343:3756356	attR	TTTGCTGGCCCCAG	NA	NA	NA	NA
>prophage 282
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3766573	3783603	4863332		Moraxella_phage(50.0%)	5	NA	NA
WP_000627719.1|3766573_3768208_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
WP_001566966.1|3768271_3771685_-	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.0	1.9e-16
WP_001255836.1|3771781_3772114_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_001680718.1|3772113_3781824_-	contact-dependent inhibition toxin CdiA	NA	A0A0R6PJK4	Moraxella_phage	37.9	1.6e-28
WP_001680716.1|3781836_3783603_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.3	7.8e-22
>prophage 283
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3798642	3800206	4863332		Yersinia_phage(50.0%)	2	NA	NA
WP_001175165.1|3798642_3799461_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	6.5e-48
WP_000706978.1|3799726_3800206_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	1.2e-12
>prophage 284
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3804600	3805584	4863332		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001355482.1|3804600_3805584_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	8.1e-37
>prophage 285
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3820038	3821277	4863332		Hokovirus(50.0%)	2	NA	NA
WP_001544928.1|3820038_3820434_-	pantoate--beta-alanine ligase	NA	A0A1V0SGE7	Hokovirus	50.0	7.3e-29
WP_001544929.1|3820602_3821277_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.7	1.2e-07
>prophage 286
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3854064	3855237	4863332		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524946.1|3854064_3855237_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 287
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3877397	3878282	4863332		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018776.1|3877397_3878282_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.3e-65
>prophage 288
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3884125	3894949	4863332		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013152.1|3884125_3884953_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_000691633.1|3885152_3886079_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848523.1|3886129_3886387_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_172636130.1|3886429_3888649_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|3888759_3890172_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|3890246_3890984_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281890.1|3891217_3893476_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
WP_000183504.1|3894021_3894504_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_000712658.1|3894556_3894949_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 289
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3901074	3913520	4863332		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_000986430.1|3901074_3902058_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	8.5e-10
WP_000940886.1|3902054_3902864_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	7.9e-14
WP_001051709.1|3903237_3905379_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195296.1|3905442_3907335_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105741.1|3907363_3907945_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|3907944_3908772_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3908796_3909219_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3909219_3909849_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|3910053_3911535_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831534.1|3911682_3912354_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	3.7e-33
WP_000442860.1|3912359_3913520_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
>prophage 290
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3921103	3921757	4863332		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076997.1|3921103_3921757_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 291
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3925669	3927103	4863332		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869179.1|3925669_3927103_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 292
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3932240	3933479	4863332	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708522.1|3932240_3933479_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	5.9e-93
>prophage 293
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3939769	3955906	4863332	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|3939769_3940783_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|3941020_3941236_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3941346_3943092_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|3943286_3945128_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228938.1|3945206_3945713_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065879.1|3945966_3946731_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018015.1|3947007_3947631_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094692.1|3947736_3949257_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_001309772.1|3949674_3951054_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.2e-32
WP_000450590.1|3951095_3951428_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212445.1|3951646_3952630_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082834.1|3952813_3955906_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.3	4.1e-159
>prophage 294
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3969526	3970492	4863332		Escherichia_phage(100.0%)	1	NA	NA
WP_001098819.1|3969526_3970492_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	1.4e-36
>prophage 295
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3985834	3987182	4863332	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100190663.1|3985834_3987182_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
>prophage 296
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	3992108	3994403	4863332		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861720.1|3992108_3994403_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.7e-157
>prophage 297
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4002101	4003247	4863332		Streptococcus_phage(100.0%)	1	NA	NA
WP_001366396.1|4002101_4003247_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	2.3e-51
>prophage 298
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4020868	4028664	4863332		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|4020868_4021732_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_000249135.1|4021796_4023833_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246837.1|4023790_4024186_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|4024205_4024796_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646049.1|4024805_4025381_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147610.1|4025493_4026534_-	permease	NA	NA	NA	NA	NA
WP_001366403.1|4026606_4027242_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|4027369_4027888_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449465.1|4027867_4028311_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189304.1|4028361_4028664_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	5.0e-14
>prophage 299
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4035695	4037597	4863332		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001306022.1|4035695_4037597_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 300
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4043073	4049712	4863332		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|4043073_4045746_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031055.1|4045770_4047258_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|4047285_4047738_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|4048368_4049712_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 301
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4053797	4056670	4863332	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|4053797_4054646_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|4054735_4056670_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 302
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4063298	4064777	4863332		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|4063298_4064270_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|4064498_4064777_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 303
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4068845	4083640	4863332		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|4068845_4069655_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922865.1|4069864_4070842_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|4070855_4071842_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|4071862_4072429_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|4072425_4073001_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|4072969_4073527_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|4073533_4074259_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|4074306_4075740_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|4075762_4076050_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|4076167_4076659_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|4076704_4077559_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|4077555_4077828_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|4078041_4078674_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047063.1|4078670_4079399_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|4079395_4080049_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|4080278_4082615_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001306030.1|4082710_4083640_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 304
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4090389	4095137	4863332		Salmonella_phage(50.0%)	5	NA	NA
WP_000445123.1|4090389_4091517_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979887.1|4091576_4092041_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209000.1|4092037_4092913_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|4092909_4093599_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108458.1|4093646_4095137_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 305
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4098842	4099340	4863332	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|4098842_4099340_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 306
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4103306	4105831	4863332	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001316675.1|4103306_4104674_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	1.3e-21
WP_000497723.1|4104763_4105831_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 307
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4122327	4123371	4863332		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4122327_4123371_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 308
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4133936	4134821	4863332		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258941.1|4133936_4134821_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	29.8	1.6e-23
>prophage 309
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4141325	4145479	4863332		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738584.1|4141325_4142351_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	4.0e-71
WP_001366395.1|4142418_4143600_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001309793.1|4143609_4144713_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078348.1|4144720_4145479_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
>prophage 310
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4155983	4157455	4863332	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|4155983_4156493_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004443.1|4156507_4157455_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.1	1.4e-06
>prophage 311
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4177332	4182906	4863332		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000031783.1|4177332_4178517_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124701.1|4178587_4180702_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	6.8e-57
WP_001138043.1|4180798_4181269_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4181365_4181740_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903375.1|4181865_4182153_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820713.1|4182160_4182520_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209710.1|4182519_4182906_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 312
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4188476	4198023	4863332		Tupanvirus(25.0%)	9	NA	NA
WP_000634794.1|4188476_4190396_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	1.9e-74
WP_000057372.1|4190395_4191418_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|4191411_4191630_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274675.1|4191683_4192553_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|4192607_4193012_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|4193313_4193946_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001366693.1|4193996_4196087_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963813.1|4196153_4197374_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601840.1|4197459_4198023_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	1.2e-61
>prophage 313
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4216928	4217765	4863332		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|4216928_4217765_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 314
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4234671	4238439	4863332		Bacillus_phage(66.67%)	3	NA	NA
WP_001306318.1|4234671_4236294_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253707.1|4236370_4237723_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001157751.1|4237719_4238439_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 315
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4245004	4245898	4863332		Sodalis_phage(100.0%)	1	NA	NA
WP_000039100.1|4245004_4245898_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.5e-69
>prophage 316
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4252058	4254452	4863332		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081881.1|4252058_4254452_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 317
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4258842	4260069	4863332		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105466.1|4258842_4260069_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	1.5e-133
>prophage 318
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4266121	4268569	4863332		Dickeya_phage(100.0%)	1	NA	NA
WP_000993440.1|4266121_4268569_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 319
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4285962	4287773	4863332		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073583.1|4285962_4286706_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	2.2e-10
WP_000907829.1|4286702_4287773_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 320
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4291299	4294311	4863332	transposase	Bacillus_phage(33.33%)	3	NA	NA
WP_100190663.1|4291299_4292647_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
WP_000416899.1|4292828_4293542_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
WP_000082101.1|4293543_4294311_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 321
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4300046	4302865	4863332		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4300046_4300901_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4301145_4302204_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|4302196_4302865_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 322
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4305871	4310003	4863332		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|4305871_4306498_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106501.1|4306571_4308770_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.6	1.1e-118
WP_000130615.1|4308871_4309117_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|4309337_4310003_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 323
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4333251	4339148	4863332		Bacillus_virus(33.33%)	6	NA	NA
WP_000173688.1|4333251_4334058_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.0e-17
WP_001190062.1|4334063_4334465_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593557.1|4334584_4334944_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001260302.1|4334940_4335216_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	2.7e-14
WP_001366710.1|4335288_4336413_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000149100.1|4336412_4339148_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	4.6e-21
>prophage 324
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4352576	4354619	4863332		Indivirus(100.0%)	1	NA	NA
WP_001366712.1|4352576_4354619_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	4.0e-46
>prophage 325
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4357967	4360103	4863332		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008965.1|4357967_4358321_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	1.3e-24
WP_001366689.1|4358375_4359665_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	7.8e-173
WP_000065801.1|4359677_4360103_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	2.8e-50
>prophage 326
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4373094	4374564	4863332		Pithovirus(50.0%)	2	NA	NA
WP_001366697.1|4373094_4373865_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	6.6e-18
WP_000123131.1|4373916_4374564_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 327
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4420979	4422964	4863332		Bacillus_virus(50.0%)	2	NA	NA
WP_000103574.1|4420979_4421984_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196479.1|4421980_4422964_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 328
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4432852	4435186	4863332		Escherichia_phage(100.0%)	1	NA	NA
WP_000013997.1|4432852_4435186_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.8	3.7e-72
>prophage 329
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4438840	4439053	4863332		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|4438840_4439053_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 330
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4443282	4444278	4863332		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182661.1|4443282_4444278_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.8	9.1e-12
>prophage 331
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4449596	4451138	4863332		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146509.1|4449596_4451138_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 332
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4472608	4474766	4863332		Acinetobacter_phage(66.67%)	3	NA	NA
WP_000499743.1|4472608_4473019_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	8.4e-20
WP_000833473.1|4473035_4473221_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	4.4e-13
WP_000061476.1|4473686_4474766_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	40.7	3.6e-62
>prophage 333
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4477886	4479731	4863332		Tupanvirus(100.0%)	1	NA	NA
WP_000582479.1|4477886_4479731_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
>prophage 334
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4512231	4521738	4863332		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024394.1|4512231_4512483_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4512624_4513056_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001361565.1|4513300_4514845_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214156.1|4514854_4516138_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483861.1|4516141_4517101_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982126.1|4517087_4518122_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000646015.1|4518360_4519386_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	2.7e-19
WP_001213834.1|4519395_4520592_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|4520805_4521738_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 335
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4525146	4527240	4863332		Catovirus(50.0%)	2	NA	NA
WP_000064000.1|4525146_4526130_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
WP_000364808.1|4526211_4527240_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.6e-11
>prophage 336
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4534678	4539241	4863332		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171872.1|4534678_4535158_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	4.8e-27
WP_001114527.1|4535196_4536006_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	3.4e-25
WP_001051798.1|4536103_4536271_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4536291_4536528_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|4536744_4537413_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050127.1|4537584_4538805_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.2	1.9e-43
WP_000976070.1|4538782_4539241_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 337
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4543798	4548819	4863332		Pseudomonas_phage(33.33%)	4	NA	NA
WP_001366765.1|4543798_4545481_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	2.5e-22
WP_001366734.1|4545738_4546362_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4546416_4546692_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|4546710_4548819_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 338
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4553119	4554511	4863332		environmental_Halophage(100.0%)	1	NA	NA
WP_001315080.1|4553119_4554511_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	99.3	7.1e-71
>prophage 339
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4586001	4587336	4863332		Moraxella_phage(100.0%)	1	NA	NA
WP_001513042.1|4586001_4587336_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 340
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4598151	4607173	4863332		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168469.1|4598151_4599840_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	1.8e-55
WP_001312198.1|4599945_4600044_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|4600608_4600698_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001306726.1|4600977_4602162_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000148043.1|4602169_4602667_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4602663_4603026_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4603015_4603363_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511309.1|4603471_4603921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828503.1|4603967_4605461_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	27.4	2.5e-29
WP_001087159.1|4605457_4607173_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	3.3e-41
>prophage 341
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4614033	4614987	4863332		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|4614033_4614462_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4614573_4614987_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 342
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4619414	4620563	4863332		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|4619414_4620563_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 343
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4625267	4632636	4863332		Bacillus_virus(33.33%)	8	NA	NA
WP_000072064.1|4625267_4627682_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.8e-115
WP_000060112.1|4627710_4628784_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673467.1|4628783_4629884_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	3.1e-53
WP_000059111.1|4629888_4631292_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|4631588_4631669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|4631898_4632039_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4632055_4632415_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4632378_4632636_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 344
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4645314	4646652	4863332		Moraxella_phage(100.0%)	1	NA	NA
WP_001316740.1|4645314_4646652_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 345
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4664009	4671524	4863332		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|4664009_4664783_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|4664873_4665764_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|4665763_4666723_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|4666808_4667849_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334098.1|4668162_4669992_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	4.3e-132
WP_000933717.1|4670153_4671524_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	1.8e-34
>prophage 346
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4683476	4684469	4863332		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|4683476_4684469_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 347
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4687637	4693490	4863332		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|4687637_4689506_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001604258.1|4689672_4690092_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|4690099_4691605_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|4691609_4692575_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|4692599_4693490_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 348
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4706884	4708531	4863332		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012604.1|4706884_4708531_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.0	2.5e-67
>prophage 349
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4716127	4721541	4863332		Bacillus_phage(33.33%)	4	NA	NA
WP_001238886.1|4716127_4718149_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001366744.1|4718195_4719680_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|4719815_4721081_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|4721211_4721541_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 350
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4725583	4731727	4863332		Enterobacteria_phage(40.0%)	6	NA	NA
WP_172636139.1|4725583_4726714_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.0	3.3e-26
WP_000006621.1|4726710_4727973_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226613.1|4727972_4729040_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000676062.1|4729058_4729940_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	2.5e-106
WP_001145185.1|4729917_4730592_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|4730596_4731727_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 351
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4739745	4741401	4863332		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395844.1|4739745_4741401_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 352
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4751707	4755566	4863332		Bacillus_phage(100.0%)	3	NA	NA
WP_000130702.1|4751707_4752604_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	2.9e-25
WP_001213584.1|4752603_4753320_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|4753403_4755566_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 353
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4762936	4764766	4863332		Catovirus(100.0%)	1	NA	NA
WP_024177878.1|4762936_4764766_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 354
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4779198	4782485	4863332		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|4779198_4780839_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|4780917_4781187_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4781190_4781706_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4781708_4782485_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 355
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4791272	4791887	4863332		Streptococcus_phage(100.0%)	1	NA	NA
WP_001366764.1|4791272_4791887_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.0	8.1e-19
>prophage 356
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4805574	4808361	4863332		uncultured_virus(100.0%)	1	NA	NA
WP_000250021.1|4805574_4808361_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 357
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4812439	4814910	4863332		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|4812439_4813849_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190578.1|4813860_4814910_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.9e-07
>prophage 358
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4822175	4826906	4863332		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|4822175_4822964_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_024177877.1|4823003_4823900_-	sugar kinase	NA	NA	NA	NA	NA
WP_001306655.1|4824072_4824951_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	1.6e-47
WP_000094547.1|4824975_4825863_+	aldolase	NA	NA	NA	NA	NA
WP_000357962.1|4825895_4826906_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 359
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4840017	4843068	4863332		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|4840017_4843068_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 360
NZ_CP051753	Escherichia coli strain SCU-102 chromosome, complete genome	4863332	4854138	4863071	4863332	integrase	Salmonella_phage(30.0%)	13	4856130:4856142	4863130:4863142
WP_001297064.1|4854138_4854759_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|4855018_4856002_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
4856130:4856142	attL	TTTCTCGTGGAGA	NA	NA	NA	NA
WP_001270247.1|4856150_4856825_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4856929_4858303_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4858299_4858998_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4859147_4859648_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|4859834_4860815_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4860884_4861178_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4861314_4861587_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|4861756_4862257_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_074484669.1|4862320_4862545_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
WP_001277900.1|4862544_4862844_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	98.0	7.1e-45
WP_001113263.1|4862846_4863071_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
4863130:4863142	attR	TCTCCACGAGAAA	NA	NA	NA	NA
