The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	359925	368291	4227167		Synechococcus_phage(50.0%)	8	NA	NA
WP_003244322.1|359925_360513_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.4	7.0e-28
WP_003242485.1|360509_361550_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.7	1.1e-63
WP_003233947.1|361651_363082_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_003244429.1|363057_365286_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-159
WP_003243954.1|365269_365953_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003219409.1|365949_366204_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003242871.1|366196_366922_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	7.0e-46
WP_003233955.1|366995_368291_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
>prophage 2
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	1335739	1391787	4227167	protease,tRNA,holin,coat,lysis	Bacillus_phage(42.86%)	57	NA	NA
WP_010886638.1|1335739_1336981_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243598.1|1337229_1337745_-	tyrZ transcriptional regulator YwaE	NA	NA	NA	NA	NA
WP_003242863.1|1337895_1338609_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_003242748.1|1338718_1339579_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.2	2.9e-06
WP_003244589.1|1339629_1340472_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_003243800.1|1340525_1341905_-	SacY negative regulator SacX	NA	NA	NA	NA	NA
WP_003243950.1|1342332_1344270_-|protease	minor protease Epr	protease	A0A1B0T6A2	Bacillus_phage	34.9	2.5e-45
WP_003242539.1|1344497_1345832_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003242887.1|1345908_1346586_+	DUF2711 domain-containing protein	NA	NA	NA	NA	NA
WP_003243380.1|1346623_1347004_-	glyoxalase GlxA	NA	NA	NA	NA	NA
WP_003244593.1|1347124_1348315_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.1	1.3e-73
WP_003243869.1|1348349_1348547_-	YwbE family protein	NA	NA	NA	NA	NA
WP_003242781.1|1348580_1349780_-	MFS transporter	NA	NA	NA	NA	NA
WP_003227371.1|1349883_1350561_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_003227375.1|1350542_1350929_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003227377.1|1351034_1351940_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003244274.1|1351947_1352766_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_003244128.1|1352762_1353431_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003243918.1|1353587_1355033_+	ferrous ion permease EfeU	NA	NA	NA	NA	NA
WP_003243208.1|1355029_1356187_+	iron uptake system lipoprotein EfeM	NA	NA	NA	NA	NA
WP_003243445.1|1356205_1357456_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_003242591.1|1357738_1358341_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003227390.1|1358371_1359913_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_003227392.1|1359909_1360218_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_003243648.1|1360660_1360819_-	transcriptional regulator SlrA	NA	NA	NA	NA	NA
WP_003227396.1|1361174_1361846_+	transcriptional regulator SlrC	NA	NA	NA	NA	NA
WP_003227398.1|1361863_1362247_+	GtrA family protein	NA	NA	NA	NA	NA
WP_003227400.1|1362327_1363500_+	galactokinase	NA	NA	NA	NA	NA
WP_003227402.1|1363503_1365045_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_009968363.1|1365115_1365361_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010886637.1|1365876_1366842_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003227407.1|1366869_1368819_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003227409.1|1368832_1369447_+	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_003227410.1|1369448_1369823_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003227411.1|1369865_1370129_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_003227413.1|1370624_1371806_+	cell shape-determining peptidoglycan glycosyltransferase RodA	NA	NA	NA	NA	NA
WP_003244098.1|1371911_1372661_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_003244349.1|1372834_1373836_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003227419.1|1373873_1376294_-|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	36.8	6.9e-21
WP_003222155.1|1376823_1377126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003243088.1|1377165_1377996_+	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003243563.1|1378034_1378805_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003227426.1|1379106_1380492_+	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_010886636.1|1380488_1381928_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	26.5	1.8e-21
WP_003243437.1|1382021_1382270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003242645.1|1382359_1383175_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003227432.1|1383318_1383657_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227434.1|1383649_1384285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009968358.1|1384332_1384866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003242519.1|1384955_1385762_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003242965.1|1385775_1386453_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
WP_003227441.1|1386477_1387848_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003243806.1|1388015_1388333_+	YwdI family protein	NA	NA	NA	NA	NA
WP_010886635.1|1388352_1389675_+	purine/pyrimidine permease	NA	NA	NA	NA	NA
WP_003227446.1|1389736_1390108_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_003227448.1|1390151_1390697_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003244383.1|1391016_1391787_+|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
>prophage 3
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	1395275	1450488	4227167	coat,tRNA,protease,bacteriocin	Enterobacteria_phage(20.0%)	56	NA	NA
WP_003243135.1|1395275_1396397_+|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_003243421.1|1396389_1397112_+|coat	spore coat polysaccharide biosynthesis protein SpsF	coat	NA	NA	NA	NA
WP_003244190.1|1397114_1398134_+|coat	spore coat polysaccharide biosynthesis protein SpsG	coat	NA	NA	NA	NA
WP_003243368.1|1398158_1398899_+	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	2.6e-48
WP_003244201.1|1398898_1399846_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_003242585.1|1399859_1400711_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.5	4.1e-37
WP_003242881.1|1400703_1401159_+|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_003242493.1|1401482_1401947_+	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_003227482.1|1402123_1403398_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003243454.1|1403624_1405172_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227487.1|1405245_1406946_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003244348.1|1406945_1408358_+	amino acid permease	NA	NA	NA	NA	NA
WP_003242790.1|1408567_1409806_+	MFS transporter	NA	NA	NA	NA	NA
WP_009968341.1|1409957_1410572_+	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_003244300.1|1410561_1411269_+	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_003243359.1|1411271_1412033_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003242921.1|1412051_1413470_+	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_003244502.1|1413466_1414651_+	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_003242568.1|1414651_1415851_+	transaminase BacF	NA	NA	NA	NA	NA
WP_003244095.1|1415865_1416645_-	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_003242896.1|1416777_1417542_-	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003243393.1|1417811_1418783_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003243173.1|1418929_1419829_+	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003227511.1|1419877_1420723_+	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_003242581.1|1420890_1421781_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003243464.1|1421924_1422701_-	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_003222050.1|1422915_1423140_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003243873.1|1423301_1424603_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003227524.1|1424638_1425139_+	YwgA family protein	NA	NA	NA	NA	NA
WP_003243988.1|1425250_1425721_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003243441.1|1425720_1427121_+	MFS transporter	NA	NA	NA	NA	NA
WP_003243399.1|1427965_1429882_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.2	6.2e-142
WP_003242889.1|1430001_1430421_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003222038.1|1430463_1430652_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003243167.1|1430760_1431420_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003244446.1|1431433_1431952_+	YwhD family protein	NA	NA	NA	NA	NA
WP_003227540.1|1432244_1434320_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003227543.1|1434521_1435352_+	spermidine synthase	NA	NA	NA	NA	NA
WP_003227545.1|1435412_1436285_+	agmatinase	NA	NA	NA	NA	NA
WP_003227547.1|1436316_1436790_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_009968329.1|1436888_1437008_-	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_003227549.1|1436991_1438137_-	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
WP_009968328.1|1438139_1438370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227552.1|1438366_1439722_+	YncE family protein	NA	NA	NA	NA	NA
WP_003244415.1|1439760_1441137_+	YncE family protein	NA	NA	NA	NA	NA
WP_003243391.1|1441142_1441844_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_003242974.1|1441840_1443121_-	insulinase family protein	NA	NA	NA	NA	NA
WP_010886633.1|1443125_1444286_-	insulinase family protein	NA	NA	NA	NA	NA
WP_003243158.1|1444275_1445586_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_003227564.1|1445578_1446298_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.3e-19
WP_003222006.1|1446294_1446456_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_003242599.1|1446468_1447815_-	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_010886632.1|1447839_1447992_-|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_003222002.1|1447948_1448080_-|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003243604.1|1448392_1448821_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003227570.1|1448817_1450488_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	1800587	1811784	4227167	holin	Anomala_cuprea_entomopoxvirus(50.0%)	14	NA	NA
WP_003243370.1|1800587_1801730_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
WP_003228349.1|1801752_1802406_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003228350.1|1802425_1803337_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003244403.1|1803354_1804044_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_003243541.1|1804263_1804536_+	sporulation delaying system autorepressor SdpR	NA	NA	NA	NA	NA
WP_003228357.1|1804532_1805156_+	immunity protein SdpI	NA	NA	NA	NA	NA
WP_003243360.1|1805202_1805814_-	sporulation delaying protein SdpC	NA	NA	NA	NA	NA
WP_003228363.1|1805856_1806828_-	sporulation-delaying protein SdpB	NA	NA	NA	NA	NA
WP_009968174.1|1806824_1807301_-	sporulation-delaying system protein SdpA	NA	NA	NA	NA	NA
WP_003243347.1|1807522_1808056_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003242811.1|1808339_1809485_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_003228370.1|1809501_1810155_+|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_003228372.1|1810166_1811087_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228374.1|1811103_1811784_+|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
>prophage 5
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	2373466	2416413	4227167	coat,tRNA,protease	Yellowstone_lake_phycodnavirus(16.67%)	39	NA	NA
WP_004398743.1|2373466_2373802_-|coat	inner spore coat protein CotQ	coat	NA	NA	NA	NA
WP_004398643.1|2374617_2376342_+	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.4	8.3e-61
WP_004399096.1|2376338_2376857_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003222549.1|2376880_2377909_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_009967929.1|2377895_2379452_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
WP_004399139.1|2379472_2380570_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_003229604.1|2380619_2382038_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_003229606.1|2382050_2382650_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003229609.1|2382768_2383773_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003229611.1|2384000_2385275_+	trigger factor	NA	NA	NA	NA	NA
WP_003229613.1|2385546_2386809_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
WP_004398923.1|2386960_2388619_+|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229618.1|2388799_2391124_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	3.4e-182
WP_003229621.1|2391120_2391708_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003229624.1|2391729_2392227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399038.1|2392456_2393824_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003222575.1|2393831_2394662_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_010886587.1|2394694_2395639_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003229629.1|2395628_2396417_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003229631.1|2396413_2397388_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_004398699.1|2397417_2398710_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003246083.1|2398840_2400568_+|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_004399056.1|2400600_2401626_+|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_003222590.1|2401644_2401836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398606.1|2402283_2404926_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003229640.1|2404985_2406278_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_010886586.1|2406417_2407164_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_004398782.1|2407297_2408296_+	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_004398496.1|2408448_2409018_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_003246034.1|2409054_2409750_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003229650.1|2409841_2410855_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_009967915.1|2410885_2411758_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004398811.1|2411754_2412273_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004398901.1|2412325_2413006_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398624.1|2413007_2413814_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398684.1|2413963_2414758_+	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_004398649.1|2414750_2415617_+	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_003229668.1|2415763_2416072_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003229669.1|2416074_2416413_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 6
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	2572345	2610487	4227167	plate,portal,tail,capsid,holin,terminase	uncultured_Caudovirales_phage(30.3%)	55	NA	NA
WP_004398704.1|2572345_2572696_-	transcriptional regulator SknR	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	30.6	2.0e-06
WP_004398958.1|2572872_2573103_+	helix-turn-helix transcriptional regulator	NA	A8ATK0	Listeria_phage	53.4	1.1e-08
WP_003229902.1|2573132_2573273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398626.1|2573346_2573916_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
WP_003245994.1|2573912_2574170_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
WP_119123069.1|2574166_2574340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229905.1|2574299_2574494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398673.1|2574599_2575559_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	72.9	2.2e-135
WP_003229907.1|2575561_2576416_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	79.0	7.1e-122
WP_010886575.1|2576491_2577169_+	DNA-binding protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	31.8	1.1e-05
WP_075058863.1|2577050_2577992_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	8.0e-58
WP_003229910.1|2577982_2578132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967809.1|2578227_2578656_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	5.6e-43
WP_003229912.1|2578737_2578944_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	71.6	5.5e-20
WP_003229913.1|2579017_2579947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398775.1|2580144_2580600_+	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	74.8	2.4e-60
WP_004398685.1|2580743_2581208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229916.1|2581275_2581995_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	55.9	1.7e-55
WP_003229917.1|2581987_2583283_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.4	1.1e-155
WP_004398894.1|2583286_2584819_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.9	4.7e-148
WP_004398748.1|2584815_2585733_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	2.4e-51
WP_003229920.1|2585773_2586427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229921.1|2586459_2587428_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.3	7.4e-59
WP_003229922.1|2587446_2588382_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	65.0	8.6e-105
WP_003229923.1|2588392_2588704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398566.1|2588707_2589103_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003229925.1|2589099_2589462_+	YqbH/XkdH family protein	NA	A0A249XXE9	Clostridium_phage	39.3	6.9e-10
WP_003246050.1|2589458_2589962_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	8.3e-38
WP_003229927.1|2589974_2590412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010886574.1|2590408_2590600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229929.1|2590600_2592001_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5MNC1	Brevibacillus_phage	39.1	4.1e-74
WP_003229930.1|2592003_2592447_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	3.2e-25
WP_075058862.1|2592700_2592790_-	type I toxin-antitoxin system toxin BsrH	NA	NA	NA	NA	NA
WP_004398662.1|2593169_2593349_-	type I toxin-antitoxin system toxin TxpA	NA	NA	NA	NA	NA
WP_003229933.1|2593494_2593944_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	41.1	2.7e-11
WP_003229934.1|2593985_2594123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003246092.1|2594125_2598883_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.3e-44
WP_004398548.1|2598875_2599535_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	4.8e-25
WP_004398524.1|2599547_2600528_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.0	2.1e-40
WP_003229938.1|2600524_2600788_+	DUF2577 family protein	NA	NA	NA	NA	NA
WP_004398572.1|2600800_2601226_+	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	36.4	1.5e-11
WP_003229940.1|2601218_2602265_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	8.3e-72
WP_003229941.1|2602248_2602827_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.5e-14
WP_003229942.1|2602823_2603096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229943.1|2603098_2604199_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_009967793.1|2604208_2604544_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003229944.1|2604540_2604705_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
WP_003246010.1|2604792_2605686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003246208.1|2605730_2606153_+|holin	holin family protein	holin	D6R405	Bacillus_phage	73.7	3.3e-48
WP_003229946.1|2606197_2607016_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	74.4	1.0e-64
WP_004399085.1|2607180_2607660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229947.1|2607675_2608038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967791.1|2608034_2608181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967790.1|2608298_2608877_-	type II toxin-antitoxin system antitoxin YqcF	NA	NA	NA	NA	NA
WP_004399034.1|2608891_2610487_-	type II toxin-antitoxin system toxin ribonuclease YqcG	NA	A0A1P8CWI7	Bacillus_phage	61.3	6.9e-78
>prophage 7
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	2840888	2846984	4227167		Staphylococcus_phage(66.67%)	8	NA	NA
WP_004398763.1|2840888_2841974_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
WP_004398505.1|2841984_2842632_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	5.0e-43
WP_004398484.1|2842646_2843843_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	6.9e-115
WP_003223915.1|2843875_2844340_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_003223910.1|2844452_2844827_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003230498.1|2844840_2845365_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003246108.1|2845645_2846401_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_003223904.1|2846390_2846984_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
>prophage 8
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	2985178	3123853	4227167	integrase,tail,holin,bacteriocin,transposase	Bacillus_phage(98.32%)	190	3054365:3054386	3116716:3116737
WP_004399080.1|2985178_2985769_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	28.6	4.9e-13
WP_004399105.1|2985823_2987461_-|integrase	serine-type integrase SprA	integrase	O64015	Bacillus_phage	100.0	2.8e-308
WP_004398623.1|2987663_2988374_+	lipoprotein	NA	O64016	Bacillus_phage	100.0	3.7e-108
WP_004398503.1|2988580_2989096_+	hypothetical protein	NA	O64017	Bacillus_phage	100.0	2.0e-95
WP_003246211.1|2989275_2989431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398929.1|2989592_2989727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004399070.1|2989746_2990565_-	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	100.0	1.9e-156
WP_004398883.1|2990868_2991351_-	PH domain-containing protein	NA	O64019	Bacillus_phage	100.0	2.5e-84
WP_004399048.1|2991364_2992255_-	endonuclease YokF	NA	O64020	Bacillus_phage	100.0	3.3e-114
WP_004399120.1|2992556_2993630_+	SPBc2 prophage-derived pesticidal crystal protein-like YokG	NA	O64021	Bacillus_phage	100.0	9.3e-204
WP_003245951.1|2993884_2994070_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003246042.1|2994153_2994711_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	100.0	3.6e-106
WP_004398855.1|2994810_2996526_+	ribonuclease YeeF family protein	NA	O64023	Bacillus_phage	99.8	1.4e-302
WP_003246188.1|2996534_2997032_+	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	100.0	1.9e-95
WP_004399123.1|2997095_2997674_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	100.0	9.4e-110
WP_004399156.1|2997709_2998243_+	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	100.0	6.2e-100
WP_009967548.1|2998521_2998638_-	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_003246138.1|2998868_2999336_+	YolA family protein	NA	O64027	Bacillus_phage	100.0	5.1e-82
WP_004398595.1|2999341_2999698_+	hypothetical protein	NA	O64028	Bacillus_phage	100.0	5.0e-61
WP_004399073.1|2999740_3000076_-	hypothetical protein	NA	O64029	Bacillus_phage	100.0	2.1e-53
WP_004398710.1|3000249_3000582_+	YolD-like family protein	NA	O64030	Bacillus_phage	100.0	1.3e-55
WP_004398504.1|3000574_3001825_+	UV-damage repair protein uvrX	NA	O64031	Bacillus_phage	100.0	4.2e-240
WP_009967545.1|3001926_3002244_+	sublancin immunity protein SunI	NA	NA	NA	NA	NA
WP_009967544.1|3002540_3002711_+|bacteriocin	bacteriocin sublancin-168	bacteriocin	NA	NA	NA	NA
WP_003246186.1|3002768_3004886_+	sublancin transporter SunT	NA	W8CYL7	Bacillus_phage	26.1	6.9e-25
WP_003230920.1|3004882_3005296_+	disulfide bond formation protein BdbA	NA	NA	NA	NA	NA
WP_004399050.1|3005295_3006564_+	SunS family peptide S-glycosyltransferase	NA	NA	NA	NA	NA
WP_009967541.1|3006560_3007007_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_004399099.1|3007062_3007329_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	50.0	1.1e-15
WP_003246119.1|3007339_3007552_-	SPBc2 prophage-derived protein BhlA	NA	A0A290GDY2	Caldibacillus_phage	59.7	4.2e-15
WP_004399108.1|3007639_3008743_-	N-acetylmuramoyl-L-alanine amidase BlyA	NA	O64040	Bacillus_phage	100.0	2.8e-187
WP_004399160.1|3008762_3008981_-	hypothetical protein	NA	A0A1P8CWN7	Bacillus_phage	100.0	1.7e-35
WP_004398829.1|3008970_3009795_-	hypothetical protein	NA	A0A1P8CWP0	Bacillus_phage	100.0	1.5e-164
WP_003246098.1|3009964_3011899_-	phosphodiester glycosidase family protein	NA	O64042	Bacillus_phage	100.0	0.0e+00
WP_010886548.1|3011935_3012757_-	hypothetical protein	NA	O64043	Bacillus_phage	100.0	1.2e-134
WP_004398800.1|3012772_3015400_-	hypothetical protein	NA	O64044	Bacillus_phage	100.0	0.0e+00
WP_004398627.1|3015411_3016170_-|tail	phage tail family protein	tail	O64045	Bacillus_phage	100.0	1.4e-145
WP_004398858.1|3016220_3023078_-	transglycosylase CwlP	NA	A0A1P8CWQ1	Bacillus_phage	67.7	0.0e+00
WP_003246141.1|3023131_3023815_-	hypothetical protein	NA	Q37974	Bacillus_phage	100.0	2.1e-116
WP_009967530.1|3023896_3024343_-	hypothetical protein	NA	O64047	Bacillus_phage	100.0	8.1e-77
WP_009966645.1|3024688_3024865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967529.1|3024889_3025576_+	hypothetical protein	NA	O64048	Bacillus_phage	100.0	2.2e-126
WP_004399258.1|3025751_3026081_+	hypothetical protein	NA	A0A1P8CWQ2	Bacillus_phage	99.1	1.2e-61
WP_009969431.1|3026083_3027085_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	100.0	4.8e-194
WP_004399281.1|3027098_3027518_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	100.0	4.8e-71
WP_004399471.1|3027501_3028002_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	100.0	5.7e-87
WP_004399574.1|3028051_3028243_-	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	100.0	3.5e-29
WP_004399254.1|3028239_3028590_-	hypothetical protein	NA	O64053	Bacillus_phage	100.0	5.4e-60
WP_004399226.1|3028600_3029818_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	100.0	2.5e-173
WP_009967523.1|3029819_3030176_-	hypothetical protein	NA	O64055	Bacillus_phage	100.0	1.4e-58
WP_009967521.1|3030239_3030467_-	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
WP_010886547.1|3030466_3031078_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	100.0	3.3e-65
WP_004399252.1|3031095_3031893_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	100.0	2.1e-91
WP_003230954.1|3031935_3032646_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	100.0	1.8e-131
WP_004399477.1|3032642_3033149_-	hypothetical protein	NA	O64060	Bacillus_phage	100.0	5.9e-92
WP_003230958.1|3033145_3033796_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	100.0	3.2e-122
WP_009967519.1|3033779_3034034_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	100.0	2.2e-39
WP_004399452.1|3034030_3034426_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	100.0	2.5e-69
WP_004399413.1|3034440_3034911_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	100.0	6.7e-82
WP_004399434.1|3034946_3035963_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	100.0	1.3e-186
WP_004399581.1|3036001_3036538_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	100.0	3.6e-95
WP_004399245.1|3036562_3037999_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	100.0	2.7e-267
WP_004399314.1|3038029_3039550_-	hypothetical protein	NA	O64068	Bacillus_phage	100.0	1.4e-282
WP_004399591.1|3039567_3041337_-	hypothetical protein	NA	O64069	Bacillus_phage	100.0	0.0e+00
WP_004399257.1|3041323_3042244_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	100.0	5.4e-176
WP_004399264.1|3042346_3042847_-	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	100.0	3.6e-89
WP_004399334.1|3043065_3043476_+	hypothetical protein	NA	A0A1P8CWT0	Bacillus_phage	100.0	8.8e-70
WP_169507058.1|3043509_3044727_-	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	100.0	3.0e-230
WP_010328101.1|3044743_3044935_-	YonK family protein	NA	A0A1P8CWT3	Bacillus_phage	100.0	1.9e-27
WP_169507059.1|3046658_3046934_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	100.0	1.5e-41
WP_169507060.1|3047196_3047811_-	hypothetical protein	NA	A0A1P8CWS4	Bacillus_phage	100.0	2.5e-113
WP_041352104.1|3048226_3050104_-	hypothetical protein	NA	A0A1P8CWS8	Bacillus_phage	100.0	0.0e+00
WP_064814709.1|3050148_3050328_-	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	100.0	3.1e-27
WP_121591845.1|3050881_3051202_+	hypothetical protein	NA	A0A1P8CWU7	Bacillus_phage	100.0	1.3e-57
WP_120028257.1|3052441_3052657_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	100.0	2.5e-31
WP_169507061.1|3052701_3052860_+	hypothetical protein	NA	A0A1P8CWU3	Bacillus_phage	100.0	9.3e-20
WP_121572580.1|3052947_3054165_+	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	100.0	2.9e-233
3054365:3054386	attL	AGAATAAAAATAAAATAACTAT	NA	NA	NA	NA
WP_169507062.1|3054524_3055379_+	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	100.0	7.3e-151
WP_169507063.1|3055384_3056305_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	100.0	5.2e-163
WP_014472015.1|3056306_3056909_+	hypothetical protein	NA	A0A1P8CWV1	Bacillus_phage	100.0	3.9e-106
WP_169507064.1|3056910_3058707_+	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	100.0	0.0e+00
WP_169507065.1|3058751_3058955_+	hypothetical protein	NA	A0A1P8CWV4	Bacillus_phage	100.0	3.0e-31
WP_059293796.1|3058986_3059262_+	hypothetical protein	NA	A0A1P8CWV2	Bacillus_phage	100.0	1.7e-45
WP_124048603.1|3059289_3059469_+	hypothetical protein	NA	A0A1P8CWU9	Bacillus_phage	100.0	8.9e-27
WP_169507066.1|3059487_3059691_+	hypothetical protein	NA	A0A1P8CWV3	Bacillus_phage	100.0	2.3e-31
WP_041352094.1|3059809_3060730_+	restriction endonuclease	NA	A0A1P8CWV0	Bacillus_phage	100.0	2.3e-171
WP_032721663.1|3061012_3061234_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	98.6	1.9e-34
WP_019712282.1|3061306_3061540_+	hypothetical protein	NA	A0A1P8CWU8	Bacillus_phage	100.0	6.6e-38
WP_041338596.1|3061637_3062273_+	hypothetical protein	NA	A0A1P8CWV5	Bacillus_phage	100.0	4.8e-115
WP_019712287.1|3062310_3062490_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	98.3	1.2e-28
WP_004399430.1|3062560_3062812_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	100.0	1.6e-37
WP_134982148.1|3062815_3063031_+	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	100.0	2.9e-32
WP_116315613.1|3063041_3063173_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	100.0	2.9e-19
WP_121572586.1|3063231_3063945_+	hypothetical protein	NA	A0A1P8CWW3	Bacillus_phage	100.0	4.0e-134
WP_121572587.1|3063934_3064630_+	hypothetical protein	NA	A0A1P8CWW4	Bacillus_phage	100.0	1.5e-125
WP_059293806.1|3064678_3065017_+	hypothetical protein	NA	A0A1P8CWV8	Bacillus_phage	100.0	7.0e-57
WP_086352547.1|3065161_3066313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134982144.1|3066343_3066475_+	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_169507067.1|3066607_3066763_+	hypothetical protein	NA	A0A1P8CWW2	Bacillus_phage	100.0	9.1e-20
WP_041338583.1|3066913_3067120_+	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	100.0	1.4e-31
WP_061187761.1|3067136_3067382_+	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	100.0	3.9e-41
WP_061187763.1|3067586_3068648_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	99.7	1.9e-201
WP_041338574.1|3068732_3070079_+	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	100.0	2.6e-251
WP_041338571.1|3070097_3071069_+|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	100.0	2.2e-180
WP_041338568.1|3071299_3071521_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	100.0	1.1e-34
WP_086352552.1|3071688_3071988_+	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	100.0	1.5e-47
WP_099043105.1|3072060_3072300_+	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	100.0	3.3e-37
WP_169507068.1|3072418_3072658_+	hypothetical protein	NA	A0A1P8CWW8	Bacillus_phage	100.0	7.4e-37
WP_004399316.1|3072693_3073029_+	hypothetical protein	NA	A0A1P8CWX6	Bacillus_phage	100.0	3.2e-46
WP_004399266.1|3073025_3073430_+	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	100.0	2.9e-73
WP_004399424.1|3073426_3073705_+	hypothetical protein	NA	A0A1P8CWX5	Bacillus_phage	100.0	9.2e-47
WP_009967502.1|3073718_3073922_+	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	100.0	5.7e-30
WP_014906374.1|3073934_3074285_+	hypothetical protein	NA	A0A1P8CWX8	Bacillus_phage	100.0	8.3e-61
WP_004399388.1|3074281_3074620_+	hypothetical protein	NA	O64111	Bacillus_phage	100.0	8.9e-52
WP_004399569.1|3074626_3075034_+	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	100.0	2.6e-74
WP_004399389.1|3075074_3075830_+	SPBc2 prophage-derived antirepressor protein YoqD	NA	A0A1P8CWY0	Bacillus_phage	100.0	1.1e-137
WP_169507056.1|3075886_3076201_+	hypothetical protein	NA	A0A1P8CWY4	Bacillus_phage	100.0	4.0e-54
WP_169507069.1|3076228_3076486_+	hypothetical protein	NA	A0A1P8CWY1	Bacillus_phage	100.0	2.3e-44
WP_169507101.1|3076505_3076766_+	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	100.0	7.6e-43
WP_169507070.1|3076783_3077458_+	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	100.0	8.6e-131
WP_147797696.1|3077477_3077681_+	hypothetical protein	NA	O64120	Bacillus_phage	98.5	2.5e-33
WP_169507102.1|3077720_3078413_+	HNH endonuclease	NA	A0A1P8CWZ4	Bacillus_phage	100.0	2.3e-131
WP_169507071.1|3078557_3078779_+	hypothetical protein	NA	O64123	Bacillus_phage	98.6	7.9e-33
WP_009967489.1|3078795_3079170_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	100.0	3.4e-60
WP_003231051.1|3079283_3079574_+	hypothetical protein	NA	A0A1P8CWY9	Bacillus_phage	100.0	4.2e-50
WP_169507072.1|3079660_3079813_-	hypothetical protein	NA	A0A1P8CWZ1	Bacillus_phage	100.0	1.2e-21
WP_003231052.1|3079959_3080799_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	100.0	2.3e-157
WP_169507073.1|3080962_3081376_+	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	100.0	5.2e-78
WP_169507074.1|3081441_3082254_-	ATP-dependent DNA ligase	NA	A0A1P8CWY5	Bacillus_phage	100.0	7.4e-153
WP_169507075.1|3082843_3083065_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	100.0	3.1e-37
WP_032721740.1|3083297_3083519_+	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	100.0	2.9e-35
WP_169507076.1|3083567_3084455_+	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	100.0	2.3e-168
WP_169507077.1|3084444_3084717_+	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	100.0	2.2e-45
WP_014721243.1|3084719_3084866_+	hypothetical protein	NA	A0A1P8CWZ9	Bacillus_phage	100.0	1.7e-12
WP_157680842.1|3084871_3085021_+	hypothetical protein	NA	A0A1P8CX03	Bacillus_phage	100.0	3.9e-20
WP_041338506.1|3085083_3085464_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	100.0	2.9e-67
WP_041338755.1|3086519_3086888_+	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	99.2	5.5e-63
WP_169507078.1|3086906_3087821_+	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	100.0	1.0e-171
WP_004399537.1|3087903_3088875_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
WP_009967478.1|3088917_3089388_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	100.0	1.4e-87
WP_004399302.1|3089402_3090917_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	100.0	3.6e-286
WP_009967477.1|3090932_3092069_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	100.0	1.2e-225
WP_169507079.1|3092068_3093799_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	100.0	0.0e+00
WP_169507080.1|3093811_3097729_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	99.6	0.0e+00
WP_052471015.1|3097803_3098454_+	hypothetical protein	NA	A0A1P8CX16	Bacillus_phage	48.5	1.2e-20
WP_064814903.1|3098465_3098681_+	YorP family protein	NA	O64150	Bacillus_phage	97.2	3.9e-37
WP_041338484.1|3098673_3098829_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	94.1	5.7e-22
WP_169507081.1|3098828_3099326_+	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	95.8	4.0e-85
WP_169507082.1|3099334_3099853_+	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	97.1	3.8e-94
WP_169507083.1|3099913_3100894_+	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	100.0	5.0e-196
WP_004399270.1|3100976_3102308_+	DNA (cytosine-5-)-methyltransferase	NA	Q77YW9	Bacillus_phage	100.0	1.5e-256
WP_041352027.1|3102359_3102578_+	hypothetical protein	NA	A0A1P8CX26	Bacillus_phage	100.0	2.5e-31
WP_169507084.1|3102580_3102946_+	hypothetical protein	NA	A0A1P8CX18	Bacillus_phage	100.0	1.4e-63
WP_041056330.1|3102985_3103213_+	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	100.0	2.7e-36
WP_017697090.1|3103727_3103901_+	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	100.0	2.1e-25
WP_041056324.1|3104313_3104634_+	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	100.0	8.7e-57
WP_169507085.1|3104646_3105069_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	100.0	1.0e-76
WP_169507086.1|3105527_3105740_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	100.0	7.3e-36
WP_169507087.1|3105756_3106023_+	hypothetical protein	NA	A0A1P8CX38	Bacillus_phage	100.0	4.3e-41
WP_169507088.1|3106045_3106768_+	hypothetical protein	NA	A0A1P8CX45	Bacillus_phage	100.0	3.0e-137
WP_014471944.1|3106769_3107123_+	hypothetical protein	NA	A0A1P8CX44	Bacillus_phage	100.0	3.8e-61
WP_017697102.1|3107122_3107518_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	100.0	6.1e-68
WP_169507089.1|3107480_3110735_+	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	100.0	0.0e+00
WP_004399561.1|3111756_3112278_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	100.0	7.4e-98
WP_004399328.1|3112858_3113101_+	thioredoxin family protein	NA	A0A1P8CX24	Bacillus_phage	100.0	1.4e-38
WP_004399492.1|3113146_3113575_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	100.0	5.4e-78
WP_004399409.1|3113669_3114119_+	SPBc2 prophage-derived transcriptional regulator YosT	NA	A0A1P8CX48	Bacillus_phage	100.0	2.0e-83
WP_009967458.1|3114158_3114404_-	hypothetical protein	NA	A0A1P8CX50	Bacillus_phage	100.0	1.6e-31
WP_169507090.1|3114559_3114727_+	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	100.0	4.6e-25
WP_169507091.1|3114731_3115037_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	100.0	6.4e-49
WP_032721835.1|3115020_3115236_+	hypothetical protein	NA	A0A1P8CX47	Bacillus_phage	100.0	3.7e-35
WP_153912230.1|3115350_3115695_+	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	99.1	2.3e-55
WP_169507092.1|3115751_3116591_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	100.0	6.0e-166
WP_169507093.1|3116863_3117217_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	100.0	9.6e-57
3116716:3116737	attR	AGAATAAAAATAAAATAACTAT	NA	NA	NA	NA
WP_169507094.1|3117229_3117949_+	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	100.0	2.8e-135
WP_109962699.1|3118513_3118702_+	hypothetical protein	NA	A0A1P8CX75	Bacillus_phage	100.0	1.2e-26
WP_042976081.1|3118782_3118995_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	100.0	4.1e-31
WP_004399249.1|3119261_3119453_+	hypothetical protein	NA	A0A1P8CX54	Bacillus_phage	100.0	1.0e-33
WP_009967449.1|3119492_3119624_+	rubrerythrin family protein	NA	A0A1P8CX61	Bacillus_phage	100.0	2.6e-20
WP_009967447.1|3119659_3119806_+	hypothetical protein	NA	A0A1P8CX49	Bacillus_phage	100.0	1.0e-17
WP_010886536.1|3119837_3119915_+	hypothetical protein	NA	A0A1P8CX55	Bacillus_phage	100.0	7.4e-07
WP_010886535.1|3119927_3120245_+	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	100.0	2.1e-55
WP_010886534.1|3120260_3120434_+	hypothetical protein	NA	O64190	Bacillus_phage	100.0	3.4e-23
WP_004399562.1|3120430_3120793_+	hypothetical protein	NA	A0A1P8CX73	Bacillus_phage	100.0	1.1e-63
WP_169507095.1|3120860_3121310_+	hypothetical protein	NA	A0A1P8CX70	Bacillus_phage	100.0	1.0e-79
WP_169507096.1|3121392_3121722_+	hypothetical protein	NA	A0A1P8CX80	Bacillus_phage	100.0	1.4e-57
WP_169507103.1|3121774_3121960_+	hypothetical protein	NA	O64193	Bacillus_phage	88.5	2.1e-23
WP_041336530.1|3121961_3122204_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	100.0	1.5e-40
WP_169507097.1|3122278_3122866_+	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	100.0	3.3e-110
WP_169507098.1|3123100_3123853_-	hypothetical protein	NA	A0A1P8CX59	Bacillus_phage	100.0	1.3e-146
>prophage 9
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	3198622	3204309	4227167		Bacillus_phage(100.0%)	10	NA	NA
WP_009967409.1|3198622_3198958_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	86.5	7.2e-46
WP_003231333.1|3199166_3199460_+	YolD-like family protein	NA	O64030	Bacillus_phage	86.6	7.5e-39
WP_010886527.1|3199452_3199800_+	DNA repair protein YozK	NA	O64031	Bacillus_phage	95.7	1.5e-57
WP_003231337.1|3199836_3200490_+	DNA repair protein YobH	NA	O64031	Bacillus_phage	95.3	6.2e-118
WP_004399440.1|3200615_3200738_-	phosphatase RapK inhibitor PhrK	NA	NA	NA	NA	NA
WP_003231340.1|3200734_3201850_-	response regulator aspartate phosphatase RapK	NA	D6R410	Bacillus_phage	49.2	1.5e-95
WP_010886526.1|3202922_3203183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231345.1|3203307_3203763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967407.1|3203766_3203991_-	hypothetical protein	NA	A0A1P8CWZ1	Bacillus_phage	82.0	8.9e-16
WP_003231348.1|3204135_3204309_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	82.5	5.6e-18
>prophage 10
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	3388828	3395383	4227167		Bacillus_phage(50.0%)	6	NA	NA
WP_003231746.1|3388828_3389797_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_003244862.1|3390420_3391188_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	9.1e-52
WP_003245105.1|3391251_3391872_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_003231754.1|3391921_3392911_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245700.1|3392928_3395031_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	87.0	0.0e+00
WP_003231758.1|3394990_3395383_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
>prophage 11
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	3904714	3949550	4227167	plate,protease,portal,tail,holin,terminase	uncultured_Caudovirales_phage(27.78%)	58	NA	NA
WP_009967069.1|3904714_3906064_+|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	5.7e-25
WP_003245413.1|3906221_3906398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232632.1|3906581_3907553_-	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.0	1.9e-62
WP_003245387.1|3907564_3909715_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_003244977.1|3909722_3909869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245086.1|3909969_3910920_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_003244819.1|3911308_3912625_+	serine/threonine exchanger	NA	NA	NA	NA	NA
WP_003218470.1|3912900_3913518_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_003232642.1|3913530_3914532_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_003244695.1|3914641_3915388_+	toxin-antitoxin-antitoxin system toxin SpoIISA	NA	NA	NA	NA	NA
WP_003232646.1|3915387_3915558_+	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
WP_003232648.1|3915643_3915781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245230.1|3915817_3916711_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
WP_003232653.1|3916723_3916987_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
WP_003232655.1|3916999_3917269_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	6.2e-24
WP_003245597.1|3917321_3918161_-	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_003232658.1|3918204_3918369_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	66.0	3.2e-15
WP_003232660.1|3918365_3918695_-	phage-like element PBSX protein XkdW	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	41.3	1.7e-15
WP_003244681.1|3918706_3920770_-	phage-like element PBSX protein XkdV	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	37.4	4.8e-31
WP_003232665.1|3920772_3921045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244743.1|3921041_3921620_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.0e-15
WP_009967060.1|3921603_3922650_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	4.4e-73
WP_003232671.1|3922642_3923068_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	7.8e-13
WP_003244812.1|3923124_3923391_-	DUF2577 family protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_003245730.1|3923390_3924368_-	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_003232674.1|3924383_3925043_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	3.7e-25
WP_010886493.1|3925035_3929034_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	44.9	2.1e-43
WP_003239113.1|3929035_3929185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232676.1|3929214_3929661_-	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
WP_003232677.1|3929752_3930196_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003245369.1|3930197_3931598_-	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232679.1|3931594_3931813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232680.1|3931816_3932257_-	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_003245226.1|3932269_3932755_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_009967053.1|3932751_3933108_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003245011.1|3933104_3933488_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.2	1.9e-13
WP_003232690.1|3933509_3934445_-	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_003245836.1|3934470_3935298_-	phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
WP_003245427.1|3935317_3936805_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003245584.1|3936808_3938110_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.2	2.4e-153
WP_003244697.1|3938106_3938904_-|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_003245797.1|3939019_3939529_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.9e-21
WP_003244900.1|3939644_3939851_-	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.6e-11
WP_003245290.1|3939847_3940198_-	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_003245588.1|3940282_3940450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886492.1|3940449_3941250_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_003245799.1|3941149_3941986_-	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
WP_003232712.1|3941972_3942152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232719.1|3942329_3942671_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232721.1|3942833_3943430_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003245071.1|3943473_3944310_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_003244789.1|3944386_3944989_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_003245254.1|3945094_3945472_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	6.1e-17
WP_003244876.1|3945511_3946465_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	74.1	7.3e-67
WP_003232731.1|3946585_3946843_+	YciI family protein	NA	NA	NA	NA	NA
WP_003245487.1|3946873_3947008_-	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_010886491.1|3946997_3948134_-	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	8.3e-94
WP_003245490.1|3948278_3949550_-	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
>prophage 12
NZ_CP051860	Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome	4227167	3983128	4014561	4227167	coat,tRNA	uncultured_Caudovirales_phage(40.0%)	41	NA	NA
WP_003245601.1|3983128_3983377_+|coat	spore coat protein CotT	coat	NA	NA	NA	NA
WP_010886488.1|3983499_3984489_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_003232822.1|3985108_3985438_+	YjdJ family protein	NA	NA	NA	NA	NA
WP_003232825.1|3985603_3985798_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_003244878.1|3985837_3986317_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_009967031.1|3986545_3986941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232828.1|3987159_3987666_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010886487.1|3987711_3988194_-	YjdF family protein	NA	NA	NA	NA	NA
WP_003232833.1|3988363_3989311_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_003245781.1|3989325_3991278_-	PTS mannose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_003245617.1|3991425_3993372_-	mannose transport/utilization transcriptional regulator ManR	NA	NA	NA	NA	NA
WP_003232839.1|3993922_3994270_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_003245148.1|3994418_3995174_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010886486.1|3995410_3995728_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003245120.1|3995901_3996429_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	55.0	8.2e-36
WP_003245536.1|3996589_3996874_-	hypothetical protein	NA	Q9AYW8	Lactococcus_phage	33.3	3.1e-05
WP_003245581.1|3996885_3997389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245063.1|3997654_3998116_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	46.7	1.8e-23
WP_003245022.1|3998152_3998326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967026.1|3998341_3998473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967025.1|3998625_3998946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967023.1|3999071_4000301_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_003245507.1|4000371_4000530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967022.1|4001386_4002577_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_003245116.1|4002646_4003192_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003244787.1|4003224_4004397_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_003232857.1|4004389_4005511_-	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
WP_003245358.1|4005866_4006589_+	esterase family protein	NA	NA	NA	NA	NA
WP_003232861.1|4006625_4007141_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_003245407.1|4007144_4007567_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232866.1|4007639_4007894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245380.1|4008010_4010290_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.8	1.0e-90
WP_003232870.1|4010363_4010618_-	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_003232872.1|4010750_4010900_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_003244769.1|4010981_4011188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244844.1|4011469_4011826_-	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_003244871.1|4011985_4012372_+|coat	spore coat protein CotV	coat	NA	NA	NA	NA
WP_003245818.1|4012412_4012730_+|coat	spore coat protein CotW	coat	NA	NA	NA	NA
WP_003244668.1|4012828_4013347_+|coat	spore coat protein CotX	coat	NA	NA	NA	NA
WP_003239243.1|4013498_4013987_+|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_003244982.1|4014114_4014561_+|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
