The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051642	Avibacterium paragallinarum strain ADL-AP01 chromosome, complete genome	2415542	257921	279057	2415542	integrase	Mannheimia_phage(44.44%)	33	255931:255982	282202:282253
255931:255982	attL	GACCAATCCCGACTTTCGTTTGAAAGTGGGTATATCCTAAATTAAAGGGCGG	NA	NA	NA	NA
WP_035689252.1|257921_258818_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	49.7	2.9e-73
WP_051128140.1|258877_259273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051128139.1|259269_259587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689249.1|259673_260153_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	53.5	1.4e-39
WP_046097549.1|260140_260773_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	68.6	1.0e-77
WP_035689246.1|260769_261549_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	62.1	9.8e-86
WP_035689276.1|261559_262501_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	48.0	1.2e-45
WP_035689243.1|263379_263655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097548.1|263676_263985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168952571.1|264078_264651_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	76.4	5.2e-20
WP_017806446.1|265323_265545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807323.1|265559_265730_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_136711940.1|266048_266345_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	58.3	2.5e-26
WP_017807324.1|266345_266636_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	47.7	1.1e-13
WP_017807325.1|266782_267556_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_017807326.1|267557_268043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807327.1|268042_268696_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	70.1	1.0e-67
WP_017807328.1|268833_269040_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168939907.1|269545_269953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097539.1|270062_270833_+	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	45.4	1.3e-45
WP_035689420.1|270829_271636_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	62.0	3.3e-28
WP_165381618.1|271659_272316_+	hypothetical protein	NA	A0A0M3LS65	Mannheimia_phage	42.2	4.4e-39
WP_052716788.1|272424_273060_+	DUF1367 family protein	NA	A0A2I7RNU5	Vibrio_phage	29.6	3.8e-19
WP_035689367.1|273060_273345_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	80.6	2.0e-36
WP_035689370.1|273670_274021_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	42.1	6.2e-16
WP_035689371.1|274020_274383_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_035689374.1|274627_275632_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	24.4	3.8e-05
WP_017807323.1|275929_276100_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_017806446.1|276114_276336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035660437.1|276592_276910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807508.1|276913_277171_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	53.6	2.0e-11
WP_051128146.1|277151_277859_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_046097210.1|278091_279057_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	39.0	3.6e-61
282202:282253	attR	CCGCCCTTTAATTTAGGATATACCCACTTTCAAACGAAAGTCGGGATTGGTC	NA	NA	NA	NA
>prophage 2
NZ_CP051642	Avibacterium paragallinarum strain ADL-AP01 chromosome, complete genome	2415542	285926	292406	2415542	integrase	Mannheimia_phage(25.0%)	10	280895:280910	293403:293418
280895:280910	attL	GATCACATCAATAACA	NA	NA	NA	NA
WP_035688053.1|285926_286427_+	siphovirus Gp157 family protein	NA	A0A0E3U2R8	Fusobacterium_phage	35.5	3.8e-14
WP_035688055.1|286437_287325_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	55.9	1.3e-57
WP_035688057.1|287324_287804_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	52.8	2.1e-38
WP_035688059.1|287812_288061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035688062.1|288103_288418_+	hypothetical protein	NA	X2CY11	Brucella_phage	40.2	3.6e-07
WP_035688065.1|288440_288623_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	52.6	4.0e-06
WP_035688068.1|288932_289142_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	58.1	6.1e-11
WP_035688071.1|289656_290319_+	KilA-N domain-containing protein	NA	D0UIM5	Aggregatibacter_phage	43.2	6.5e-14
WP_051128099.1|290562_291159_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_035688073.1|291386_292406_+|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	88.2	2.3e-175
293403:293418	attR	TGTTATTGATGTGATC	NA	NA	NA	NA
>prophage 3
NZ_CP051642	Avibacterium paragallinarum strain ADL-AP01 chromosome, complete genome	2415542	1464484	1487488	2415542		Mannheimia_phage(52.63%)	37	NA	NA
WP_081637566.1|1464484_1465384_-	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	72.1	5.5e-48
WP_035689183.1|1465728_1465947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081637567.1|1465939_1467166_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	49.3	5.0e-44
WP_046097530.1|1467388_1467667_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_026138622.1|1467676_1467970_+	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	48.7	4.7e-09
WP_017807426.1|1468079_1468742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807425.1|1468731_1469373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689190.1|1469446_1470043_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	43.4	9.6e-33
WP_035689209.1|1470367_1470805_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	71.0	8.5e-55
WP_035689193.1|1470813_1471407_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	56.8	6.4e-53
WP_035689196.1|1471403_1472243_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	48.9	4.4e-68
WP_035689199.1|1472235_1473048_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	45.6	1.1e-15
WP_035689202.1|1473044_1473818_-	Rha family transcriptional regulator	NA	A0A2D0YGX8	Vibrio_phage	42.0	6.6e-42
WP_035689204.1|1473864_1474326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097532.1|1474374_1474596_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	44.6	3.2e-10
WP_046097533.1|1474695_1475361_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	77.0	2.0e-71
WP_156127790.1|1475967_1476372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689467.1|1476374_1476815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807323.1|1477174_1477345_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_017806446.1|1477359_1477581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168952571.1|1478253_1478826_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	76.4	5.2e-20
WP_046097548.1|1478919_1479228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689243.1|1479249_1479525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689276.1|1480403_1481345_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	48.0	1.2e-45
WP_035689246.1|1481355_1482135_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	62.1	9.8e-86
WP_046097549.1|1482131_1482764_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	68.6	1.0e-77
WP_035689249.1|1482751_1483231_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	53.5	1.4e-39
WP_051128139.1|1483317_1483635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051128140.1|1483631_1484027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689252.1|1484086_1484983_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	49.7	2.9e-73
WP_035689255.1|1484979_1485189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807560.1|1485204_1485402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689257.1|1485404_1485734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051128141.1|1485849_1486353_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	32.5	1.6e-12
WP_035689260.1|1486345_1486579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689262.1|1486654_1486939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689265.1|1487005_1487488_+	methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	72.3	7.7e-65
>prophage 4
NZ_CP051642	Avibacterium paragallinarum strain ADL-AP01 chromosome, complete genome	2415542	1678477	1765306	2415542	tail,plate,holin,capsid,tRNA,transposase,terminase	Haemophilus_phage(23.94%)	105	NA	NA
WP_046097356.1|1678477_1678963_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_035687040.1|1679158_1680304_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_017807042.1|1680318_1681122_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_017807041.1|1681404_1682223_+	DNA ligase	NA	A0A1X9VNU1	Mimivirus	29.4	3.6e-30
WP_035687043.1|1682633_1683863_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_035687045.1|1683892_1685923_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_035695974.1|1686240_1687917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124994873.1|1687906_1689454_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.3	4.0e-22
WP_046097314.1|1689456_1690185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939946.1|1690554_1691727_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.2	1.6e-116
WP_168939947.1|1691716_1693153_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.8	1.2e-17
WP_035688629.1|1693259_1694426_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_046097312.1|1694435_1695578_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_035688630.1|1695577_1696375_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_035688632.1|1696371_1697019_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	1.9e-10
WP_124994912.1|1697691_1697943_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035688634.1|1698439_1699066_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	34.4	5.7e-12
WP_035688639.1|1699065_1699491_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	41.3	3.3e-19
WP_017807028.1|1699483_1700167_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	48.9	1.1e-53
WP_017807029.1|1700341_1700665_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_035685198.1|1702304_1703984_-|tail	tail fiber protein	tail	Q7Y5S2	Haemophilus_phage	36.3	1.5e-11
WP_017805938.1|1703993_1704608_-	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	35.8	9.0e-18
WP_035685201.1|1704616_1706053_-|plate	baseplate J/gp47 family protein	plate	E5AGC3	Erwinia_phage	29.8	1.7e-43
WP_017805941.1|1706045_1706411_-	hypothetical protein	NA	D4N458	Pseudomonas_phage	36.9	1.1e-10
WP_017805942.1|1706407_1707079_-|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	33.8	5.6e-21
WP_035685202.1|1707071_1708037_-	hypothetical protein	NA	M4SNA5	Psychrobacter_phage	30.9	3.5e-24
WP_017805944.1|1708014_1708347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168939948.1|1708454_1709297_-	phage antirepressor N-terminal domain-containing protein	NA	A0A0M3LR56	Mannheimia_phage	71.8	2.3e-48
WP_168939949.1|1709622_1710774_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	30.3	6.2e-36
WP_035685204.1|1710905_1711499_-	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	26.5	1.3e-08
WP_017805948.1|1711588_1711771_+	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	47.5	1.4e-06
WP_017805949.1|1711814_1712234_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A2H4JFV9	uncultured_Caudovirales_phage	46.4	9.4e-27
WP_017805950.1|1712271_1714530_-	tape measure protein	NA	K7RVL7	Vibrio_phage	29.4	1.5e-33
WP_017805951.1|1714526_1714679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805952.1|1714714_1715200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805953.1|1715199_1715628_-	DUF3277 family protein	NA	A0A2H4P8K8	Pseudomonas_phage	38.3	4.6e-21
WP_017805954.1|1715679_1716753_-	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	35.5	5.3e-66
WP_017805955.1|1716739_1717249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805956.1|1717250_1717610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685207.1|1717609_1718068_-	hypothetical protein	NA	D0UII8	Aggregatibacter_phage	29.0	2.2e-08
WP_017805958.1|1718051_1718405_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_017805960.1|1718635_1719589_-	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	37.6	3.6e-50
WP_017805961.1|1719662_1720079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685209.1|1720090_1721146_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.5	3.9e-53
WP_017805963.1|1721233_1721668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685212.1|1722790_1724098_-	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	31.4	3.3e-46
WP_046097305.1|1724100_1725450_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	59.0	5.4e-148
WP_017806476.1|1725430_1725958_-|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	43.2	2.4e-19
WP_168939950.1|1725968_1726223_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	56.8	2.3e-20
WP_168939980.1|1726206_1726419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168939979.1|1726387_1726750_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_168939951.1|1726709_1727117_-	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	64.4	1.5e-45
WP_017807585.1|1727109_1727442_-|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	36.8	4.1e-09
WP_130239081.1|1727596_1727914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807600.1|1728001_1728514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689440.1|1728697_1729102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689442.1|1729092_1729698_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	44.9	2.3e-34
WP_035689454.1|1730006_1730660_+	hypothetical protein	NA	D0UIM5	Aggregatibacter_phage	37.6	1.2e-31
WP_168939952.1|1730697_1731123_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	62.1	3.5e-45
WP_103853787.1|1731112_1731340_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	42.6	1.5e-07
WP_168939953.1|1731339_1732017_-	hypothetical protein	NA	A0A1P8DTF3	Proteus_phage	35.7	1.1e-27
WP_168939954.1|1732016_1732754_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	45.1	5.0e-47
WP_046097539.1|1732750_1733521_-	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	45.4	1.3e-45
WP_082082238.1|1733630_1734038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689502.1|1734085_1734379_-	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	79.2	1.6e-36
WP_035689499.1|1734401_1734602_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	44.6	1.0e-07
WP_035689497.1|1734721_1735480_+	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	26.1	6.5e-18
WP_017807600.1|1735656_1736169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046097541.1|1736434_1736977_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	34.9	2.5e-19
WP_017807585.1|1737080_1737413_+|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	36.8	4.1e-09
WP_168939951.1|1737405_1737813_+	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	64.4	1.5e-45
WP_168939979.1|1737772_1738135_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_168939980.1|1738103_1738316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939950.1|1738299_1738554_+	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	56.8	2.3e-20
WP_115615517.1|1738564_1739077_+|terminase	terminase small subunit	terminase	A0A0M3LSU1	Mannheimia_phage	59.8	1.2e-44
WP_046097804.1|1739057_1740407_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	58.3	3.0e-143
WP_046097263.1|1740403_1741720_+	DUF1073 domain-containing protein	NA	D0UIJ6	Aggregatibacter_phage	52.8	5.1e-119
WP_168939955.1|1741640_1743038_+|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	45.1	6.5e-56
WP_168939956.1|1743040_1743322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939957.1|1743389_1744511_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	60.2	7.0e-85
WP_017807108.1|1744510_1744963_+	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	52.7	3.6e-32
WP_035688838.1|1744975_1745878_+	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	62.8	3.0e-102
WP_017807106.1|1745886_1746237_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	51.7	2.4e-23
WP_035688835.1|1746233_1746677_+	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	49.6	3.3e-30
WP_017807104.1|1746673_1747021_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	47.9	4.0e-23
WP_051052690.1|1746944_1747457_+	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	50.6	1.0e-35
WP_168939958.1|1747460_1748963_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	74.9	3.9e-216
WP_017807101.1|1748972_1749401_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	78.2	7.3e-59
WP_017807100.1|1749403_1749829_+	hypothetical protein	NA	Q776V6	Haemophilus_phage	56.2	3.6e-34
WP_051128129.1|1749958_1751893_+|tail	phage tail tape measure protein	tail	D0UII2	Aggregatibacter_phage	48.2	4.7e-04
WP_035688832.1|1751895_1752243_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	55.3	8.1e-24
WP_081637560.1|1752226_1752481_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	55.8	1.4e-17
WP_035688830.1|1752548_1753310_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	53.5	3.0e-63
WP_035688827.1|1753313_1753616_+	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	56.8	6.1e-28
WP_082082221.1|1753591_1754431_+	replication initiation protein	NA	A0A1V0E006	Clostridioides_phage	35.7	2.2e-14
WP_103846642.1|1755615_1756464_+	hemin receptor	NA	NA	NA	NA	NA
WP_017806206.1|1756426_1757023_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_017806205.1|1757025_1757733_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_035688856.1|1758079_1758406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130231609.1|1759576_1760413_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	71.5	3.7e-115
WP_081637559.1|1760409_1761057_+|plate	baseplate protein	plate	D0UIH7	Aggregatibacter_phage	60.8	7.6e-68
WP_081637558.1|1761053_1761404_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	66.7	8.6e-42
WP_035688818.1|1761454_1762585_+|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	66.6	7.7e-140
WP_046097796.1|1762584_1763163_+	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	67.9	1.2e-72
WP_046097262.1|1763167_1765306_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	37.1	7.6e-64
